diff --git a/001 Two Sum.py b/001 Two Sum.py index cc13d16..88e5548 100644 --- a/001 Two Sum.py +++ b/001 Two Sum.py @@ -52,5 +52,6 @@ def twoSum(self, num, target): if ind1!=ind2: return ind1+1, ind2+1 + if __name__=="__main__": print Solution().twoSum([3, 2, 4], 6) \ No newline at end of file diff --git a/002 Median of Two Sorted Arrays.py b/002 Median of Two Sorted Arrays.py index 28b1d52..8aebcfa 100644 --- a/002 Median of Two Sorted Arrays.py +++ b/002 Median of Two Sorted Arrays.py @@ -3,6 +3,8 @@ run time complexity should be O(log (m+n)). """ __author__ = 'Danyang' + + class Solution: def findMedianSortedArrays(self, A, B): """ @@ -28,7 +30,7 @@ def findMedianSortedArrays(self, A, B): """ m = len(A) n = len(B) - if((m+n)&1==0): + if ((m+n)&1 == 0): return (self.find_kth(A, B, (m+n)/2)+self.find_kth(A, B, (m+n)/2-1))/2.0 else: return self.find_kth(A, B, (m+n)/2) @@ -41,32 +43,23 @@ def find_kth(self, A, B, k): :param k: index starting from 0 :return: """ - if not A: - return B[k] - if not B: - return A[k] - - if k==0: - return min(A[0], B[0]) - - m = len(A) - n = len(B) + if not A: return B[k] + if not B: return A[k] + if k == 0: return min(A[0], B[0]) + m, n = len(A), len(B) # pay attention to consider the equal sign. Assigning equal sign is an art. - if A[m/2]>B[n/2]: - if k>m/2+n/2: - return self.find_kth(A, B[n/2+1:], k-n/2-1) # exclude B[n/2] + if A[m/2] >= B[n/2]: + if k > m/2+n/2: + return self.find_kth(A, B[n/2+1:], k-n/2-1) # exclude B[n/2] to make progress else: - return self.find_kth(A[:m/2], B, k) # exclude A[m/2] + return self.find_kth(A[:m/2], B, k) # exclude A[m/2] to make progress else: - if k>m/2+n/2: - return self.find_kth(A[m/2+1:], B, k-m/2-1) # exclude A[m/2] - else: - return self.find_kth(A, B[:n/2], k) # exclude B[n/2] + return self.find_kth(B, A, k) -if __name__=="__main__": - assert Solution().findMedianSortedArrays([1,2], [1,2,3])==2 - assert Solution().findMedianSortedArrays([1, 2], [3])==2 - assert Solution().findMedianSortedArrays([1], [2, 3])==2 - assert Solution().findMedianSortedArrays([1, 2], [1, 2])==1.5 +if __name__ == "__main__": + assert Solution().findMedianSortedArrays([1, 2], [1, 2, 3]) == 2 + assert Solution().findMedianSortedArrays([1, 2], [3]) == 2 + assert Solution().findMedianSortedArrays([1], [2, 3]) == 2 + assert Solution().findMedianSortedArrays([1, 2], [1, 2]) == 1.5 diff --git a/003 Longest Substring Without Repeating Characters.py b/003 Longest Substring Without Repeating Characters.py index 3918520..c9c5747 100644 --- a/003 Longest Substring Without Repeating Characters.py +++ b/003 Longest Substring Without Repeating Characters.py @@ -4,6 +4,8 @@ is "b", with the length of 1. """ __author__ = 'Danyang' + + class Solution: def lengthOfLongestSubstring(self, s): """ @@ -21,7 +23,7 @@ def lengthOfLongestSubstring(self, s): start = 0 # pointer for ind, val in enumerate(s): - if visited_last_index[ord(val)]==-1: + if visited_last_index[ord(val)] == -1: longest = max(longest, (ind)-start+1) else: longest = max(longest, (ind-1)-start+1) diff --git a/004 Add Two Numbers.py b/004 Add Two Numbers.py index 7da571f..dcc6364 100644 --- a/004 Add Two Numbers.py +++ b/004 Add Two Numbers.py @@ -7,7 +7,8 @@ """ __author__ = 'Danyang' -# Definition for singly-linked list. + + class ListNode: def __init__(self, x): self.val = x @@ -17,6 +18,7 @@ def __repr__(self): # for debugging return repr(self.val) + class Solution: def addTwoNumbers(self, l1, l2): """ @@ -34,8 +36,8 @@ def addTwoNumbers(self, l1, l2): cur2 = l2 cur = result_head while cur1 or cur2: - cur.val = cur.val + self.addNode(cur1, cur2) - if cur.val<10: + cur.val = cur.val+self.addNode(cur1, cur2) + if cur.val < 10: if cur1 and cur1.next or cur2 and cur2.next: # next node cur.next = ListNode(0) else: @@ -64,9 +66,10 @@ def addNode(self, node1, node2): return node2.val if not node2: return node1.val - return node1.val + node2.val + return node1.val+node2.val + -if __name__=="__main__": +if __name__ == "__main__": l1s = [ListNode(1)] l2s = [ListNode(9), ListNode(9)] for i in range(len(l1s)-1): diff --git a/005 Longest Palindromic Substring.py b/005 Longest Palindromic Substring.py index d4abcfc..ca1abd6 100644 --- a/005 Longest Palindromic Substring.py +++ b/005 Longest Palindromic Substring.py @@ -3,7 +3,29 @@ there exists one unique longest palindromic substring. """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): + def longestPalindrome(self, s): + """ + O(n^2) + :param s: string + :return: string + """ + if not s: + return + n = len(s) + if n == 1: + return s + + ret = s[0] + for i in xrange(0, n): + cur = self.get_palindrome_from_center(s, i, i) # odd length + if len(cur) > len(ret): ret = cur + cur = self.get_palindrome_from_center(s, i, i+1) + if len(cur) > len(ret): ret = cur + return ret + def longestPalindrome_TLE(self, s): """ Algorithm: dp, O(n^2) @@ -33,13 +55,12 @@ def longestPalindrome_TLE(self, s): longest = [0, 0] for j in xrange(length+1): for i in xrange(j-1, -1, -1): - if i+1==j: + if i+1 == j: dp[i][j] = True else: - dp[i][j] = s[i]==s[j-1] and dp[i+1][j-1] # pre-access? starting backward - + dp[i][j] = s[i] == s[j-1] and dp[i+1][j-1] # pre-access? starting backward - if dp[i][j]==True and longest[1]-longest[0]len(longest): longest = current - current = self.get_palindrome_from_center(s, i, i+1) - if len(current)>len(longest): longest = current - return longest - def get_palindrome_from_center(self, s, begin, end): """ # [begin, end] """ - while begin>=0 and end= 0 and end < len(s) and s[begin] == s[end]: begin -= 1 end += 1 return s[begin+1: end-1+1] -if __name__=="__main__": - assert Solution().longestPalindrome("dfaaabbbaaac")=="aaabbbaaa" \ No newline at end of file +if __name__ == "__main__": + assert Solution().longestPalindrome("dfaaabbbaaac") == "aaabbbaaa" \ No newline at end of file diff --git a/006 ZigZag Conversion.py b/006 ZigZag Conversion.py index af1d231..5a847f4 100644 --- a/006 ZigZag Conversion.py +++ b/006 ZigZag Conversion.py @@ -12,6 +12,8 @@ convert("PAYPALISHIRING", 3) should return "PAHNAPLSIIGYIR". """ __author__ = 'Danyang' + + class Solution: def convert(self, s, nRows): """ @@ -24,7 +26,7 @@ def convert(self, s, nRows): matrix = [[] for _ in xrange(nRows)] i = 0 - while iINT_MAX: + if result > INT_MAX: return INT_MAX - if result=10: + while x/div >= 10: div *= 10 # without touch x + while x > 0: + msb = x/div + lsb = x%10 - while x>0: - msb = x / div - lsb = x % 10 - - if msb!=lsb: + if msb != lsb: return False # shrink @@ -37,5 +38,5 @@ def isPalindrome(self, x): return True -if __name__=="__main__": +if __name__ == "__main__": Solution().isPalindrome(2147483647) \ No newline at end of file diff --git a/010 Container With Most Water.py b/010 Container With Most Water.py index 8540ae5..e55966f 100644 --- a/010 Container With Most Water.py +++ b/010 Container With Most Water.py @@ -6,6 +6,8 @@ Note: You may not slant the container. """ __author__ = 'Danyang' + + class Solution: def maxArea(self, height): """ @@ -19,14 +21,14 @@ def maxArea(self, height): start = 0 end = len(height)-1 - max_area = -1<<32 - while start true """ __author__ = 'Danyang' + + class Solution: def isMatch_error(self, s, p): """ @@ -35,33 +37,33 @@ def isMatch_error(self, s, p): index = 0 state = 0 - while index=0 and regex[j-1]!="*": + if regex[j] == "*": + if j-1 >= 0 and regex[j-1] != "*": dp[i][j] = dp[i][j+1] # skip else: return False # two consecutive * - elif j+1=component: + while num >= component: string_builder.append(int2roman[component]) num -= component diff --git a/013 Roman to Integer.py b/013 Roman to Integer.py index 5f0f915..febf00f 100644 --- a/013 Roman to Integer.py +++ b/013 Roman to Integer.py @@ -13,6 +13,8 @@ "D": 500, "M": 1000 } + + class Solution: def romanToInt(self, s): """ @@ -23,7 +25,7 @@ def romanToInt(self, s): """ result = 0 for ind, val in enumerate(s): - if ind>0 and roman2int[val]>roman2int[s[ind-1]]: # e.g. XIV + if ind > 0 and roman2int[val] > roman2int[s[ind-1]]: # e.g. XIV result -= roman2int[s[ind-1]] # reverse last action result += roman2int[val]-roman2int[s[ind-1]] else: diff --git a/014 3Sum.py b/014 3Sum.py index 3888016..3100ae5 100644 --- a/014 3Sum.py +++ b/014 3Sum.py @@ -12,6 +12,8 @@ (-1, -1, 2) """ __author__ = 'Danyang' + + class Solution: def threeSum_duplicate(self, num): """ @@ -30,11 +32,11 @@ def threeSum_duplicate(self, num): result = [] for i in xrange(len(num)): for j in xrange(i, len(num)): - target = 0 - num[i] - num[j] + target = 0-num[i]-num[j] if target not in reverse_map: continue for index in reverse_map[target]: - if i!=index and j!=index: + if i != index and j != index: result.append([num[i], num[j], target]) break return result @@ -55,7 +57,6 @@ def threeSum_TLE(self, num): else: reverse_map[val].append(ind) - result = {} for i in xrange(len(num)): for j in xrange(i, len(num)): @@ -63,10 +64,10 @@ def threeSum_TLE(self, num): if target not in reverse_map: continue for index in reverse_map[target]: - if index!=i and index!=j: + if index != i and index != j: lst = sorted([num[i], num[j], target]) lst = tuple(lst) - result[lst] = 1 # hash + result[lst] = 1 # hash break return result.keys() @@ -97,36 +98,32 @@ def threeSum(self, num): result = [] num.sort() # sorting first, avoid duplicate, i = 0 - while i0: + elif sum(lst) > 0: k -= 1 else: j += 1 i += 1 # remove duplicate - while i List[str]: + """ + Method 1 - backtracking + Method 2 - dp + Let F[n] be the list of parentheses at length 2n + """ + F: List[List[str]] = [[] for _ in range(n + 1)] + F[0].append("") + for i in range(1, n+1): + for j in range(i): + for s1 in F[j]: + for s2 in F[i-j-1]: + F[i].append(f"({s1}){s2}") + + return F[n] diff --git a/021 Generate Parentheses.py b/021 Generate Parentheses.py index ac64cc8..32d85db 100644 --- a/021 Generate Parentheses.py +++ b/021 Generate Parentheses.py @@ -25,16 +25,17 @@ def generateParenthesisDfs(self, result, cur, left, right): :param left: number of left parenthesis remaining :param right: number of right parenthesis remaining """ - # trivial - if left==0 and right==0: + if left == 0 and right == 0: result.append(cur) return + # add left parenthesis - if left>0: - self.generateParenthesisDfs(result, cur+"(", left-1, right) + if left > 0: + self.generateParenthesisDfs(result, cur + "(", left - 1, right) # add right parenthesis - if right>left: - self.generateParenthesisDfs(result, cur+")", left, right-1) + if right > left: + self.generateParenthesisDfs(result, cur + ")", left, right - 1) + if __name__=="__main__": - assert Solution().generateParenthesis(3)==['((()))', '(()())', '(())()', '()(())', '()()()'] \ No newline at end of file + assert Solution().generateParenthesis(3)==['((()))', '(()())', '(())()', '()(())', '()()()'] diff --git a/030 Next Permutation.py b/030 Next Permutation.py index a74637a..5e0095e 100644 --- a/030 Next Permutation.py +++ b/030 Next Permutation.py @@ -11,11 +11,13 @@ 1,1,5 -> 1,5,1 """ __author__ = 'Danyang' + + class Solution: def nextPermutation(self, num): """ Implement next permutation, which rearranges numbers into the lexicographically next greater permutation of numbers. - Unable to use Contour Expansion due to duplicates + Unable to use Cantor Expansion due to duplicates Classic algorithm in STL math problem; algorithm: http://fisherlei.blogspot.sg/2012/12/leetcode-next-permutation.html @@ -45,5 +47,6 @@ def nextPermutation(self, num): num[partition_num_index+1:] = reversed(num[partition_num_index+1:]) return num + if __name__=="__main__": print Solution().nextPermutation([3, 2, 1]) diff --git a/031 Longest Valid Parentheses.py b/031 Longest Valid Parentheses.py index 3e0b7e1..baefde5 100644 --- a/031 Longest Valid Parentheses.py +++ b/031 Longest Valid Parentheses.py @@ -7,7 +7,9 @@ Another example is ")()())", where the longest valid parentheses substring is "()()", which has length = 4. """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): def longestValidParentheses(self, s): """ Stack holds the index of unpaired brackets @@ -23,22 +25,23 @@ def longestValidParentheses(self, s): :param s: a string :return: an integer """ - stack = [] # hold unpaired bracket, either ( or ) - longest = 0 - for ind, char in enumerate(s): - if char==")" and stack and s[stack[-1]]=="(": # ), and non-empty stack - stack.pop() - if not stack: - longest = ind+1 + stk = [] # hold the INDEX of UNPAIRED bracket, either ( or ) + maxa = 0 + for idx, val in enumerate(s): + if val == ")" and stk and s[stk[-1]] == "(": + stk.pop() + if not stk: + maxa = max(maxa, idx+1) else: - longest = max(longest, ind-stack[-1]) + maxa = max(maxa, idx-stk[-1]) else: - stack.append(ind) + stk.append(idx) + + return maxa - return longest -if __name__=="__main__": - assert Solution().longestValidParentheses("(()()")==4 - assert Solution().longestValidParentheses("()(()")==2 - assert Solution().longestValidParentheses("(()")==2 - assert Solution().longestValidParentheses(")()())")==4 \ No newline at end of file +if __name__ == "__main__": + assert Solution().longestValidParentheses("(()()") == 4 + assert Solution().longestValidParentheses("()(()") == 2 + assert Solution().longestValidParentheses("(()") == 2 + assert Solution().longestValidParentheses(")()())") == 4 \ No newline at end of file diff --git a/035 Valid Sudoku.py b/035 Valid Sudoku.py index cc22a81..caf842b 100644 --- a/035 Valid Sudoku.py +++ b/035 Valid Sudoku.py @@ -12,8 +12,12 @@ class Solution: def isValidSudoku(self, board): """ + Brute force - check rows, cols, and squares and maintain a hashmap to store the previously seen elements + Notice how check the square in the board. + Save space by one iterations. + 9 squares are iterated by i 9 cells are iterated by j Squares lie on 3 big rows; index for the 3 big rows: i/3*3-th, thus iteration pattern: 000, 333, 666 @@ -22,14 +26,14 @@ def isValidSudoku(self, board): Squares lie on 3 big column; index for the 3 big column: i%3*3-th, thus iteration pattern: (036, 036, 036) Subdivide the 1 big column into 3 small column; index for the 3 small columns: j%3-th, thus iteration pattern 012, 012, 012) - thus, iterate by board[i/3*3+j/3][i%3*3+j%3] + thus, iterate by board[i/3*3 + j/3][i%3*3 + j%3] :param board: a 9x9 2D array :return: boolean """ # check row & column for i in xrange(9): - row = [] + row = [] # change to hashamp column = [] square = [] for j in xrange(9): @@ -55,7 +59,7 @@ def isValidSudoku(self, board): # check square try: - square_element = int(board[i/3*3+j/3][i%3*3+j%3]) + square_element = int(board[i/3*3 + j/3][i%3*3 + j%3]) if square_element in square: return False else: @@ -69,4 +73,4 @@ def isValidSudoku(self, board): assert Solution().isValidSudoku( ["..4...63.", ".........", "5......9.", "...56....", "4.3.....1", "...7.....", "...5.....", ".........", "........."] - )==False \ No newline at end of file + )==False diff --git a/038 Combination Sum II py3.py b/038 Combination Sum II py3.py new file mode 100644 index 0000000..7658b27 --- /dev/null +++ b/038 Combination Sum II py3.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +Given a collection of candidate numbers (candidates) and a target number +(target), find all unique combinations in candidates where the candidate numbers +sums to target. + +Each number in candidates may only be used once in the combination. + +Note: + +All numbers (including target) will be positive integers. +The solution set must not contain duplicate combinations. +Example 1: + +Input: candidates = [10,1,2,7,6,1,5], target = 8, +A solution set is: +[ + [1, 7], + [1, 2, 5], + [2, 6], + [1, 1, 6] +] +Example 2: + +Input: candidates = [2,5,2,1,2], target = 5, +A solution set is: +[ + [1,2,2], + [5] +] +""" +from typing import List + + +class Solution: + def combinationSum2(self, candidates: List[int], target: int) -> List[List[int]]: + ret = [] + candidates.sort() + self.dfs(candidates, 0, [], 0, target, ret) + return ret + + def dfs(self, candidates, i, cur, cur_sum, target, ret): + if cur_sum == target: + ret.append(list(cur)) + return + + if cur_sum > target or i >= len(candidates): + return + + # not choose A_i + # to de-dup, need to jump + j = i + 1 + while j < len(candidates) and candidates[j] == candidates[i]: + j += 1 + + self.dfs(candidates, j, cur, cur_sum, target, ret) + + # choose A_i + cur.append(candidates[i]) + cur_sum += candidates[i] + self.dfs(candidates, i + 1, cur, cur_sum, target, ret) + cur.pop() + cur_sum -= candidates[i] + + +if __name__ == "__main__": + assert Solution().combinationSum2([2,5,2,1,2], 5) == [[5], [1,2,2]] diff --git a/039 Combination Sum py3.py b/039 Combination Sum py3.py new file mode 100644 index 0000000..3f758dd --- /dev/null +++ b/039 Combination Sum py3.py @@ -0,0 +1,57 @@ +#!/usr/bin/python3 +""" +Given a set of candidate numbers (candidates) (without duplicates) and a target +number (target), find all unique combinations in candidates where the candidate +numbers sums to target. + +The same repeated number may be chosen from candidates unlimited number of +times. + +Note: + +All numbers (including target) will be positive integers. +The solution set must not contain duplicate combinations. +Example 1: + +Input: candidates = [2,3,6,7], target = 7, +A solution set is: +[ + [7], + [2,2,3] +] +Example 2: + +Input: candidates = [2,3,5], target = 8, +A solution set is: +[ + [2,2,2,2], + [2,3,3], + [3,5] +] +""" +from typing import List + + +class Solution: + def combinationSum(self, candidates: List[int], target: int) -> List[List[int]]: + ret = [] + self.dfs(candidates, 0, [], 0, target, ret) + return ret + + def dfs(self, candidates, i, cur, cur_sum, target, ret): + if cur_sum == target: + ret.append(list(cur)) + return + + if cur_sum > target or i >= len(candidates): + return + + # not choose A_i + self.dfs(candidates, i + 1, cur, cur_sum, target, ret) + + # choose A_i + cur.append(candidates[i]) + cur_sum += candidates[i] + self.dfs(candidates, i, cur, cur_sum, target, ret) + cur.pop() + cur_sum -= candidates[i] diff --git a/041 Trapping Rain Water py3.py b/041 Trapping Rain Water py3.py new file mode 100644 index 0000000..52cbe3e --- /dev/null +++ b/041 Trapping Rain Water py3.py @@ -0,0 +1,37 @@ +#!/usr/bin/python3 +""" +Given n non-negative integers representing an elevation map where the width of +each bar is 1, compute how much water it is able to trap after raining. + + +The above elevation map is represented by array [0,1,0,2,1,0,1,3,2,1,2,1]. In +this case, 6 units of rain water (blue section) are being trapped. + +Example: +Input: [0,1,0,2,1,0,1,3,2,1,2,1] +Output: 6 +""" + +class Solution: + def trap(self, height: List[int]) -> int: + """ + At each position, the water is determined by the left and right max + + Let lefts[i] be the max(height[:i]) + Let rights[i] be the max(height[i:]) + """ + n = len(height) + lefts = [0 for _ in range(n+1)] + rights = [0 for _ in range(n+1)] + for i in range(1, n+1): # i, index of lefts + lefts[i] = max(lefts[i-1], height[i-1]) + for i in range(n-1, -1, -1): + rights[i] = max(rights[i+1], height[i]) + + ret = 0 + for i in range(n): + ret += max( + 0, + min(lefts[i], rights[i+1]) - height[i] + ) + return ret diff --git a/042 Multiply Strings.py b/042 Multiply Strings.py index 2bf45e5..81fcaf2 100644 --- a/042 Multiply Strings.py +++ b/042 Multiply Strings.py @@ -4,7 +4,9 @@ Note: The numbers can be arbitrarily large and are non-negative. """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): def multiply(self, num1, num2): """ Google Phone Interview Question, 20 Sep 2013 @@ -25,23 +27,23 @@ def multiply(self, num1, num2): result = [] # pre processing - if len(num1) len(num2): # order them first + return self.multiply(num2, num1) - num2 = num2[::-1] # reverse them first - num1 = num1[::-1] + # reverse them first + num1 = map(int, list(num1[::-1])) + num2 = map(int, list(num2[::-1])) # multiply by 1 digit at a time - for i in range(len(num2)): - result.append(self.multiply_1_digit(num2[i], num1)) + for d in num1: + result.append(self.multiply_1_digit(d, num2)) # add the temporary results up lst = self.add_list(result) - # post processing lst.reverse() # reverse back - result = "".join(str(item) for item in lst).lstrip("0") + result = "".join(map(str, lst)).lstrip("0") if not result: return "0" return result @@ -52,22 +54,19 @@ def multiply_1_digit(self, digit, num): :param num: String :return: list of digit in reverse order """ - digit = int(digit) - temp = [int(item) for item in num] + ret = [] carry = 0 - for ind in range(len(temp)): - val = temp[ind] - mul = val*digit+carry + for elt in num: + mul = elt*digit + carry carry = mul/10 - mul = mul%10 - temp[ind] = mul + mul %= 10 + ret.append(mul) - if carry!=0: - temp.append(carry) - - return temp + if carry != 0: + ret.append(carry) + return ret def add_list(self, lst): """ @@ -75,17 +74,13 @@ def add_list(self, lst): :param lst: :return: """ - appending_zero = 0 - result = [0] + sig = 0 + ret = [0] for ind, val in enumerate(lst): - for i in range(appending_zero): - val.insert(0, 0) # NOTICE: side-effect - result = self.add(result, val) - appending_zero += 1 - return result - - - + for i in xrange(sig): val.insert(0, 0) # possible deque + ret = self.add(ret, val) + sig += 1 + return ret def add(self, num1, num2): """ @@ -93,35 +88,30 @@ def add(self, num1, num2): :param num2: list of digits in reverse order :return: list of digits in reverse order """ - num1 = list(num1) # NOTICE: local copy - num2 = list(num2) # NOTICE: local copy - if len(num1) len(num2): + return self.add(num2, num1) + + ret = [] carry = 0 - for ind in range(len(num1)): # longer one + for idx in xrange(len(num2)): # longer one try: - result = num1[ind]+num2[ind]+carry + sm = num1[idx] + num2[idx] + carry except IndexError: - result = num1[ind]+carry - if result==num1[ind]: break # prune - - - carry = result/10 - num1[ind] = result%10 - - if carry!=0: - num1.append(carry) + sm = num2[idx] + carry - return num1 + carry = sm/10 + ret.append(sm % 10) + if carry != 0: + ret.append(carry) + return ret -if __name__=="__main__": +if __name__ == "__main__": solution = Solution() - #assert [1, 2]==solution.add([2,1], [9]) - #assert [1, 9, 9, 8]==solution.multiply_1_digit("9", "999") - #assert str(123*999)==solution.multiply("123", "999") - #assert str(0)==solution.multiply("0", "0") - assert str(123*456)==solution.multiply("123", "456") \ No newline at end of file + assert [1, 2] == solution.add([2, 1], [9]) + assert str(123*999) == solution.multiply("123", "999") + assert str(0) == solution.multiply("0", "0") + assert str(123*456) == solution.multiply("123", "456") diff --git a/048 Pow(x, n).py b/048 Pow(x, n).py index 37f777b..2751c4c 100644 --- a/048 Pow(x, n).py +++ b/048 Pow(x, n).py @@ -2,7 +2,37 @@ Implement pow(x, n). """ __author__ = 'Danyang' + + class Solution: + def pow(self, x, n): + """ + O(log n) + Algorithm: math, Exponentiation by Squaring + + Basically: x^n = (x^2)^(n/2) + More formally: x^n = x^(n/2) * x^(n/2) * x^(n%2) + + :param x: float + :param n: integer + :return: float + """ + invert_flag = False if n > 0 else True + # O(log n) + n = abs(n) + product = 1.0 + while n > 0: + if n & 1 == 1: + product *= x + + n = n >> 1 + x *= x + + if invert_flag: + product = 1.0 / product + + return product + # @param x, a float # @param n, a integer # @return a float @@ -43,33 +73,5 @@ def pow_TLE(self, x, n): return product - - - - def pow(self, x, n): - """ - O(log n) - Algorithm: math, Exponentiation by Squaring - - Basically: x^n = (x^2)^(n/2) - More formally: x^n = x^(n/2) * x^(n/2) * x^(n%2) - - :param x: float - :param n: integer - :return: float - """ - invert_flag = False if n>0 else True - n = abs(n) - product = 1.0 - while n>0: - if n&1==1: - product *= x - n = n>>1 - x *=x - - if invert_flag: - product = 1.0/product - return product - if __name__=="__main__": - print Solution().pow(8.88023, 3) + print Solution().pow(8.88023, 3) diff --git a/053 Spiral Matrix.py b/053 Spiral Matrix.py index 9897659..4424d6a 100644 --- a/053 Spiral Matrix.py +++ b/053 Spiral Matrix.py @@ -1,59 +1,75 @@ -""" -Given a matrix of m x n elements (m rows, n columns), return all elements of the matrix in spiral order. - -For example, -Given the following matrix: - -[ - [ 1, 2, 3 ], - [ 4, 5, 6 ], - [ 7, 8, 9 ] -] -You should return [1,2,3,6,9,8,7,4,5]. -""" -__author__ = 'Danyang' -class Solution: - def spiralOrder(self, matrix): - """ - top - | - left --+-- right - | - bottom - - be careful with the index - - :param matrix: a list of lists of integers - :return: a list of integers - """ - if not matrix or not matrix[0]: - return matrix - - result = [] - - left = 0 - right = len(matrix[0])-1 - top = 0 - bottom = len(matrix)-1 - - while left<=right and top<=bottom: - for i in xrange(left, right+1): - result.append(matrix[top][i]) - for i in xrange(top+1, bottom+1): - result.append(matrix[i][right]) - for i in reversed(xrange(left+1, right)): - if top e, itvls) + if len(left)+len(right) != len(itvls): + s = min(s, itvls[len(left)].start) + e = max(e, itvls[-len(right)-1].end) + + return left + [Interval(s, e)] + right + + def insert_itr(self, itvls, newItvl): + """ + iterator TODO """ - :param intervals: a list of Intervals - :param newInterval: a Interval + +class SolutionSlow(object): + def insert(self, itvls, newItvl): + """ + :param itvls: a list of Intervals + :param newItvl: a Interval :return: a list of Interval """ - return self.merge(intervals+[newInterval]) + return self.merge(itvls+[newItvl]) - def merge(self, intervals): + def merge(self, itvls): """ sort first by .start then decide whether to extend the .end - :param intervals: list of Interval + :param itvls: list of Interval :return: list of Interval """ - intervals.sort(cmp=lambda a, b: a.start - b.start) + itvls.sort(cmp=lambda a, b: a.start - b.start) - result = [intervals[0]] - for cur in intervals[1:]: - pre = result[-1] - if cur.start<=pre.end: # overlap + ret = [itvls[0]] + for cur in itvls[1:]: + pre = ret[-1] + if cur.start <= pre.end: # overlap pre.end = max(pre.end, cur.end) else: - result.append(cur) + ret.append(cur) - return result + return ret -if __name__=="__main__": - lst = [[1,2],[3,5],[6,7],[8,10],[12,16]] - insert = [4,9] +if __name__ == "__main__": + lst = [[1, 2], [3, 5], [6, 7], [8, 10], [12, 16]] + insert = [4, 9] lst_interval = [] for item in lst: lst_interval.append(Interval(item[0], item[1])) diff --git a/058 Spiral Matrix II.py b/058 Spiral Matrix II.py index 003de91..3394cd1 100644 --- a/058 Spiral Matrix II.py +++ b/058 Spiral Matrix II.py @@ -1,54 +1,95 @@ -""" -Given an integer n, generate a square matrix filled with elements from 1 to n2 in spiral order. - -For example, -Given n = 3, - -You should return the following matrix: -[ - [ 1, 2, 3 ], - [ 8, 9, 4 ], - [ 7, 6, 5 ] -] -""" -__author__ = 'Danyang' -class Solution: - def generateMatrix(self, n): - """ - algorithm: array - :param n: Integer - :return: a list of lists of integer - """ - left = 0 - right = n-1 # [0, n) - top = 0 - bottom = n-1 # [0, n) - - result = [[-1 for _ in xrange(n)] for _ in xrange(n)] - num = 1 - while left<=right and top<=bottom: - for i in xrange(left, right+1): # tuning ending condition - result[top][i] = num - num += 1 - for i in xrange(top+1, bottom): - result[i][right] = num - num += 1 - - for i in xrange(right, left, -1): - result[bottom][i] = num - num += 1 - for i in xrange(bottom, top, -1): - result[i][left] = num - num += 1 - - left += 1 - right -= 1 - top += 1 - bottom -= 1 - - return result - -if __name__=="__main__": - result = Solution().generateMatrix(4) - for row in result: - print row \ No newline at end of file +""" +Given an integer n, generate a square matrix filled with elements from 1 to n2 in spiral order. + +For example, +Given n = 3, + +You should return the following matrix: +[ + [ 1, 2, 3 ], + [ 8, 9, 4 ], + [ 7, 6, 5 ] +] +""" +__author__ = 'Danyang' + + +class Solution: + def generateMatrix(self, n): + """ + algorithm: array, simulation + :param n: Integer + :return: a list of lists of integer + """ + left = 0 + right = n - 1 # [0, n) + top = 0 + bottom = n - 1 # [0, n) + + result = [[-1 for _ in xrange(n)] for _ in xrange(n)] + num = 1 + while left <= right and top <= bottom: + for i in xrange(left, right + 1): # tuning ending condition, be greedy + result[top][i] = num + num += 1 + for i in xrange(top + 1, bottom): + result[i][right] = num + num += 1 + + for i in xrange(right, left, -1): + result[bottom][i] = num + num += 1 + for i in xrange(bottom, top, -1): + result[i][left] = num + num += 1 + + left += 1 + right -= 1 + top += 1 + bottom -= 1 + + return result + + +class SolutionError: + def generateMatrix(self, n): + """ + algorithm: array, simulation + :param n: Integer + :return: a list of lists of integer + """ + left = 0 + right = n - 1 # [0, n) + top = 0 + bottom = n - 1 # [0, n) + + result = [[-1 for _ in xrange(n)] for _ in xrange(n)] + num = 1 + while left <= right and top <= bottom: + for i in xrange(left, right): # tuning ending condition, this will fail in the middle + result[top][i] = num + num += 1 + for i in xrange(top, bottom): + result[i][right] = num + num += 1 + + for i in xrange(right, left, -1): + result[bottom][i] = num + num += 1 + + for i in xrange(bottom, top, -1): + result[i][left] = num + num += 1 + + left += 1 + right -= 1 + top += 1 + bottom -= 1 + + return result + + +if __name__=="__main__": + result = Solution().generateMatrix(4) + for row in result: + print row diff --git a/060 Permutation Sequence.py b/060 Permutation Sequence.py index 329f233..3ac410b 100644 --- a/060 Permutation Sequence.py +++ b/060 Permutation Sequence.py @@ -14,62 +14,75 @@ Note: Given n will be between 1 and 9 inclusive. """ +import math + __author__ = 'Danyang' -class Solution_TLE: - """ - Time Limit Expected - """ - def __init__(self): - self.counter = 0 + +class Solution(object): + def getPermutation(self, n, k): + k -= 1 + + array = range(1, n+1) + k %= math.factorial(n) + ret = [] + for i in xrange(n-1, -1, -1): + idx, k = divmod(k, math.factorial(i)) + ret.append(array.pop(idx)) + + return "".join(map(str, ret)) def getPermutation(self, n, k): """ - dfs, iterate all possibilities + Reverse Cantor Expansion + + equation: sum a_i * i! = k :param n: integer :param k: integer :return: String """ - if not n: - return - - sequence = range(1, n+1) - result = self.get_kth_permutation_dfs(sequence, k, []) - return "".join(str(element) for element in result) - + # factorial + fac = [1 for _ in xrange(n)] + for i in xrange(1, n): + fac[i] = fac[i-1]*i + # solve equation + k -= 1 # index starting from 0 + a = [0 for _ in xrange(n)] + for i in xrange(n-1, -1, -1): + a[n-1-i] = k/fac[i] # a[i] = k/fac[i] + k %= fac[i] - def get_kth_permutation_dfs(self, remaining_seq, k, cur): - """ - dfs until find kth permutation, return that permutation, otherwise return None - :param remaining_seq: - :param k: - :param cur: - :return: - """ - if not remaining_seq: - self.counter += 1 - if self.counter==k: - return cur + # post-process + candidate = range(1, n+1) # sorted + visited = [False for _ in xrange(n)] + for ind, val in enumerate(a): + i = 0 # pointer + cnt = 0 # counter + while True: + if visited[i]: + i += 1 + else: + if cnt == val: break + cnt += 1 + i += 1 - for ind, val in enumerate(remaining_seq): - result = self.get_kth_permutation_dfs(remaining_seq[:ind]+remaining_seq[ind+1:], k, cur+[val]) - if result: return result + a[ind] = candidate[i] + visited[i] = True + return "".join(map(str, a)) -class Solution: def getPermutation_complicated(self, n, k): """ - Mathematics, reference: http://fisherlei.blogspot.sg/2013/04/leetcode-permutation-sequence-solution.html - Reversed Contour Expansion + Mathematics + Reversed Cantor Expansion A = [1, 2, ..., n], where A's index starts from 0 Suppose for n element, the k-th permutation is: [a0, a1, a2, ..., an-1] since [a1, a3, ..., an-1] has (n-1)! permutations, - if k<(n-1)!, a0 = 1 (first element in array), else a0=k/(n-1)!+1 (subsequent items) - thus a0 = A[k/(n-1)!] + if k < (n-1)!, a0 = A[0] (first element in array), else a0 = A[k/(n-1)!] (subsequent items) recursively, (or iteratively) a0 = A[k0/(n-1)!], where k0 = k @@ -87,7 +100,6 @@ def getPermutation_complicated(self, n, k): for i in xrange(1, n): factorial *= i - result = [] array = range(1, n+1) for i in reversed(xrange(1, n)): @@ -102,54 +114,51 @@ def getPermutation_complicated(self, n, k): return "".join(str(element) for element in result) + +class Solution_TLE: + """ + Time Limit Expected + """ + + def __init__(self): + self.counter = 0 + def getPermutation(self, n, k): """ - Reverse Contour Expansion - - equation: sum a_i * i! = k + dfs, iterate all possibilities :param n: integer :param k: integer :return: String """ - # factorial - fac = [1 for _ in xrange(n)] - for i in xrange(1, n): - fac[i] = fac[i-1]*i - - # solve equation - k -= 1 # index starting from 0 - a = [0 for _ in xrange(n)] - for i in xrange(n-1, -1, -1): - a[n-1-i] = k/fac[i] # a[i] = k/fac[i] - k %= fac[i] - - # post-process - candidate = range(1, n+1) # sorted - visited = [False for _ in xrange(n)] - for ind, val in enumerate(a): - i = 0 # pointer - cnt = 0 # counter - while True: - if visited[i]: - i += 1 - else: - if cnt==val: break - cnt += 1 - i += 1 - - a[ind] = candidate[i] - visited[i] = True - - return "".join(map(str, a)) + if not n: + return + sequence = range(1, n+1) + result = self.get_kth_permutation_dfs(sequence, k, []) + return "".join(str(element) for element in result) + def get_kth_permutation_dfs(self, remaining_seq, k, cur): + """ + dfs until find kth permutation, return that permutation, otherwise return None + :param remaining_seq: + :param k: + :param cur: + :return: + """ + if not remaining_seq: + self.counter += 1 + if self.counter == k: + return cur + for ind, val in enumerate(remaining_seq): + result = self.get_kth_permutation_dfs(remaining_seq[:ind]+remaining_seq[ind+1:], k, cur+[val]) + if result: return result -if __name__=="__main__": - assert Solution().getPermutation(4, 6)=="1432" - assert Solution().getPermutation(2, 2)=="21" - assert Solution().getPermutation(3, 1)=="123" - assert Solution().getPermutation(3, 5)=="312" +if __name__ == "__main__": + assert Solution().getPermutation(4, 6) == "1432" + assert Solution().getPermutation(2, 2) == "21" + assert Solution().getPermutation(3, 1) == "123" + assert Solution().getPermutation(3, 5) == "312" print Solution().getPermutation(9, 171669) \ No newline at end of file diff --git a/061 Unique Paths.py b/061 Unique Paths.py index c70327a..ff4ae0d 100644 --- a/061 Unique Paths.py +++ b/061 Unique Paths.py @@ -11,31 +11,57 @@ Note: m and n will be at most 100. """ +import math __author__ = 'Danyang' -class Solution: + + +class Solution(object): def uniquePaths(self, m, n): + """ + Math solution: + if total m+n steps + (m+n) \choose m as down, the remain n as right. + + mCn = n!/m!(n-m)! + :param m: + :param n: + :return: + """ + m -= 1 + n -= 1 + return math.factorial(m+n) / (math.factorial(n) * math.factorial(m)) + + def uniquePathsDP(self, m, n): + F = [[0 for _ in xrange(n+1)] for _ in xrange(m+1)] + F[1][0] = 1 # dummy entry point + for i in xrange(1, m+1): + for j in xrange(1, n+1): + F[i][j] = F[i-1][j] + F[i][j-1] + + return F[m][n] + + def uniquePathsNormal(self, m, n): """ dp - path[i][j] = path[i-1][j] + path[i][j-1] + Let F be number of unique paths at position i, j + F[i][j] = F[i-1][j] + F[i][j-1] :param m: :param n: :return: an integer """ - path = [[0 for _ in range(n)] for _ in range(m)] - path[0][0] = 1 # start - - # path[i][j] = path[i-1][j] + path[i][j-1] - for i in range(m): - for j in range(n): - if i==0 and j==0: - continue - if i==0: - path[i][j] = path[i][j-1] - elif j==0: - path[i][j] = path[i-1][j] - else: - path[i][j] = path[i-1][j]+path[i][j-1] - return path[m-1][n-1] - -if __name__=="__main__": - print Solution().uniquePaths(3, 7) \ No newline at end of file + F = [[0 for _ in xrange(n)] for _ in xrange(m)] + F[0][0] = 1 # start + + # F[i][j] = F[i-1][j] + F[i][j-1] + for i in xrange(m): + for j in xrange(n): + if i == 0 and j == 0: continue + if i == 0: F[i][j] = F[i][j-1] + elif j == 0: F[i][j] = F[i-1][j] + else: F[i][j] = F[i-1][j]+F[i][j-1] + + return F[m-1][n-1] + + +if __name__ == "__main__": + assert Solution().uniquePaths(3, 7) == 28 \ No newline at end of file diff --git a/065 Plus One.py b/065 Plus One.py index f118678..fd24e57 100644 --- a/065 Plus One.py +++ b/065 Plus One.py @@ -4,7 +4,9 @@ The digits are stored such that the most significant digit is at the head of the list. """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): def plusOne(self, digits): """ Math @@ -13,20 +15,15 @@ def plusOne(self, digits): :param digits: a list of integer digits :return: a list of integer digits """ - cur = len(digits)-1 - while True: - if cur>=0: - digits[cur] += 1 - if digits[cur]<10: - break - else: - digits[cur] -= 10 - cur -= 1 + for i in xrange(len(digits)-1, -1, -1): + digits[i] += 1 + if digits[i] < 10: + return digits else: - # MSB - digits.insert(0, 1) - break + digits[i] -= 10 + # MSB + digits.insert(0, 1) return digits def plusOne(self, digits): @@ -41,7 +38,7 @@ def plusOne(self, digits): carry = 0 for i in xrange(len(digits)): # for ind, val in enumerate(digits): digits[i] += carry - if digits[i]>9: + if digits[i] > 9: digits[i] -= 10 carry = 1 else: @@ -54,6 +51,7 @@ def plusOne(self, digits): digits.reverse() return digits -if __name__=="__main__": + +if __name__ == "__main__": digits = [9] - assert Solution().plusOne(digits)==[1, 0] \ No newline at end of file + assert Solution().plusOne(digits) == [1, 0] \ No newline at end of file diff --git a/068 Simplify Path.py b/068 Simplify Path.py index b14aae8..0a786de 100644 --- a/068 Simplify Path.py +++ b/068 Simplify Path.py @@ -13,7 +13,9 @@ In this case, you should ignore redundant slashes and return "/home/foo". """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): def simplifyPath(self, path): """ use "." as intermediate @@ -24,13 +26,16 @@ def simplifyPath(self, path): path = path.split("/") path = filter(lambda x: x not in ("", " ", "."), path) - for ind, val in enumerate(path): # some unexpected error in memory - if val=="..": - path[ind] = "." + # modify the content of the list, not the structure. + for idx in xrange(len(path)): + val = path[idx] + if val == "..": + path[idx] = "." - i = 1 - while ind-i>=0 and path[ind-i]==".": i += 1 - if ind-i>=0: path[ind-i] = "." # avoid unexpected path[-1] + # rm a previous meaningful part + i = idx-1 + while i >= 0 and path[i] == ".": i -= 1 + if i >= 0: path[i] = "." # avoid path[-1] path = filter(lambda x: x not in (".",), path) @@ -40,7 +45,8 @@ def simplifyPath(self, path): path = map(lambda x: "/"+x, path) return "".join(path) -if __name__=="__main__": - assert Solution().simplifyPath("/a/./b///../c/../././../d/..//../e/./f/./g/././//.//h///././/..///")=="/e/f/g" - assert Solution().simplifyPath("/a/./b/../../c/")=="/c" - assert Solution().simplifyPath("/../")=="/" \ No newline at end of file + +if __name__ == "__main__": + assert Solution().simplifyPath("/a/./b///../c/../././../d/..//../e/./f/./g/././//.//h///././/..///") == "/e/f/g" + assert Solution().simplifyPath("/a/./b/../../c/") == "/c" + assert Solution().simplifyPath("/../") == "/" \ No newline at end of file diff --git a/068 Text Justification py3.py b/068 Text Justification py3.py new file mode 100644 index 0000000..8ec1ad1 --- /dev/null +++ b/068 Text Justification py3.py @@ -0,0 +1,128 @@ +#!/usr/bin/python3 +""" +Given an array of words and a width maxWidth, format the text such that each line has exactly maxWidth characters and is fully (left and right) justified. + +You should pack your words in a greedy approach; that is, pack as many words as you can in each line. Pad extra spaces ' ' when necessary so that each line has exactly maxWidth characters. + +Extra spaces between words should be distributed as evenly as possible. If the number of spaces on a line do not divide evenly between words, the empty slots on the left will be assigned more spaces than the slots on the right. + +For the last line of text, it should be left justified and no extra space is inserted between words. + +Note: + +A word is defined as a character sequence consisting of non-space characters only. +Each word's length is guaranteed to be greater than 0 and not exceed maxWidth. +The input array words contains at least one word. +Example 1: + +Input: +words = ["This", "is", "an", "example", "of", "text", "justification."] +maxWidth = 16 +Output: +[ + "This is an", + "example of text", + "justification. " +] +Example 2: + +Input: +words = ["What","must","be","acknowledgment","shall","be"] +maxWidth = 16 +Output: +[ + "What must be", + "acknowledgment ", + "shall be " +] +Explanation: Note that the last line is "shall be " instead of "shall be", + because the last line must be left-justified instead of fully-justified. + Note that the second line is also left-justified becase it contains only one word. +Example 3: + +Input: +words = ["Science","is","what","we","understand","well","enough","to","explain", + "to","a","computer.","Art","is","everything","else","we","do"] +maxWidth = 20 +Output: +[ + "Science is what we", + "understand well", + "enough to explain to", + "a computer. Art is", + "everything else we", + "do " +] +""" +from typing import List + + +class Solution: + def fullJustify(self, words: List[str], maxWidth: int) -> List[str]: + """ + Round robin distribution of spaces + + Jump and then backtrack + """ + ret = [] + char_cnt = 0 # char exclude spaces + cur_words = [] + + for w in words: + cur_words.append(w) + char_cnt += len(w) + if char_cnt + len(cur_words) - 1 > maxWidth: + # break + cur_words.pop() + char_cnt -= len(w) + for i in range(maxWidth - char_cnt): + cur_words[i % max(1, len(cur_words) - 1)] += " " + + ret.append("".join(cur_words)) + + cur_words = [w] + char_cnt = len(w) + + # last line + last = " ".join(cur_words) + ret.append(last + " " * (maxWidth - len(last))) + return ret + + +class Solution2: + def fullJustify(self, words: List[str], maxWidth: int) -> List[str]: + """ + Round robin distribution of spaces + + Look before jump + Look before you leap + """ + ret = [] + char_cnt = 0 + cur_words = [] + + for w in words: + # len(cur_words) is the space needed with len(cur_words) + 1 words + if char_cnt + len(w) + len(cur_words) > maxWidth: + # break, move w into the next line + # Round robin distribut the spaces except for the last word + for i in range(maxWidth - char_cnt): + cur_words[i % max(1, len(cur_words) - 1)] += " " # insert in between + # len(cur_words) - 1 can be 0 + ret.append("".join(cur_words)) + + cur_words = [] + char_cnt = 0 + + cur_words.append(w) + char_cnt += len(w) + + # last line + last = " ".join(cur_words) + ret.append(last + " " * (maxWidth - len(last))) + return ret + + +if __name__ == "__main__": + assert Solution().fullJustify(["This", "is", "an", "example", "of", "text", "justification."], 16) == ["This is an","example of text","justification. "] + assert Solution().fullJustify(["What","must","be","acknowledgment","shall","be"], 16) == ["What must be","acknowledgment ","shall be "] diff --git a/070 Text Justification.py b/070 Text Justification.py index 6e46ff2..ef48fc8 100644 --- a/070 Text Justification.py +++ b/070 Text Justification.py @@ -29,6 +29,8 @@ In this case, that line should be left-justified. """ __author__ = 'Danyang' + + class Solution: def fullJustify(self, words, L): """ @@ -95,4 +97,4 @@ def distribute_space(self, L, result): if __name__=="__main__": print Solution().fullJustify(["This", "is", "an", "example", "of", "text", "justification."], 16) - print Solution().fullJustify(["What","must","be","shall","be."], 12) \ No newline at end of file + print Solution().fullJustify(["What","must","be","shall","be."], 12) diff --git a/074 Search a 2D Matrix.py b/074 Search a 2D Matrix.py index 7bb2dd1..1e32925 100644 --- a/074 Search a 2D Matrix.py +++ b/074 Search a 2D Matrix.py @@ -15,48 +15,50 @@ Given target = 3, return true. """ __author__ = 'Danyang' -class Solution: - def searchMatrix(self, matrix, target): + + +class Solution(object): + def searchMatrix(self, mat, target): """ binary search. Two exactly the same binary search algorithm - :param matrix: a list of lists of integers + :param mat: a list of lists of integers :param target: an integer :return: a boolean """ - if not matrix: + if not mat: return False - m = len(matrix) - n = len(matrix[0]) + m = len(mat) + n = len(mat[0]) # binary search - start = 0 - end = m # [0, m) - while startmatrix[mid][0]: - start = mid+1 + elif mat[mid][0] < target: + lo = mid+1 + else: + hi = mid - - lst = matrix[end] if matrix[end][0]<=target else matrix[start] # positioning ! + lst = mat[lo-1] # <= # binary search - start = 0 - end = n # [0, n) - while startlst[mid]: - start = mid+1 + elif lst[mid] < target: + lo = mid+1 + else: + hi = mid return False -if __name__=="__main__": - assert Solution().searchMatrix([[1], [3]], 3)==True \ No newline at end of file + +if __name__ == "__main__": + assert Solution().searchMatrix([[1], [3]], 3) == True \ No newline at end of file diff --git a/076 Minimum Window Substring.py b/076 Minimum Window Substring.py index 3800991..de29d9b 100644 --- a/076 Minimum Window Substring.py +++ b/076 Minimum Window Substring.py @@ -12,8 +12,12 @@ If there are multiple such windows, you are guaranteed that there will always be only one unique minimum window in S. """ +import sys + __author__ = 'Danyang' -class Solution: + + +class Solution(object): def minWindow(self, S, T): """ Algorithm: @@ -24,37 +28,37 @@ def minWindow(self, S, T): :param T: str :return: str """ - min_window = [0, 1<<32] # [start, end) - w_chars = [0 for _ in range(256)] # window - T_CHARS = [0 for _ in range(256)] # 256 ascii, static + min_win = [0, sys.maxint] # [start, end) + w_cnt = [0 for _ in range(256)] # window + t_cnt = [0 for _ in range(256)] # 256 ascii, static for char in T: - T_CHARS[ord(char)] += 1 # remain static after construction + t_cnt[ord(char)] += 1 appeared_cnt = 0 - start_ptr = 0 - for end_ptr in xrange(len(S)): + lo = 0 + for hi in xrange(1, len(S)+1): # expand - val = S[end_ptr] - if T_CHARS[ord(val)]>0: - w_chars[ord(val)] += 1 - if T_CHARS[ord(val)]>0 and w_chars[ord(val)]<=T_CHARS[ord(val)]: - appeared_cnt += 1 # when to decrease appeared_cnt? + val = S[hi-1] + if t_cnt[ord(val)] > 0: + w_cnt[ord(val)] += 1 + + if t_cnt[ord(val)] > 0 and w_cnt[ord(val)] <= t_cnt[ord(val)]: + appeared_cnt += 1 # cache, determine when to decrease appeared_cnt # shrink - if appeared_cnt==len(T): # until find all - # while w_chars[ord(S[start_ptr])]>T_CHARS[ord(S[start_ptr])] or w_chars[ord(S[start_ptr])]<=0: - while w_chars[ord(S[start_ptr])]>T_CHARS[ord(S[start_ptr])] or T_CHARS[ord(S[start_ptr])]<=0: - w_chars[ord(S[start_ptr])] -= 1 # if negative, it doesn't matter - start_ptr += 1 + if appeared_cnt == len(T): # until find all + while w_cnt[ord(S[lo])] > t_cnt[ord(S[lo])] or t_cnt[ord(S[lo])] == 0: + if w_cnt[ord(S[lo])] > 0: w_cnt[ord(S[lo])] -= 1 + lo += 1 - # after shrinking, still valid window - if min_window[1]-min_window[0]>end_ptr-start_ptr+1: - min_window[0], min_window[1] = start_ptr, end_ptr+1 + if min_win[1]-min_win[0] > hi-lo: + min_win[0], min_win[1] = lo, hi - if min_window[1]==1<<32: + if min_win[1] == sys.maxint: return "" else: - return S[min_window[0]:min_window[1]] + return S[min_win[0]:min_win[1]] + -if __name__=="__main__": - assert Solution().minWindow("ADOBECODEBANC", "ABC")=="BANC" \ No newline at end of file +if __name__ == "__main__": + assert Solution().minWindow("ADOBECODEBANC", "ABC") == "BANC" \ No newline at end of file diff --git a/079 Word Search py3.py b/079 Word Search py3.py new file mode 100644 index 0000000..1d8e6c0 --- /dev/null +++ b/079 Word Search py3.py @@ -0,0 +1,63 @@ +#!/usr/bin/python3 +""" +Given a 2D board and a word, find if the word exists in the grid. + +The word can be constructed from letters of sequentially adjacent cell, where +"adjacent" cells are those horizontally or vertically neighboring. The same +letter cell may not be used more than once. + +Example: + +board = +[ + ['A','B','C','E'], + ['S','F','C','S'], + ['A','D','E','E'] +] + +Given word = "ABCCED", return true. +Given word = "SEE", return true. +Given word = "ABCB", return false. +""" +from typing import List +from collections import defaultdict + + +dirs = [(0, -1), (0, 1), (1, 0), (-1, 0)] + + +class Solution: + def exist(self, board: List[List[str]], word: str) -> bool: + m, n = len(board), len(board[0]) + visited = defaultdict(lambda: defaultdict(bool)) + for i in range(m): + for j in range(n): + if board[i][j] == word[0]: + if self.dfs(board, visited, i, j, word, 1): + return True + + return False + + def dfs(self, board, visited, i, j, word, idx): + visited[i][j] = True + if idx >= len(word): + return True + + m, n = len(board), len(board[0]) + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n and not visited[I][J] and board[I][J] == word[idx]: + if self.dfs(board, visited, I, J, word, idx + 1): + return True + + visited[i][j] = False # restore + return False + + +if __name__ == "__main__": + assert Solution().exist([ + ["A","B","C","E"], + ["S","F","E","S"], + ["A","D","E","E"] + ], "ABCESEEEFS") == True diff --git a/088 Merge Sorted Array.py b/088 Merge Sorted Array.py index 40e3df2..85875a1 100644 --- a/088 Merge Sorted Array.py +++ b/088 Merge Sorted Array.py @@ -6,7 +6,9 @@ number of elements initialized in A and B are m and n respectively. """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): def merge(self, A, m, B, n): """ array, ascending order. @@ -24,9 +26,9 @@ def merge(self, A, m, B, n): j = n-1 closed = m+n - while i>=0 and j>=0: + while i >= 0 and j >= 0: closed -= 1 - if A[i]>B[j]: + if A[i] > B[j]: A[closed] = A[i] i -= 1 else: @@ -35,13 +37,5 @@ def merge(self, A, m, B, n): # either-or # dangling - while j>=0: - closed -= 1 - A[closed] = B[j] - j -= 1 - - # dangling - while i>=0: - closed -= 1 - A[closed] = A[i] - i -= 1 + if j >= 0: A[:closed] = B[:j+1] + # if i >= 0: A[:closed] = A[:i+1] diff --git a/091 Decode Ways.py b/091 Decode Ways.py index 7d3741e..6fccfac 100644 --- a/091 Decode Ways.py +++ b/091 Decode Ways.py @@ -13,13 +13,16 @@ The number of ways decoding "12" is 2. """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): def numDecodings(self, s): """ - dp + F + Let F[i] be the number of decode ways for s[:i] - 1 2 2 3 1 2 2 3 1 1 2 ? ? - dp[i] = (dp[i-1]) + optional(dp[i-2]) + F[i] = (F[i-1]) + optional(F[i-2])) notice the special handling for "0 @@ -32,27 +35,26 @@ def numDecodings(self, s): n = len(s) if not s: return 0 - dp = [0 for _ in xrange(n+1)] - dp[0] = 1 - dp[1] = 1 + F = [0 for _ in xrange(n+1)] + F[0] = 1 + F[1] = 1 for i in xrange(2, n+1): - if s[i-1]!="0": - dp[i] = dp[i-1] - if 10<=int(s[i-2]+s[i-1])<27: - dp[i] += dp[i-2] - + if s[i-1] != "0": + F[i] = F[i-1] + if 10 <= int(s[i-2]+s[i-1]) < 27: + F[i] += F[i-2] else: # 0 is special - if s[i-2] not in ("1", "2"): - return 0 + if s[i-2] in ("1", "2"): + F[i] = F[i-2] else: - dp[i] = dp[i-2] + return 0 + return F[-1] - return dp[-1] -if __name__=="__main__": - assert Solution().numDecodings("10")==1 - assert Solution().numDecodings("27")==1 - assert Solution().numDecodings("12")==2 - assert Solution().numDecodings("0")==0 \ No newline at end of file +if __name__ == "__main__": + assert Solution().numDecodings("10") == 1 + assert Solution().numDecodings("27") == 1 + assert Solution().numDecodings("12") == 2 + assert Solution().numDecodings("0") == 0 \ No newline at end of file diff --git a/092 Reverse Linked List II py3.py b/092 Reverse Linked List II py3.py new file mode 100644 index 0000000..6c3e7e2 --- /dev/null +++ b/092 Reverse Linked List II py3.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +Reverse a linked list from position m to n. Do it in one-pass. + +Note: 1 ≤ m ≤ n ≤ length of list. + +Example: + +Input: 1->2->3->4->5->NULL, m = 2, n = 4 +Output: 1->4->3->2->5->NULL +""" + + +# Definition for singly-linked list. +class ListNode: + def __init__(self, x): + self.val = x + self.next = None + + +class Solution: + def reverseBetween(self, head: ListNode, m: int, n: int) -> ListNode: + prev = None + cur = head + + l = 1 + while l < m: + nxt = cur.next + prev = cur + cur = nxt + l += 1 + # prev cur (m) + # -> ... -> left -> right -> ... -> null + # (n) + # -> ... -> left <- right <- ... <- prev <- cur -> ... -> null + # -> ... -> left -> prev -> ... -> right -> cur -> ... -> null + leftend = prev + rightend = cur + + while l <= n: # notice is it <= + nxt = cur.next + cur.next = prev + prev = cur + cur = nxt + l += 1 + + if m != 1: # leftend is None + leftend.next = prev + else: + head = prev + + rightend.next = cur + return head diff --git a/093 Restore IP Addresses.py b/093 Restore IP Addresses.py index 992c8f1..9c44ba6 100644 --- a/093 Restore IP Addresses.py +++ b/093 Restore IP Addresses.py @@ -7,6 +7,8 @@ return ["255.255.11.135", "255.255.111.35"]. (Order does not matter) """ __author__ = 'Danyang' + + class Solution: def restoreIpAddresses(self, s): """ @@ -27,11 +29,11 @@ def dfs_complicated(self, seq, cur, result): :param result: :return: """ - if len(cur)>4: + if len(cur) > 4: return if not cur or self.is_valid(cur[-1]): - if len(cur)==4 and not seq: # check the last one first + if len(cur) == 4 and not seq: # check the last one first result.append(".".join(cur)) return @@ -57,20 +59,19 @@ def dfs(self, seq, cur, result): # for i in xrange(1, 3+1): # for loop - for i in xrange(1, min(3, len(seq))+1): + for i in xrange(1, min(3, len(seq)) + 1): new_seg = seq[:i] # condition check - if len(cur)<4 and self.is_valid(new_seg): - self.dfs(seq[i:], cur+[new_seg], result) + if len(cur) < 4 and self.is_valid(new_seg): + self.dfs(seq[i:], cur + [new_seg], result) else: return - def is_valid(self, s): if not s: return False - return s=="0" or s[0]!="0" and 0<=int(s)<256 # ["0.0.0.0"] + return s == "0" or s[0]!="0" and 0<= int(s) <256 # ["0.0.0.0"] if __name__=="__main__": IP = "25525511135" - print Solution().restoreIpAddresses(IP) \ No newline at end of file + print Solution().restoreIpAddresses(IP) diff --git a/094 Unique Binary Search Trees.py b/094 Unique Binary Search Trees.py index cb0f7be..021ddc8 100644 --- a/094 Unique Binary Search Trees.py +++ b/094 Unique Binary Search Trees.py @@ -10,8 +10,12 @@ / / \ \ 2 1 2 3 """ +import math + __author__ = 'Danyang' -class Solution: + + +class Solution(object): def numTrees_math(self, n): """ number of unique binary search tree @@ -22,14 +26,8 @@ def numTrees_math(self, n): :param n: integer :return: integer """ - return self.factorial(2*n)/(self.factorial(n)*self.factorial(n)) -self.factorial(2*n)/( - self.factorial(n+1)*self.factorial(n-1)) - - def factorial(self, n): - factorial = 1 - for i in range(n): - factorial *= i+1 - return factorial + return math.factorial(2*n)/(math.factorial(n)*math.factorial(n))-math.factorial(2*n)/( + math.factorial(n+1)*math.factorial(n-1)) def numTrees(self, n): """ @@ -47,7 +45,7 @@ def numTrees(self, n): :param n: integer :return: integer """ - if n<2: + if n < 2: return n dp = [0 for _ in xrange(n+1)] @@ -58,5 +56,5 @@ def numTrees(self, n): return dp[-1] -if __name__=="__main__": - assert Solution().numTrees(100)==Solution().numTrees_math(100) \ No newline at end of file +if __name__ == "__main__": + assert Solution().numTrees(100) == Solution().numTrees_math(100) \ No newline at end of file diff --git a/095 Binary Tree Inorder Traversal.py b/095 Binary Tree Inorder Traversal.py index 753f078..e929ac0 100644 --- a/095 Binary Tree Inorder Traversal.py +++ b/095 Binary Tree Inorder Traversal.py @@ -15,15 +15,42 @@ confused what "{1,#,2,3}" means? > read more on how binary tree is serialized on OJ. """ __author__ = 'Danyang' -# Definition for a binary tree node -class TreeNode: + + +class TreeNode(object): def __init__(self, x): self.val = x self.left = None self.right = None -class Solution: + +class Solution(object): def inorderTraversal(self, root): + """ + Morris Traversal + """ + ret = [] + cur = root + while cur: + if not cur.left: + ret.append(cur.val) + cur = cur.right + else: + pre = cur.left + while pre.right and pre.right != cur: + pre = pre.right + + if not pre.right: + pre.right = cur + cur = cur.left + else: + pre.right = None + ret.append(cur.val) + cur = cur.right + + return ret + + def inorderTraversal_memory(self, root): """ :type root: TreeNode :param root: diff --git a/096 Unique Binary Search Trees II.py b/096 Unique Binary Search Trees II.py index 565d963..94941fa 100644 --- a/096 Unique Binary Search Trees II.py +++ b/096 Unique Binary Search Trees II.py @@ -12,30 +12,59 @@ confused what "{1,#,2,3}" means? > read more on how binary tree is serialized on OJ. """ __author__ = 'Danyang' + + # Definition for a binary tree node -class TreeNode: +class TreeNode(object): def __init__(self, x): self.val = x self.left = None self.right = None -class Solution: +class Solution(object): + def __init__(self): + self.cache = {} + def generateTrees(self, n): """ dfs - Catalan: https://www.youtube.com/watch?v=QdcujZTp_8M (Forth proof) + Catalan :param n: integer :return: list of TreeNode """ - if n==0: + if n == 0: return [None] - return self.generate(1, n) + return self.generate_cache(1, n) + + def generate_cache(self, start, end): + """80ms""" + if (start, end) not in self.cache: + roots = [] + if start > end: + roots.append(None) + return roots + + for pivot in range(start, end+1): + left_roots = self.generate_cache(start, pivot-1) + right_roots = self.generate_cache(pivot+1, end) + for left_root in left_roots: + for right_root in right_roots: + root = TreeNode(pivot) + root.left = left_root + root.right = right_root + + roots.append(root) + + self.cache[(start, end)] = roots + + return self.cache[(start, end)] def generate(self, start, end): """ - dfs without dp + dfs (cache possible) + 100 ms {number| number \in [start, end]} Follow the 1st proof of Catalan Number @@ -46,15 +75,15 @@ def generate(self, start, end): subtree_roots = [] # trivial - if start>end: + if start > end: subtree_roots.append(None) return subtree_roots # pivot # list of unique subtrees = list of unique left subtrees, pivot, list of unique right subtrees for pivot in range(start, end+1): - left_subtree_roots = self.generate(start, pivot-1) # no dp yet - right_subtree_roots = self.generate(pivot+1, end) # no dp yet + left_subtree_roots = self.generate(start, pivot-1) + right_subtree_roots = self.generate(pivot+1, end) for left_node in left_subtree_roots: for right_node in right_subtree_roots: @@ -64,7 +93,4 @@ def generate(self, start, end): subtree_roots.append(pivot_node) - return subtree_roots - - diff --git a/097 Interleaving String.py b/097 Interleaving String.py index 2b1c35f..f2b3723 100644 --- a/097 Interleaving String.py +++ b/097 Interleaving String.py @@ -10,27 +10,9 @@ When s3 = "aadbbbaccc", return false. """ __author__ = 'Danyang' -class Solution: - def isInterleave_TLE(self, s1, s2, s3): - """ - dfs - Time Limit Exceeded - :param s1: - :param s2: - :param s3: - :return: boolean - """ - if not s3: - return True - letter = s3[0] - if s1 and s1[0]==letter: - if self.isInterleave(s1[1:], s2, s3[1:]): - return True - if s2 and s2[0]==letter: - if self.isInterleave(s1, s2[1:], s3[1:]): - return True - return False + +class Solution(object): def isInterleave(self, s1, s2, s3): """ dfs @@ -72,7 +54,7 @@ def isInterleave(self, s1, s2, s3): """ m = len(s1) n = len(s2) - if m+n!=len(s3): + if m+n != len(s3): return False dp = [[False for _ in xrange(n+1)] for _ in xrange(m+1)] @@ -80,25 +62,42 @@ def isInterleave(self, s1, s2, s3): # initialize boundary conditions dp[0][0] = True for i in xrange(1, m+1): - dp[i][0] = dp[i-1][0] and s3[i+0-1]==s1[i-1] + dp[i][0] = dp[i-1][0] and s3[i+0-1] == s1[i-1] for j in xrange(1, n+1): - dp[0][j] = dp[0][j-1] and s3[0+j-1]==s2[j-1] + dp[0][j] = dp[0][j-1] and s3[0+j-1] == s2[j-1] # calculating for i in xrange(1, m+1): for j in xrange(1, n+1): if not dp[i][j]: - dp[i][j] = dp[i-1][j] and s3[i+j-1]==s1[i-1] + dp[i][j] = dp[i-1][j] and s3[i+j-1] == s1[i-1] if not dp[i][j]: - dp[i][j] = dp[i][j-1] and s3[i+j-1]==s2[j-1] + dp[i][j] = dp[i][j-1] and s3[i+j-1] == s2[j-1] return dp[-1][-1] + def isInterleave_TLE(self, s1, s2, s3): + """ + dfs + Time Limit Exceeded + :param s1: + :param s2: + :param s3: + :return: boolean + """ + if not s3: + return True + letter = s3[0] + if s1 and s1[0] == letter: + if self.isInterleave(s1[1:], s2, s3[1:]): + return True + if s2 and s2[0] == letter: + if self.isInterleave(s1, s2[1:], s3[1:]): + return True + return False - - -if __name__=="__main__": - assert Solution().isInterleave("aa", "ab", "abaa")==True - assert Solution().isInterleave("aabcc", "dbbca", "aadbbcbcac")==True - assert Solution().isInterleave("aabcc", "dbbca", "aadbbbaccc")==False \ No newline at end of file +if __name__ == "__main__": + assert Solution().isInterleave("aa", "ab", "abaa") == True + assert Solution().isInterleave("aabcc", "dbbca", "aadbbcbcac") == True + assert Solution().isInterleave("aabcc", "dbbca", "aadbbbaccc") == False \ No newline at end of file diff --git a/1000 Minimum Cost to Merge Stones.py b/1000 Minimum Cost to Merge Stones.py new file mode 100644 index 0000000..88cf783 --- /dev/null +++ b/1000 Minimum Cost to Merge Stones.py @@ -0,0 +1,118 @@ +#!/usr/bin/python3 +""" +There are N piles of stones arranged in a row. The i-th pile has stones[i] +stones. + +A move consists of merging exactly K consecutive piles into one pile, and the +cost of this move is equal to the total number of stones in these K piles. + +Find the minimum cost to merge all piles of stones into one pile. If it is +impossible, return -1. + + + +Example 1: + +Input: stones = [3,2,4,1], K = 2 +Output: 20 +Explanation: +We start with [3, 2, 4, 1]. +We merge [3, 2] for a cost of 5, and we are left with [5, 4, 1]. +We merge [4, 1] for a cost of 5, and we are left with [5, 5]. +We merge [5, 5] for a cost of 10, and we are left with [10]. +The total cost was 20, and this is the minimum possible. +Example 2: + +Input: stones = [3,2,4,1], K = 3 +Output: -1 +Explanation: After any merge operation, there are 2 piles left, and we can't +merge anymore. So the task is impossible. +Example 3: + +Input: stones = [3,5,1,2,6], K = 3 +Output: 25 +Explanation: +We start with [3, 5, 1, 2, 6]. +We merge [5, 1, 2] for a cost of 8, and we are left with [3, 8, 6]. +We merge [3, 8, 6] for a cost of 17, and we are left with [17]. +The total cost was 25, and this is the minimum possible. + + +Note: + +1 <= stones.length <= 30 +2 <= K <= 30 +1 <= stones[i] <= 100 +""" +from typing import List +from functools import lru_cache + + +class Solution: + def mergeStones(self, stones: List[int], K: int) -> int: + """ + Mergeable? K -> 1. Reduction size (K - 1) + N - (K - 1) * m = 1 + mergeable: (N - 1) % (K - 1) = 0 + + K consecutive + every piles involves at least once + Non-consecutive: priority queue merge the least first + But here it is consecutive, need to search, cannot gready + + * Merge the piles cost the same as merge individual ones. + + Attemp 1: + F[i] = cost to merge A[:i] into 1 + F[i] = F[i-3] + A[i-1] + A[i-2] + A[i-3] ?? + + Attemp 2: + F[i][j] = cost of merge A[i:j] into 1 + F[i][j] = F[i][k] + F[k][j] ?? + + Answer: + F[i][j][m] = cost of merge A[i:j] into m piles + F[i][j][1] = F[i][j][k] + sum(stones[i:j]) # merge + F[i][j][m] = min F[i][mid][1] + F[mid][j][m-1] # add + + initial: + F[i][i+1][1] = 0 + F[i][i+1][m] = inf + + since the mid goes through the middle in the i, j. + Use memoization rather than dp + """ + N = len(stones) + sums = [0] + for s in stones: + sums.append(sums[-1] + s) + + @lru_cache(None) + def F(i, j, m): + if i >= j or m < 1: + return float("inf") + + n = j - i + if (n - m) % (K - 1) != 0: + return float("inf") + + if j == i + 1: + if m == 1: + return 0 + return float("inf") + + if m == 1: + return F(i, j, K) + sums[j] - sums[i] + + ret = min( + F(i, mid, 1) + F(mid, j, m - 1) + for mid in range(i + 1, j, K - 1) + ) + return ret + + ret = F(0, N, 1) + return ret if ret != float("inf") else -1 + + +if __name__ == "__main__": + assert Solution().mergeStones([3,5,1,2,6], 3) == 25 diff --git a/1001 Grid Illumination.py b/1001 Grid Illumination.py new file mode 100644 index 0000000..ed58566 --- /dev/null +++ b/1001 Grid Illumination.py @@ -0,0 +1,4 @@ +#!/usr/bin/python3 +""" + +""" diff --git a/1002 Find Common Characters.py b/1002 Find Common Characters.py new file mode 100644 index 0000000..eeddfb4 --- /dev/null +++ b/1002 Find Common Characters.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +Given an array A of strings made only from lowercase letters, return a list of +all characters that show up in all strings within the list (including +duplicates). For example, if a character occurs 3 times in all strings but not +4 times, you need to include that character three times in the final answer. + +You may return the answer in any order. + + + +Example 1: + +Input: ["bella","label","roller"] +Output: ["e","l","l"] +Example 2: + +Input: ["cool","lock","cook"] +Output: ["c","o"] + + +Note: + +1 <= A.length <= 100 +1 <= A[i].length <= 100 +A[i][j] is a lowercase letter +""" +import string + +from typing import List +from collections import Counter + + +class Solution: + def commonChars(self, A: List[str]) -> List[str]: + """ + running counter + """ + ret = [] + if not A: + return ret + + counter = Counter(A[0]) + for a in A[1:]: + cur = Counter(a) + for c in string.ascii_lowercase: + counter[c] = min(counter[c], cur[c]) + + for c in string.ascii_lowercase: + if counter[c] > 0: + ret.extend([c] * counter[c]) + + return ret diff --git a/1003 Check If Word Is Valid After Substitutions.py b/1003 Check If Word Is Valid After Substitutions.py new file mode 100644 index 0000000..85bd5ff --- /dev/null +++ b/1003 Check If Word Is Valid After Substitutions.py @@ -0,0 +1,77 @@ +#!/usr/bin/python3 +""" +Given a string s, determine if it is valid. + +A string s is valid if, starting with an empty string t = "", you can transform t into s after performing the following operation any number of times: + +Insert string "abc" into any position in t. More formally, t becomes tleft + "abc" + tright, where t == tleft + tright. Note that tleft and tright may be empty. +Return true if s is a valid string, otherwise, return false. + + + +Example 1: + +Input: s = "aabcbc" +Output: true +Explanation: +"" -> "abc" -> "aabcbc" +Thus, "aabcbc" is valid. +Example 2: + +Input: s = "abcabcababcc" +Output: true +Explanation: +"" -> "abc" -> "abcabc" -> "abcabcabc" -> "abcabcababcc" +Thus, "abcabcababcc" is valid. +Example 3: + +Input: s = "abccba" +Output: false +Explanation: It is impossible to get "abccba" using the operation. + + +Constraints: + +1 <= s.length <= 2 * 104 +s consists of letters 'a', 'b', and 'c' +""" + +from collections import defaultdict + +class Solution: + def isValid_naive(self, s: str) -> bool: + """ + similar to valid parenthesis of () + cnt[a] >= cnt[b] >= cnt[c] + in the end, cnt[a] == cnt[b] == cnt[c] + but aaabbbccc is invalid + + remove "abc", there another "abc" in the string. O(N^2) + """ + if len(s) == 0: + return True + + for i in range(len(s) - 2): + if s[i:i+3] == "abc": + return self.isValid(s[:i] + s[i+3:]) + + return False + + def isValid(self, s: str) -> bool: + """ + when c, we there must be a and b immediately before + using stk + """ + stk = [] + for e in s: + if e in ("a", "b"): + stk.append(e) + else: # "c" + if len(stk) < 2: + return False + if stk.pop() != "b": + return False + if stk.pop() != "a": + return False + + return len(stk) == 0 \ No newline at end of file diff --git a/1004 Max Consecutive Ones III.py b/1004 Max Consecutive Ones III.py new file mode 100644 index 0000000..8bc72d4 --- /dev/null +++ b/1004 Max Consecutive Ones III.py @@ -0,0 +1,65 @@ +#!/usr/bin/python3 +""" +Given an array A of 0s and 1s, we may change up to K values from 0 to 1. + +Return the length of the longest (contiguous) subarray that contains only 1s. + + + +Example 1: + +Input: A = [1,1,1,0,0,0,1,1,1,1,0], K = 2 +Output: 6 +Explanation: +[1,1,1,0,0,1,1,1,1,1,1] +Bolded numbers were flipped from 0 to 1. The longest subarray is underlined. +Example 2: + +Input: A = [0,0,1,1,0,0,1,1,1,0,1,1,0,0,0,1,1,1,1], K = 3 +Output: 10 +Explanation: +[0,0,1,1,1,1,1,1,1,1,1,1,0,0,0,1,1,1,1] +Bolded numbers were flipped from 0 to 1. The longest subarray is underlined. + + +Note: +1 <= A.length <= 20000 +0 <= K <= A.length +A[i] is 0 or 1 +""" +from typing import List + + +class Solution: + def longestOnes(self, A: List[int], K: int) -> int: + """ + len(gap) + But there is multiple gap need to fill, and which gaps to fill is + undecided. Greedy? No. DP? + + Sliding Window: Find the longest subarray with at most K zeros. + """ + i, j = 0, 0 + cnt_0 = 0 + n = len(A) + ret = 0 + while i < n and j < n: + while j < n: + if A[j] == 0 and cnt_0 < K: + j += 1 + cnt_0 += 1 + elif A[j] == 1: + j += 1 + else: + break + + ret = max(ret, j - i) + if A[i] == 0: + cnt_0 -= 1 + i += 1 + + return ret + + +if __name__ == "__main__": + assert Solution().longestOnes([1,1,1,0,0,0,1,1,1,1,0], 2) == 6 diff --git a/1005 Maximize Sum Of Array After K Negations.py b/1005 Maximize Sum Of Array After K Negations.py new file mode 100644 index 0000000..a5950ae --- /dev/null +++ b/1005 Maximize Sum Of Array After K Negations.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +Given an array A of integers, we must modify the array in the following way: we +choose an i and replace A[i] with -A[i], and we repeat this process K times in +total. (We may choose the same index i multiple times.) + +Return the largest possible sum of the array after modifying it in this way. + + + +Example 1: + +Input: A = [4,2,3], K = 1 +Output: 5 +Explanation: Choose indices (1,) and A becomes [4,-2,3]. +Example 2: + +Input: A = [3,-1,0,2], K = 3 +Output: 6 +Explanation: Choose indices (1, 2, 2) and A becomes [3,1,0,2]. +Example 3: + +Input: A = [2,-3,-1,5,-4], K = 2 +Output: 13 +Explanation: Choose indices (1, 4) and A becomes [2,3,-1,5,4]. + + +Note: + +1 <= A.length <= 10000 +1 <= K <= 10000 +-100 <= A[i] <= 100 +""" +from typing import List + + +class Solution: + def largestSumAfterKNegations(self, A: List[int], K: int) -> int: + """ + revert all the negative, if positive, revert multiple times the smallest + + since -100 <= A[i] <= 100, then sort can be done in linear time + """ + A.sort() + for i in range(len(A)): + if K == 0: + break + + if A[i] < 0: + A[i] *= -1 + prev = A[i] + K -= 1 + else: + if K % 2 != 0: + if i - 1 >= 0 and A[i-1] < A[i]: + A[i-1] *= -1 + else: + A[i] *= -1 + break + + return sum(A) diff --git a/1006 Clumsy Factorial.py b/1006 Clumsy Factorial.py new file mode 100644 index 0000000..7cd1fe8 --- /dev/null +++ b/1006 Clumsy Factorial.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +The factorial of a positive integer n is the product of all positive integers less than or equal to n. + +For example, factorial(10) = 10 * 9 * 8 * 7 * 6 * 5 * 4 * 3 * 2 * 1. +We make a clumsy factorial using the integers in decreasing order by swapping out the multiply operations for a fixed rotation of operations with multiply '*', divide '/', add '+', and subtract '-' in this order. + +For example, clumsy(10) = 10 * 9 / 8 + 7 - 6 * 5 / 4 + 3 - 2 * 1. +However, these operations are still applied using the usual order of operations of arithmetic. We do all multiplication and division steps before any addition or subtraction steps, and multiplication and division steps are processed left to right. + +Additionally, the division that we use is floor division such that 10 * 9 / 8 = 90 / 8 = 11. + +Given an integer n, return the clumsy factorial of n. + + + +Example 1: + +Input: n = 4 +Output: 7 +Explanation: 7 = 4 * 3 / 2 + 1 +Example 2: + +Input: n = 10 +Output: 12 +Explanation: 12 = 10 * 9 / 8 + 7 - 6 * 5 / 4 + 3 - 2 * 1 + + +Constraints: + +1 <= n <= 104 +""" + +class Solution: + def clumsy(self, n: int) -> int: + """ + * / + - + + is applied, + - the next set of * / + """ + accu = 0 + for i in range(min(4, n)): + num = n - i + if i % 4 == 0: + accu += num + elif i % 4 == 1: + accu *= num + elif i % 4 == 2: + accu //= num + else: + accu += num + + cur = 0 + for i in range(4, n): + num = n - i + if i % 4 == 0: + cur += num + elif i % 4 == 1: + cur *= num + elif i % 4 == 2: + cur //= num + else: + accu += num + accu -= cur + cur = 0 + + return accu - cur # remaining cur \ No newline at end of file diff --git a/1007 Minimum Domino Rotations For Equal Row.py b/1007 Minimum Domino Rotations For Equal Row.py new file mode 100644 index 0000000..9b1e6ae --- /dev/null +++ b/1007 Minimum Domino Rotations For Equal Row.py @@ -0,0 +1,59 @@ +#!/usr/bin/python3 +""" +In a row of dominoes, tops[i] and bottoms[i] represent the top and bottom halves of the ith domino. (A domino is a tile with two numbers from 1 to 6 - one on each half of the tile.) + +We may rotate the ith domino, so that tops[i] and bottoms[i] swap values. + +Return the minimum number of rotations so that all the values in tops are the same, or all the values in bottoms are the same. + +If it cannot be done, return -1. + + +Example 1: + + +Input: tops = [2,1,2,4,2,2], bottoms = [5,2,6,2,3,2] +Output: 2 +Explanation: +The first figure represents the dominoes as given by tops and bottoms: before we do any rotations. +If we rotate the second and fourth dominoes, we can make every value in the top row equal to 2, as indicated by the second figure. +Example 2: + +Input: tops = [3,5,1,2,3], bottoms = [3,6,3,3,4] +Output: -1 +Explanation: +In this case, it is not possible to rotate the dominoes to make one row of values equal. + + +Constraints: + +2 <= tops.length <= 2 * 104 +bottoms.length == tops.length +1 <= tops[i], bottoms[i] <= 6 +""" +class Solution: + def minDominoRotations(self, tops: List[int], bottoms: List[int]) -> int: + """ + Mainly focus on making tops the same + bottoms check can be done by swapping the params + + find target first and then swap + """ + return min(self.find_min(tops, bottoms), self.find_min(bottoms, tops)) + + def find_min(self, tops, bottoms): + targets = set([tops[0], bottoms[0]]) + N = len(tops) + for i in range(1, N): + targets &= set([tops[i], bottoms[i]]) + + if len(targets) == 0: + return -1 + + target = targets.pop() + swap = 0 + for i in range(N): + if target != tops[i]: + swap += 1 + + return swap \ No newline at end of file diff --git a/1008 Construct Binary Search Tree from Preorder Traversal.py b/1008 Construct Binary Search Tree from Preorder Traversal.py new file mode 100644 index 0000000..805456f --- /dev/null +++ b/1008 Construct Binary Search Tree from Preorder Traversal.py @@ -0,0 +1,81 @@ +#!/usr/bin/python3 +""" +Return the root node of a binary search tree that matches the given preorder +traversal. + +(Recall that a binary search tree is a binary tree where for every node, any +descendant of node.left has a value < node.val, and any descendant of node.right +has a value > node.val. Also recall that a preorder traversal displays the +value of the node first, then traverses node.left, then traverses node.right.) + +Example 1: + +Input: [8,5,1,7,10,12] +Output: [8,5,10,1,7,null,12] + +Note: +1 <= preorder.length <= 100 +The values of preorder are distinct. +""" +from typing import List + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def bstFromPreorder2(self, preorder: List[int]) -> TreeNode: + """ + need to be BST + + scan the list to break left and right part + F(n) = 2 F(n/2) + O(n), then it is O(n log n) + + Make it O(n) + maintain a stack + After walking through example, left child can be determined quickly + since it is pre-order. Left comes first. + + Stack maintain a node that is missing right child + decreasing stack + """ + root = TreeNode(preorder[0]) + stk = [root] + for a in preorder[1:]: + node = TreeNode(a) + if a < stk[-1].val: # len(stk) always >= 1 + stk[-1].left = node + else: + while len(stk) >= 2 and stk[-2].val < a: + stk.pop() + + stk[-1].right = node + stk.pop() + + stk.append(node) + + return root + + def bstFromPreorder(self, preorder: List[int]) -> TreeNode: + """ + If a node is a right child (larger), find the proper parent + The proper parent should the deepest in the stack that its val < current val + """ + root = TreeNode(preorder[0]) + stk = [root] + for a in preorder[1:]: + node = TreeNode(a) + if a < stk[-1].val: + stk[-1].left = node + else: + while stk and stk[-1].val < a: + pi = stk.pop() + pi.right = node + stk.append(node) + + return root diff --git a/1009 Complement of Base 10 Integer.py b/1009 Complement of Base 10 Integer.py new file mode 100644 index 0000000..d04bd87 --- /dev/null +++ b/1009 Complement of Base 10 Integer.py @@ -0,0 +1,49 @@ +#!/usr/bin/python3 +""" +Every non-negative integer N has a binary representation. For example, 5 can be +represented as "101" in binary, 11 as "1011" in binary, and so on. Note that +except for N = 0, there are no leading zeroes in any binary representation. + +The complement of a binary representation is the number in binary you get when +changing every 1 to a 0 and 0 to a 1. For example, the complement of "101" in +binary is "010" in binary. + +For a given number N in base-10, return the complement of it's binary +representation as a base-10 integer. + +Example 1: +Input: 5 +Output: 2 +Explanation: 5 is "101" in binary, with complement "010" in binary, which is 2 +in base-10. + +Example 2: +Input: 7 +Output: 0 +Explanation: 7 is "111" in binary, with complement "000" in binary, which is 0 +in base-10. + +Example 3: +Input: 10 +Output: 5 +Explanation: 10 is "1010" in binary, with complement "0101" in binary, which is +5 in base-10. + +Note: +0 <= N < 10^9 +""" + + +class Solution: + def bitwiseComplement(self, N: int) -> int: + """ + invert the bit, and the mask it + """ + mask = 1 + cur = N + while cur >> 1: + cur >>= 1 + mask <<= 1 + mask += 1 + + return ~N & mask diff --git a/101 Symmetric Tree.py b/101 Symmetric Tree.py index 4df0e80..358cc88 100644 --- a/101 Symmetric Tree.py +++ b/101 Symmetric Tree.py @@ -20,37 +20,35 @@ confused what "{1,#,2,3}" means? > read more on how binary tree is serialized on OJ. """ __author__ = 'Danyang' + + # Definition for a binary tree node -class TreeNode: +class TreeNode(object): def __init__(self, x): self.val = x self.left = None self.right = None -class Solution: + +class Solution(object): def isSymmetric(self, root): """ dfs :param root: TreeNode :return: boolean """ - # Trivial if not root: return True return self.isSymmetrical(root.left, root.right) - - def isSymmetrical(self, mirror_left, mirror_right): - # Trivial - if not mirror_left and not mirror_right: + def isSymmetrical(self, l, r): + if not l and not r: return True # recursive - try: - if mirror_left.val==mirror_right.val and self.isSymmetrical(mirror_left.left, mirror_right.right) and self.isSymmetrical(mirror_left.right, mirror_right.left): - return True - except AttributeError: - return False + if (l and r and + l.val == r.val and self.isSymmetrical(l.left, r.right) and self.isSymmetrical(l.right, r.left)): + return True return False diff --git a/1010 Pairs of Songs With Total Durations Divisible by 60.py b/1010 Pairs of Songs With Total Durations Divisible by 60.py new file mode 100644 index 0000000..f0c7985 --- /dev/null +++ b/1010 Pairs of Songs With Total Durations Divisible by 60.py @@ -0,0 +1,65 @@ +#!/usr/bin/python3 +""" +In a list of songs, the i-th song has a duration of time[i] seconds. + +Return the number of pairs of songs for which their total duration in seconds is +divisible by 60. Formally, we want the number of indices i < j with (time[i] + +time[j]) % 60 == 0. + +Example 1: + +Input: [30,20,150,100,40] +Output: 3 +Explanation: Three pairs have a total duration divisible by 60: +(time[0] = 30, time[2] = 150): total duration 180 +(time[1] = 20, time[3] = 100): total duration 120 +(time[1] = 20, time[4] = 40): total duration 60 +Example 2: + +Input: [60,60,60] +Output: 3 +Explanation: All three pairs have a total duration of 120, which is divisible by 60. + +Note: +1 <= time.length <= 60000 +1 <= time[i] <= 500 +""" +from typing import List +from collections import defaultdict + + +class Solution: + def numPairsDivisibleBy60(self, time: List[int]) -> int: + """ + Running attribution + """ + counter = defaultdict(int) + ret = 0 + for t in time: + ret += counter[(60 - t) % 60] # handle 0 + counter[t % 60] += 1 + + return ret + + + def numPairsDivisibleBy60_error(self, time: List[int]) -> int: + """ + O(N^2) check i, j + Reduce it + O(N) by using hashmap, the key should mod 60 + + attribution error + """ + hm = defaultdict(int) + for t in time: + hm[t % 60] += 1 + + ret = 0 + for k, v in hm.items(): + if k == 0: + ret += (v * (v - 1)) // 2 + elif k <= 60 - k: # attribution + v2 = hm[60 - k] + ret += v2 * v + + return ret diff --git a/1011 Capacity To Ship Packages Within D Days.py b/1011 Capacity To Ship Packages Within D Days.py new file mode 100644 index 0000000..07a32a7 --- /dev/null +++ b/1011 Capacity To Ship Packages Within D Days.py @@ -0,0 +1,82 @@ +#!/usr/bin/python3 +""" +A conveyor belt has packages that must be shipped from one port to another +within D days. + +The i-th package on the conveyor belt has a weight of weights[i]. Each day, we +load the ship with packages on the conveyor belt (in the order given by +weights). We may not load more weight than the maximum weight capacity of the +ship. + +Return the least weight capacity of the ship that will result in all the +packages on the conveyor belt being shipped within D days. + +Example 1: + +Input: weights = [1,2,3,4,5,6,7,8,9,10], D = 5 +Output: 15 +Explanation: +A ship capacity of 15 is the minimum to ship all the packages in 5 days like +this: +1st day: 1, 2, 3, 4, 5 +2nd day: 6, 7 +3rd day: 8 +4th day: 9 +5th day: 10 + +Note that the cargo must be shipped in the order given, so using a ship of +capacity 14 and splitting the packages into parts like (2, 3, 4, 5), (1, 6, 7), +(8), (9), (10) is not allowed. +Example 2: + +Input: weights = [3,2,2,4,1,4], D = 3 +Output: 6 +Explanation: +A ship capacity of 6 is the minimum to ship all the packages in 3 days like +this: +1st day: 3, 2 +2nd day: 2, 4 +3rd day: 1, 4 +Example 3: + +Input: weights = [1,2,3,1,1], D = 4 +Output: 3 +Explanation: +1st day: 1 +2nd day: 2 +3rd day: 3 +4th day: 1, 1 + +Note: + +1 <= D <= weights.length <= 50000 +1 <= weights[i] <= 500 +""" +from tying import List + + +class Solution: + def shipWithinDays(self, weights: List[int], D: int) -> int: + """ + Must respect conveyor's order + + Binary search on value range (max, sum) + """ + lo = max(weights) + hi = sum(weights) + while lo < hi: + mid = (lo + hi) // 2 + cnt = 1 + cur = 0 + for w in weights: + cur += w + if cur > mid: + cnt += 1 + cur = w + + if cnt > D: + lo = mid + 1 + else: + hi = mid + + return lo diff --git a/1013 Partition Array Into Three Parts With Equal Sum.py b/1013 Partition Array Into Three Parts With Equal Sum.py new file mode 100644 index 0000000..b09b16a --- /dev/null +++ b/1013 Partition Array Into Three Parts With Equal Sum.py @@ -0,0 +1,55 @@ +#!/usr/bin/python3 +""" +Given an array A of integers, return true if and only if we can partition the +array into three non-empty parts with equal sums. + +Formally, we can partition the array if we can find indexes i+1 < j with (A[0] ++ A[1] + ... + A[i] == A[i+1] + A[i+2] + ... + A[j-1] == A[j] + A[j-1] + ... + +A[A.length - 1]) + +Example 1: + +Input: [0,2,1,-6,6,-7,9,1,2,0,1] +Output: true +Explanation: 0 + 2 + 1 = -6 + 6 - 7 + 9 + 1 = 2 + 0 + 1 +Example 2: + +Input: [0,2,1,-6,6,7,9,-1,2,0,1] +Output: false +Example 3: + +Input: [3,3,6,5,-2,2,5,1,-9,4] +Output: true +Explanation: 3 + 3 = 6 = 5 - 2 + 2 + 5 + 1 - 9 + 4 + +Note: + +3 <= A.length <= 50000 +-10000 <= A[i] <= 10000 +""" +from typing import List + + +class Solution: + def canThreePartsEqualSum(self, A: List[int]) -> bool: + s = sum(A) + if s % 3 != 0: + return False + + target = s // 3 + count = 0 + cur_sum = 0 + for a in A: + cur_sum += a + if cur_sum == target: + count += 1 + cur_sum = 0 + # elif cur_sum > target: + # return False + # can have negative number + + return count == 3 and cur_sum == 0 + + +if __name__ == "__main__": + assert Solution().canThreePartsEqualSum([3,3,6,5,-2,2,5,1,-9,4]) == True diff --git a/1014 Best Sightseeing Pair.py b/1014 Best Sightseeing Pair.py new file mode 100644 index 0000000..8673420 --- /dev/null +++ b/1014 Best Sightseeing Pair.py @@ -0,0 +1,69 @@ +#!/usr/bin/python3 +""" +Given an array A of positive integers, A[i] represents the value of the i-th +sightseeing spot, and two sightseeing spots i and j have distance j - i between +them. + +The score of a pair (i < j) of sightseeing spots is (A[i] + A[j] + i - j) : the +sum of the values of the sightseeing spots, minus the distance between them. + +Return the maximum score of a pair of sightseeing spots. + +Example 1: + +Input: [8,1,5,2,6] +Output: 11 +Explanation: i = 0, j = 2, A[i] + A[j] + i - j = 8 + 5 + 0 - 2 = 11 + + +Note: +2 <= A.length <= 50000 +1 <= A[i] <= 1000 +""" +from typing import List + + +class Solution: + def maxScoreSightseeingPair(self, A: List[int]) -> int: + """ + Attribute the result to the ending element + + Count the current best score in all previous. + Distance will increase, then the score will decay + """ + ret = -float("inf") + prev_max = A[0] + for a in A[1:]: + ret = max(ret, prev_max - 1 + a) + prev_max = max(prev_max - 1, a) + + return ret + + def maxScoreSightseeingPair_error(self, A: List[int]) -> int: + """ + brute force O(N^2) + + pre-processing, adjust A[i] as A[i] - i + error, no direction + """ + n = len(A) + B = [] + for i in range(n): + B.append(A[i] - i) + + # find top 2 + m1, m2 = None, None + for i in range(n): + if m1 is None: + m1 = i + elif m2 is None: + m2 = i + elif B[i] + (i - m1) > B[m1]: + m1 = i + elif B[i] + (i - m2) > B[m2]: + m2 = i + return A[m2] + A[m1] - abs(m2 - m1) + + +if __name__ == "__main__": + assert Solution().maxScoreSightseeingPair([8,1,5,2,6]) == 11 diff --git a/1015 Smallest Integer Divisible by K.py b/1015 Smallest Integer Divisible by K.py new file mode 100644 index 0000000..2d1dd1f --- /dev/null +++ b/1015 Smallest Integer Divisible by K.py @@ -0,0 +1,57 @@ +#!/usr/bin/python3 +""" +Given a positive integer k, you need to find the length of the smallest positive integer n such that n is divisible by k, and n only contains the digit 1. + +Return the length of n. If there is no such n, return -1. + +Note: n may not fit in a 64-bit signed integer. + + + +Example 1: + +Input: k = 1 +Output: 1 +Explanation: The smallest answer is n = 1, which has length 1. +Example 2: + +Input: k = 2 +Output: -1 +Explanation: There is no such positive integer n divisible by 2. +Example 3: + +Input: k = 3 +Output: 3 +Explanation: The smallest answer is n = 111, which has length 3. + + +Constraints: + +1 <= k <= 10^5 +""" +from collections import defaultdict + + +class Solution: + def smallestRepunitDivByK(self, k: int) -> int: + """ + 1 % k = 1 + 11 % k = prev * 10 + 1 % k + 111 % k = prev * 10 + 1 % k + """ + if k % 2 == 0 or k % 5 == 0: + return -1 + + hit = defaultdict(bool) + l = 1 + cur = 1 + remainder = 1 % k + while True: + if hit[remainder]: + return -1 + if remainder == 0: + return l + + hit[remainder] = True + remainder = (remainder * 10 + 1) % k + l += 1 diff --git a/1016 Binary String With Substrings Representing 1 To N.py b/1016 Binary String With Substrings Representing 1 To N.py new file mode 100644 index 0000000..e360018 --- /dev/null +++ b/1016 Binary String With Substrings Representing 1 To N.py @@ -0,0 +1,48 @@ +#!/usr/bin/python3 +""" +Given a binary string s and a positive integer n, return true if the binary representation of all the integers in the range [1, n] are substrings of s, or false otherwise. + +A substring is a contiguous sequence of characters within a string. + +Example 1: + +Input: s = "0110", n = 3 +Output: true +Example 2: + +Input: s = "0110", n = 4 +Output: false + + +Constraints: + +1 <= s.length <= 1000 +s[i] is either '0' or '1'. +1 <= n <= 10^9 +""" + +class Solution: + def queryString(self, s: str, n: int) -> bool: + """ + Naive solution: KMP string matching from 1 to N, O(N * (m + n)). + Python `in` is enough + + Construct numbers from the string s itself + Scan the s from left to right + """ + numbers = set() + for i in range(len(s)): + cur = 0 + sig = 1 + for j in range(i, len(s)): + if s[~j] == "1": + cur += sig + if cur > n: + break + + sig <<= 1 + + if cur != 0: + numbers.add(cur) + + return len(numbers) == n diff --git a/1017 Convert to Base -2.py b/1017 Convert to Base -2.py new file mode 100644 index 0000000..434b580 --- /dev/null +++ b/1017 Convert to Base -2.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +Given a number N, return a string consisting of "0"s and "1"s that represents +its value in base -2 (negative two). + +The returned string must have no leading zeroes, unless the string is "0". + + + +Example 1: + +Input: 2 +Output: "110" +Explantion: (-2) ^ 2 + (-2) ^ 1 = 2 +Example 2: + +Input: 3 +Output: "111" +Explantion: (-2) ^ 2 + (-2) ^ 1 + (-2) ^ 0 = 3 +Example 3: + +Input: 4 +Output: "100" +Explantion: (-2) ^ 2 = 4 + + +Note: +0 <= N <= 10^9 +""" +from collections import deque + + +class Solution: + def baseNeg2(self, N: int) -> str: + """ + % -2, // -2 ? not really + + alternating + + + 3 + (-2) ^ 2 + (-2) ^ 1 + (-2) ^ 0, LSB set + minus reminder, divide by -2 + (-2) ^ 1 + (-2) ^ 0, LSB set + minus reminder, divide by -2 + (-2) ^ 0, LSB set + + 4 + (-2) ^ 2 + 0 ^ 1 + 0 ^ 0, LSB not set + minus reminder, divide by -2 + (-2) ^ 1 + 0 ^ 0, LSB not set + minus reminder, divide by -2 + (-2) ^ 0, LSB set + """ + ret = deque() + while N != 0: + r = N % 2 # r is the range of 0 and 2 + ret.appendleft(r) + N -= r + N //= -2 + + return "".join(map(str, ret)) or "0" + + +if __name__ == "__main__": + assert Solution().baseNeg2(3) == "111" + assert Solution().baseNeg2(4) == "100" diff --git a/1018 Binary Prefix Divisible By 5.py b/1018 Binary Prefix Divisible By 5.py new file mode 100644 index 0000000..5c7d2bd --- /dev/null +++ b/1018 Binary Prefix Divisible By 5.py @@ -0,0 +1,52 @@ +#!/usr/bin/python3 +""" +Given an array A of 0s and 1s, consider N_i: the i-th subarray from A[0] to A[i] +interpreted as a binary number (from most-significant-bit to +least-significant-bit.) + +Return a list of booleans answer, where answer[i] is true if and only if N_i is +divisible by 5. + +Example 1: + +Input: [0,1,1] +Output: [true,false,false] +Explanation: +The input numbers in binary are 0, 01, 011; which are 0, 1, and 3 in base-10. +Only the first number is divisible by 5, so answer[0] is true. +Example 2: + +Input: [1,1,1] +Output: [false,false,false] +Example 3: + +Input: [0,1,1,1,1,1] +Output: [true,false,false,false,true,false] +Example 4: + +Input: [1,1,1,0,1] +Output: [false,false,false,false,false] + +Note: +1 <= A.length <= 30000 +A[i] is 0 or 1 +""" +from typing import List + + +class Solution: + def prefixesDivBy5(self, A: List[int]) -> List[bool]: + """ + brute force + """ + cur = 0 + ret = [] + for a in A: + cur = (cur << 1) + a + cur %= 5 + if cur == 0: + ret.append(True) + else: + ret.append(False) + + return ret diff --git a/1019 Next Greater Node In Linked List.py b/1019 Next Greater Node In Linked List.py new file mode 100644 index 0000000..2ffaccf --- /dev/null +++ b/1019 Next Greater Node In Linked List.py @@ -0,0 +1,65 @@ +#!/usr/bin/python3 +""" +We are given a linked list with head as the first node. Let's number the nodes +in the list: node_1, node_2, node_3, ... etc. + +Each node may have a next larger value: for node_i, next_larger(node_i) is the +node_j.val such that j > i, node_j.val > node_i.val, and j is the smallest +possible choice. If such a j does not exist, the next larger value is 0. + +Return an array of integers answer, where answer[i] = next_larger(node_{i+1}). + +Note that in the example inputs (not outputs) below, arrays such as [2,1,5] +represent the serialization of a linked list with a head node value of 2, second +node value of 1, and third node value of 5. + +Example 1: +Input: [2,1,5] +Output: [5,5,0] + +Example 2: +Input: [2,7,4,3,5] +Output: [7,0,5,5,0] + +Example 3: +Input: [1,7,5,1,9,2,5,1] +Output: [7,9,9,9,0,5,0,0] + +Note: +1 <= node.val <= 10^9 for each node in the linked list. +The given list has length in the range [0, 10000]. +""" + +# Definition for singly-linked list. +class ListNode: + def __init__(self, x): + self.val = x + self.next = None + + +from typing import List + + +class Solution: + def nextLargerNodes(self, head: ListNode) -> List[int]: + """ + If input is an array, use stack from right to left. Maintain a decreasing stack + + How to make it one-pass? Maintain a stack from left to right for the element + waiting for the next larger node + """ + ret = [] + stk = [] # [[index, value]] + i = 0 + cur = head + while cur: + while stk and stk[-1][1] < cur.val: + idx, _ = stk.pop() + ret[idx] = cur.val + + stk.append([i, cur.val]) + ret.append(0) + cur = cur.next + i += 1 + + return ret diff --git a/1020 Number of Enclaves.py b/1020 Number of Enclaves.py new file mode 100644 index 0000000..2e43d84 --- /dev/null +++ b/1020 Number of Enclaves.py @@ -0,0 +1,98 @@ +#!/usr/bin/python3 +""" +Given a 2D array A, each cell is 0 (representing sea) or 1 (representing land) + +A move consists of walking from one land square 4-directionally to another land +square, or off the boundary of the grid. + +Return the number of land squares in the grid for which we cannot walk off the +boundary of the grid in any number of moves. + +Example 1: +Input: [[0,0,0,0],[1,0,1,0],[0,1,1,0],[0,0,0,0]] +Output: 3 +Explanation: +There are three 1s that are enclosed by 0s, and one 1 that isn't enclosed +because its on the boundary. + +Example 2: +Input: [[0,1,1,0],[0,0,1,0],[0,0,1,0],[0,0,0,0]] +Output: 0 +Explanation: +All 1s are either on the boundary or can reach the boundary. + +Note: +1 <= A.length <= 500 +1 <= A[i].length <= 500 +0 <= A[i][j] <= 1 +All rows have the same size. +""" +from typing import List + + +dirs = ((0, -1), (0, 1), (1, 0), (-1, 0)) + + +class Solution: + def numEnclaves(self, A: List[List[int]]) -> int: + """ + not dfs from any cell, but dfs from the edges + """ + m, n = len(A), len(A[0]) + visited = [[False for _ in range(n)] for _ in range(m)] + for i in range(m): + for j in range(n): + if not visited[i][j] and A[i][j] == 1 and (i == 0 or j == 0 or i == m - 1 or j == n - 1): + self.dfs(A, i, j, visited) + + ret = 0 + for i in range(m): + for j in range(n): + if A[i][j] == 1 and not visited[i][j]: + ret += 1 + return ret + + def dfs(self, A, i, j, visited): + m, n = len(A), len(A[0]) + visited[i][j] = True + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n and not visited[I][J] and A[I][J] == 1: + self.dfs(A, I, J, visited) + + +class SolutionError: + def __init__(self): + self.ret = 0 + + def numEnclaves(self, A: List[List[int]]) -> int: + """ + dfs coloring + """ + m, n = len(A), len(A[0]) + visited = [[None for _ in range(n)] for _ in range(m)] # 0 not off, 1 off + for i in range(m): + for j in range(n): + if not visited[i][j] and A[i][j] == 1: + self.dfs(A, i, j, visited) + return self.ret + + def dfs(self, A, i, j, visited): + m, n = len(A), len(A[0]) + visited[i][j] = 0 + for di, dj in dirs: + I = i + di + J = j + dj + if not (0 <= I < m and 0 <= J < n): + visited[i][j] = 1 + return True + if visited[I][J] == 1: + visited[i][j] = 1 + return True + if visited[I][J] is None and A[I][J] == 1 and self.dfs(A, I, J, visited): + visited[i][j] = 1 + return True + + self.ret += 1 + return False diff --git a/1021 Remove Outermost Parentheses.py b/1021 Remove Outermost Parentheses.py new file mode 100644 index 0000000..2609aa7 --- /dev/null +++ b/1021 Remove Outermost Parentheses.py @@ -0,0 +1,96 @@ +#!/usr/bin/python3 +""" +A valid parentheses string is either empty (""), "(" + A + ")", or A + B, where +A and B are valid parentheses strings, and + represents string concatenation. +For example, "", "()", "(())()", and "(()(()))" are all valid parentheses strings. + +A valid parentheses string S is primitive if it is nonempty, and there does not +exist a way to split it into S = A+B, with A and B nonempty valid parentheses +strings. + +Given a valid parentheses string S, consider its primitive decomposition: +S = P_1 + P_2 + ... + P_k, where P_i are primitive valid parentheses strings. + +Return S after removing the outermost parentheses of every primitive string in +the primitive decomposition of S. + +Example 1: +Input: "(()())(())" +Output: "()()()" +Explanation: +The input string is "(()())(())", with primitive decomposition "(()())" + "(())". +After removing outer parentheses of each part, this is "()()" + "()" = "()()()". + +Example 2: +Input: "(()())(())(()(()))" +Output: "()()()()(())" +Explanation: +The input string is "(()())(())(()(()))", with primitive decomposition +"(()())" + "(())" + "(()(()))". +After removing outer parentheses of each part, this is "()()" + "()" + +"()(())" = "()()()()(())". + +Example 3: +Input: "()()" +Output: "" +Explanation: +The input string is "()()", with primitive decomposition "()" + "()". +After removing outer parentheses of each part, this is "" + "" = "". + + +Note: +S.length <= 10000 +S[i] is "(" or ")" +S is a valid parentheses string +""" +from collections import deque + + +class Solution: + def removeOuterParentheses(self, S: str) -> str: + """ + Primitive parentheses will have equal number of opened and closed + parentheses. + + Use count + Exclude the first and last parathesis + """ + ret = [] + cnt = 0 + for e in S: + if e == "(": + cnt += 1 + if cnt > 1: + ret.append(e) + else: + cnt -= 1 + if cnt > 0: + ret.append(e) + + return "".join(ret) + + + def removeOuterParentheses_error(self, S: str) -> str: + """ + stack + deque + """ + ret = [] + stk = [] + cur_q = deque() + for e in S: + if e == "(": + stk.append(e) + else: + prev = stk.pop() + if stk: + cur_q.appendleft(prev) + cur_q.append(e) + else: + ret.extend(cur_q) + cur_q = deque() + + return "".join(ret) + + +if __name__ == "__main__": + assert Solution().removeOuterParentheses("(()())(())(()(()))") == "()()()()(())" diff --git a/1022 Sum of Root To Leaf Binary Numbers.py b/1022 Sum of Root To Leaf Binary Numbers.py new file mode 100644 index 0000000..f5de32e --- /dev/null +++ b/1022 Sum of Root To Leaf Binary Numbers.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +Given a binary tree, each node has value 0 or 1. Each root-to-leaf path +represents a binary number starting with the most significant bit. For example, +if the path is 0 -> 1 -> 1 -> 0 -> 1, then this could represent 01101 in binary, +which is 13. + +For all leaves in the tree, consider the numbers represented by the path from +the root to that leaf. + +Return the sum of these numbers. + +Example 1: +Input: [1,0,1,0,1,0,1] +Output: 22 +Explanation: (100) + (101) + (110) + (111) = 4 + 5 + 6 + 7 = 22 + +Note: +The number of nodes in the tree is between 1 and 1000. +node.val is 0 or 1. +The answer will not exceed 2^31 - 1. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.ret = 0 + self.lst = [] + + def sumRootToLeaf(self, root: TreeNode) -> int: + """ + Brute force, keep a lst, space O(log n) + Error-prone + """ + self.dfs(root) + return self.ret + + def dfs(self, node): + if not node: + return + + self.lst.append(node.val) # error prone + if not node.left and not node.right: + # leaf + cur = 0 + for a in self.lst: + cur <<= 1 + cur += a + self.ret += cur + else: + self.dfs(node.left) + self.dfs(node.right) + self.lst.pop() diff --git a/1023 Camelcase Matching.py b/1023 Camelcase Matching.py new file mode 100644 index 0000000..b3becd7 --- /dev/null +++ b/1023 Camelcase Matching.py @@ -0,0 +1,71 @@ +#!/usr/bin/python3 +""" +A query word matches a given pattern if we can insert lowercase letters to the +pattern word so that it equals the query. (We may insert each character at any +position, and may insert 0 characters.) + +Given a list of queries, and a pattern, return an answer list of booleans, where +answer[i] is true if and only if queries[i] matches the pattern. + +Example 1: + +Input: queries = ["FooBar","FooBarTest","FootBall","FrameBuffer", +"ForceFeedBack"], pattern = "FB" +Output: [true,false,true,true,false] +Explanation: +"FooBar" can be generated like this "F" + "oo" + "B" + "ar". +"FootBall" can be generated like this "F" + "oot" + "B" + "all". +"FrameBuffer" can be generated like this "F" + "rame" + "B" + "uffer". +Example 2: + +Input: queries = ["FooBar","FooBarTest","FootBall","FrameBuffer", +"ForceFeedBack"], pattern = "FoBa" +Output: [true,false,true,false,false] +Explanation: +"FooBar" can be generated like this "Fo" + "o" + "Ba" + "r". +"FootBall" can be generated like this "Fo" + "ot" + "Ba" + "ll". +Example 3: + +Input: queries = ["FooBar","FooBarTest","FootBall","FrameBuffer", +"ForceFeedBack"], pattern = "FoBaT" +Output: [false,true,false,false,false] +Explanation: +"FooBarTest" can be generated like this "Fo" + "o" + "Ba" + "r" + "T" + "est". + +Note: +1 <= queries.length <= 100 +1 <= queries[i].length <= 100 +1 <= pattern.length <= 100 +All strings consists only of lower and upper case English letters. +""" +from typing import List + + +class Solution: + def camelMatch(self, queries: List[str], pattern: str) -> List[bool]: + ret = [] + for q in queries: + ret.append(self.match(q, pattern)) + + return ret + + def match(self, q, p): + i = 0 + j = 0 + while i < len(q) and j < len(p): + if q[i] == p[j]: + i += 1 + j += 1 + elif q[i].islower(): + i += 1 + else: + break + + while i < len(q) and q[i].islower(): + i += 1 + + return i == len(q) and j == len(p) + + +if __name__ == "__main__": + assert Solution().camelMatch(["FooBar","FooBarTest","FootBall","FrameBuffer","ForceFeedBack"], "FoBa") == [True, False, True, False, False] diff --git a/1024 Video Stitching.py b/1024 Video Stitching.py new file mode 100644 index 0000000..2b04a22 --- /dev/null +++ b/1024 Video Stitching.py @@ -0,0 +1,94 @@ +#!/usr/bin/python3 +""" +You are given a series of video clips from a sporting event that lasted T +seconds. These video clips can be overlapping with each other and have varied +lengths. + +Each video clip clips[i] is an interval: it starts at time clips[i][0] and ends +at time clips[i][1]. We can cut these clips into segments freely: for example, +a clip [0, 7] can be cut into segments [0, 1] + [1, 3] + [3, 7]. + +Return the minimum number of clips needed so that we can cut the clips into +segments that cover the entire sporting event ([0, T]). If the task is +impossible, return -1. + +Example 1: +Input: clips = [[0,2],[4,6],[8,10],[1,9],[1,5],[5,9]], T = 10 +Output: 3 +Explanation: +We take the clips [0,2], [8,10], [1,9]; a total of 3 clips. +Then, we can reconstruct the sporting event as follows: +We cut [1,9] into segments [1,2] + [2,8] + [8,9]. +Now we have segments [0,2] + [2,8] + [8,10] which cover the sporting event [0, 10]. +Example 2: + +Input: clips = [[0,1],[1,2]], T = 5 +Output: -1 +Explanation: +We can't cover [0,5] with only [0,1] and [0,2]. +Example 3: + +Input: clips = [[0,1],[6,8],[0,2],[5,6],[0,4],[0,3],[6,7],[1,3],[4,7],[1,4],[2,5],[2,6],[3,4],[4,5],[5,7],[6,9]], T = 9 +Output: 3 +Explanation: +We can take clips [0,4], [4,7], and [6,9]. +Example 4: + +Input: clips = [[0,4],[2,8]], T = 5 +Output: 2 +Explanation: +Notice you can have extra video after the event ends. + +Note: +1 <= clips.length <= 100 +0 <= clips[i][0], clips[i][1] <= 100 +0 <= T <= 100 +""" +from typing import List + + +class Solution: + def videoStitching(self, clips: List[List[int]], T: int) -> int: + """ + Greedy is correct. The larger the coverage, the better + """ + clips.sort() + prev_e = 0 + ret = 0 + + i = 0 + while i < len(clips): + if clips[i][0] > prev_e: # gap + break + + max_e = -float("inf") + while i < len(clips) and clips[i][0] <= prev_e: + max_e = max(max_e, clips[i][1]) + i += 1 + + prev_e = max_e # take + ret += 1 + if prev_e >= T: + break + + return ret if prev_e >= T else -1 + + def videoStitching_error(self, clips: List[List[int]], T: int) -> int: + """ + gready take the max coverage? + """ + A = [(s, -e, s, e) for s, e in clips] + A.sort() + ret = 1 + _, _, prev_s, prev_e = A[0] + if prev_s > 0: + return False + + for _, _, s, e in A[1:]: + if s <= prev_e and e > prev_e: + prev_e = e + ret += 1 + + +if __name__ == "__main__": + assert Solution().videoStitching([[0,4],[2,8]], 5) == 2 diff --git a/1026 Maximum Difference Between Node and Ancestor.py b/1026 Maximum Difference Between Node and Ancestor.py new file mode 100644 index 0000000..cee7616 --- /dev/null +++ b/1026 Maximum Difference Between Node and Ancestor.py @@ -0,0 +1,59 @@ +#!/usr/bin/python3 +""" +Given the root of a binary tree, find the maximum value V for which there exists +different nodes A and B where V = |A.val - B.val| and A is an ancestor of B. + +(A node A is an ancestor of B if either: any child of A is equal to B, or any +child of A is an ancestor of B.) + +Example 1: +Input: [8,3,10,1,6,null,14,null,null,4,7,13] +Output: 7 +Explanation: +We have various ancestor-node differences, some of which are given below : +|8 - 3| = 5 +|3 - 7| = 4 +|8 - 1| = 7 +|10 - 13| = 3 +Among all possible differences, the maximum value of 7 is obtained by |8 - 1| = +7. + +Note: +The number of nodes in the tree is between 2 and 5000. +Each node will have value between 0 and 100000. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.ret = 0 + + def maxAncestorDiff(self, root: TreeNode) -> int: + """ + dfs return min and max + """ + self.dfs(root) + return self.ret + + def dfs(self, node): + if not node: + return float("inf"), -float("inf") + + lmin, lmax = self.dfs(node.left) + rmin, rmax = self.dfs(node.right) + mini = min(lmin, rmin) + maxa = max(lmax, rmax) + if mini != float("inf"): + self.ret = max(self.ret, abs(mini - node.val)) + if maxa != -float("inf"): + self.ret = max(self.ret, abs(maxa - node.val)) + + return min(mini, node.val), max(maxa, node.val) diff --git a/1027 Longest Arithmetic Sequence.py b/1027 Longest Arithmetic Sequence.py new file mode 100644 index 0000000..7e784a5 --- /dev/null +++ b/1027 Longest Arithmetic Sequence.py @@ -0,0 +1,58 @@ +#!/usr/bin/python3 +""" +Given an array A of integers, return the length of the longest arithmetic +subsequence in A. + +Recall that a subsequence of A is a list A[i_1], A[i_2], ..., A[i_k] with +0 <= i_1 < i_2 < ... < i_k <= A.length - 1, and that a sequence B is arithmetic +if B[i+1] - B[i] are all the same value (for 0 <= i < B.length - 1). + +Example 1: +Input: [3,6,9,12] +Output: 4 +Explanation: +The whole array is an arithmetic sequence with steps of length = 3. + +Example 2: +Input: [9,4,7,2,10] +Output: 3 +Explanation: +The longest arithmetic subsequence is [4,7,10]. + +Example 3: +Input: [20,1,15,3,10,5,8] +Output: 4 +Explanation: +The longest arithmetic subsequence is [20,15,10,5]. + +Note: +2 <= A.length <= 2000 +0 <= A[i] <= 10000 +""" +from typing import List +from collections import defaultdict + + +class Solution: + def longestArithSeqLength(self, A: List[int]) -> int: + """ + Brute force O(n^2) + + Let F[i][j] be the longest arith subseq ending at A[i] with step j + """ + F = defaultdict(lambda: defaultdict(lambda: 1)) + for i in range(len(A)): + for j in range(i): + delta = A[i] - A[j] + F[i][delta] = F[j][delta] + 1 + + ret = 0 + for d in F.values(): + for v in d.values(): + ret = max(ret, v) + + return ret + + +if __name__ == "__main__": + assert Solution().longestArithSeqLength([20,1,15,3,10,5,8]) == 4 diff --git a/1028 Recover a Tree From Preorder Traversal.py b/1028 Recover a Tree From Preorder Traversal.py new file mode 100644 index 0000000..4fc6c13 --- /dev/null +++ b/1028 Recover a Tree From Preorder Traversal.py @@ -0,0 +1,143 @@ +#!/usr/bin/python3 +""" +We run a preorder depth first search on the root of a binary tree. + +At each node in this traversal, we output D dashes (where D is the depth of this +node), then we output the value of this node. (If the depth of a node is D, the +depth of its immediate child is D+1. The depth of the root node is 0.) + +If a node has only one child, that child is guaranteed to be the left child. + +Given the output S of this traversal, recover the tree and return its root. + + +Example 1: +Input: "1-2--3--4-5--6--7" +Output: [1,2,5,3,4,6,7] + +Example 2: +Input: "1-2--3---4-5--6---7" +Output: [1,2,5,3,null,6,null,4,null,7] + + +Example 3: +Input: "1-401--349---90--88" +Output: [1,401,null,349,88,90] + + +Note: +The number of nodes in the original tree is between 1 and 1000. +Each node will have a value between 1 and 10^9. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + +from collections import OrderedDict + + +class Solution: + def recoverFromPreorder(self, S: str) -> TreeNode: + """ + map: node -> depth + stack of pi (incompleted) + """ + depth = 0 + # parse + n = len(S) + i = 0 + root = None + stk = [] + while i < n: + if S[i] == "-": + depth += 1 + i += 1 + else: + j = i + while j < n and S[j] != "-": + j += 1 + + val = int(S[i:j]) + + # construct + cur = TreeNode(val) + if depth == 0: + root = cur + stk = [(depth, root)] + else: + assert stk + while stk[-1][0] != depth - 1: + stk.pop() + + _, pi = stk[-1] + if not pi.left: + pi.left = cur + elif not pi.right: + pi.right = cur + stk.pop() + else: + raise + stk.append((depth, cur)) + + depth = 0 + i = j + + return root + + def recoverFromPreorder_error(self, S: str) -> TreeNode: + """ + map: node -> depth + stack of pi (incompleted) + """ + depth = 0 + depths = OrderedDict() + # parse + n = len(S) + i = 0 + while i < n: + if S[i] == "-": + depth += 1 + i += 1 + else: + j = i + while j < n and S[j] != "-": + j += 1 + + val = int(S[i:j]) + depths[val] = depth + depth = 0 + i = j + + # construct + stk = [] + root = None + for k, v in depths.items(): + cur = TreeNode(k) + if v == 0: + root = cur + stk = [root] + else: + assert stk + while depths[stk[-1].val] != v - 1: + stk.pop() + + if not stk[-1].left: + stk[-1].left = cur + elif not stk[-1].right: + stk[-1].right = cur + stk.pop() + else: + raise + stk.append(cur) + + return root + + +if __name__ == "__main__": + assert Solution().recoverFromPreorder("5-4--4") + assert Solution().recoverFromPreorder("1-2--3--4-5--6--7") diff --git a/1029 Two City Scheduling.py b/1029 Two City Scheduling.py new file mode 100644 index 0000000..ac6fc76 --- /dev/null +++ b/1029 Two City Scheduling.py @@ -0,0 +1,76 @@ +#!/usr/bin/python3 +""" +There are 2N people a company is planning to interview. The cost of flying the +i-th person to city A is costs[i][0], and the cost of flying the i-th person to +city B is costs[i][1]. + +Return the minimum cost to fly every person to a city such that exactly N people +arrive in each city. + + + +Example 1: + +Input: [[10,20],[30,200],[400,50],[30,20]] +Output: 110 +Explanation: +The first person goes to city A for a cost of 10. +The second person goes to city A for a cost of 30. +The third person goes to city B for a cost of 50. +The fourth person goes to city B for a cost of 20. + +The total minimum cost is 10 + 30 + 50 + 20 = 110 to have half the people +interviewing in each city. + +Note: + +1 <= costs.length <= 100 +It is guaranteed that costs.length is even. +1 <= costs[i][0], costs[i][1] <= 1000 +""" + + +class Solution: + def twoCitySchedCost(self, costs: List[List[int]]) -> int: + """ + sort by city A and greedy? [30, 20]? + sort by total? + sort by diff - either choose A or B, the difference matters + + a - b: incremental cost of flying A instead of B + """ + A = [(a - b, a, b) for a, b in costs] + A.sort() + ret = 0 + remain = len(A) // 2 + for _, a, b in A: + if remain > 0: + ret += a + remain -= 1 + else: + ret += b + + return ret + + def twoCitySchedCost_error(self, costs: List[List[int]]) -> int: + """ + sort by city A and greedy? [30, 20]? + sort by total? + sort by diff - either choose A or B, the difference matters + + Error in the abs of difference + """ + A = [(abs(a - b), a, b) for a, b in costs] + A.sort(reverse=True) + ret = 0 + remain = len(A) // 2 + for _, a, b in A: + if a > b: + ret += b + elif remain > 0: + ret += a + remain -= 1 + else: + ret += b + + return ret diff --git a/1030 Matrix Cells in Distance Order.py b/1030 Matrix Cells in Distance Order.py new file mode 100644 index 0000000..d590078 --- /dev/null +++ b/1030 Matrix Cells in Distance Order.py @@ -0,0 +1,56 @@ +#!/usr/bin/python3 +""" +We are given a matrix with R rows and C columns has cells with integer +coordinates (r, c), where 0 <= r < R and 0 <= c < C. + +Additionally, we are given a cell in that matrix with coordinates (r0, c0). + +Return the coordinates of all cells in the matrix, sorted by their distance from +(r0, c0) from smallest distance to largest distance. Here, the distance between +two cells (r1, c1) and (r2, c2) is the Manhattan distance, |r1 - r2| + |c1 - c2|. +(You may return the answer in any order that satisfies this condition.) + +Example 1: +Input: R = 1, C = 2, r0 = 0, c0 = 0 +Output: [[0,0],[0,1]] +Explanation: The distances from (r0, c0) to other cells are: [0,1] + +Example 2: +Input: R = 2, C = 2, r0 = 0, c0 = 1 +Output: [[0,1],[0,0],[1,1],[1,0]] +Explanation: The distances from (r0, c0) to other cells are: [0,1,1,2] +The answer [[0,1],[1,1],[0,0],[1,0]] would also be accepted as correct. + +Example 3: +Input: R = 2, C = 3, r0 = 1, c0 = 2 +Output: [[1,2],[0,2],[1,1],[0,1],[1,0],[0,0]] +Explanation: The distances from (r0, c0) to other cells are: [0,1,1,2,2,3] +There are other answers that would also be accepted as correct, such as [[1,2],[1,1],[0,2],[1,0],[0,1],[0,0]]. + +Note: + +1 <= R <= 100 +1 <= C <= 100 +0 <= r0 < R +0 <= c0 < C +""" +from typing import List + + +class Solution: + def allCellsDistOrder(self, R: int, C: int, r0: int, c0: int) -> List[List[int]]: + """ + bucket sort + """ + r_max = max(r0, R-1 - r0) + c_max = max(c0, C-1 - c0) + lst = [[] for _ in range(r_max + c_max + 1)] + for i in range(R): + for j in range(C): + lst[abs(i - r0) + abs(j - c0)].append([i, j]) + + ret = [] + for e in lst: + ret.extend(e) + + return ret diff --git a/1031 Maximum Sum of Two Non-Overlapping Subarrays.py b/1031 Maximum Sum of Two Non-Overlapping Subarrays.py new file mode 100644 index 0000000..7cd976f --- /dev/null +++ b/1031 Maximum Sum of Two Non-Overlapping Subarrays.py @@ -0,0 +1,64 @@ +#!/usr/bin/python3 +""" +Given an array A of non-negative integers, return the maximum sum of elements in +two non-overlapping (contiguous) subarrays, which have lengths L and M. (For +clarification, the L-length subarray could occur before or after the M-length +subarray.) + +Formally, return the largest V for which V = (A[i] + A[i+1] + ... + A[i+L-1]) + +(A[j] + A[j+1] + ... + A[j+M-1]) and either: + +0 <= i < i + L - 1 < j < j + M - 1 < A.length, or +0 <= j < j + M - 1 < i < i + L - 1 < A.length. + + +Example 1: +Input: A = [0,6,5,2,2,5,1,9,4], L = 1, M = 2 +Output: 20 +Explanation: One choice of subarrays is [9] with length 1, and [6,5] with length +2. + +Example 2: +Input: A = [3,8,1,3,2,1,8,9,0], L = 3, M = 2 +Output: 29 +Explanation: One choice of subarrays is [3,8,1] with length 3, and [8,9] with +length 2. + +Example 3: +Input: A = [2,1,5,6,0,9,5,0,3,8], L = 4, M = 3 +Output: 31 +Explanation: One choice of subarrays is [5,6,0,9] with length 4, and [3,8] with +length 3. + +Note: +L >= 1 +M >= 1 +L + M <= A.length <= 1000 +0 <= A[i] <= 1000 +""" +from typing import List + + +class Solution: + def maxSumTwoNoOverlap(self, A: List[int], L: int, M: int) -> int: + """ + Prefix sum + Brute force O(N^2) + two pointer i, j + """ + n = len(A) + F = [0 for _ in range(n + 1)] + for i, a in enumerate(A): + F[i+1] = F[i] + a + + ret = -float("inf") + for l, m in ((L, M), (M, L)): + for i in range(n + 1 - l): + for j in range(i + l, n + 1 - m): # upper needs +1 here + cur = F[i + l] - F[i] + F[j + m] - F[j] + ret = max(ret, cur) + + return ret + + +if __name__ == "__main__": + assert Solution().maxSumTwoNoOverlap([0,6,5,2,2,5,1,9,4], 1, 2) == 20 diff --git a/1033 Moving Stones Until Consecutive.py b/1033 Moving Stones Until Consecutive.py new file mode 100644 index 0000000..76e4238 --- /dev/null +++ b/1033 Moving Stones Until Consecutive.py @@ -0,0 +1,57 @@ +#!/usr/bin/python3 +""" +There are three stones in different positions on the X-axis. You are given three integers a, b, and c, the positions of the stones. + +In one move, you pick up a stone at an endpoint (i.e., either the lowest or highest position stone), and move it to an unoccupied position between those endpoints. Formally, let's say the stones are currently at positions x, y, and z with x < y < z. You pick up the stone at either position x or position z, and move that stone to an integer position k, with x < k < z and k != y. + +The game ends when you cannot make any more moves (i.e., the stones are in three consecutive positions). + +Return an integer array answer of length 2 where: + +answer[0] is the minimum number of moves you can play, and +answer[1] is the maximum number of moves you can play. + + +Example 1: + +Input: a = 1, b = 2, c = 5 +Output: [1,2] +Explanation: Move the stone from 5 to 3, or move the stone from 5 to 4 to 3. +Example 2: + +Input: a = 4, b = 3, c = 2 +Output: [0,0] +Explanation: We cannot make any moves. +Example 3: + +Input: a = 3, b = 5, c = 1 +Output: [1,2] +Explanation: Move the stone from 1 to 4; or move the stone from 1 to 2 to 4. + + +Constraints: + +1 <= a, b, c <= 100 +a, b, and c have different values. +""" +class Solution: + def numMovesStones(self, a: int, b: int, c: int) -> List[int]: + """ + max: move 1 slot by 1 slot + min: move the entire gap. + """ + A = [a, b, c] + A.sort() + gap_l = A[1] - A[0] - 1 + gap_r = A[2] - A[1] - 1 + maxa = gap_l + gap_r + + min_gap = min(gap_l, gap_r) + if gap_l == 0 and gap_r == 0: + mini = 0 + elif min_gap == 0 or min_gap == 1: + mini = 1 + else: + mini = 2 + + return mini, maxa \ No newline at end of file diff --git a/1034 Coloring A Border.py b/1034 Coloring A Border.py new file mode 100644 index 0000000..28a399c --- /dev/null +++ b/1034 Coloring A Border.py @@ -0,0 +1,87 @@ +#!/usr/bin/python3 +""" +You are given an m x n integer matrix grid, and three integers row, col, and color. Each value in the grid represents the color of the grid square at that location. + +Two squares are called adjacent if they are next to each other in any of the 4 directions. + +Two squares belong to the same connected component if they have the same color and they are adjacent. + +The border of a connected component is all the squares in the connected component that are either adjacent to (at least) a square not in the component, or on the boundary of the grid (the first or last row or column). + +You should color the border of the connected component that contains the square grid[row][col] with color. + +Return the final grid. + + + +Example 1: + +Input: grid = [[1,1],[1,2]], row = 0, col = 0, color = 3 +Output: [[3,3],[3,2]] +Example 2: + +Input: grid = [[1,2,2],[2,3,2]], row = 0, col = 1, color = 3 +Output: [[1,3,3],[2,3,3]] +Example 3: + +Input: grid = [[1,1,1],[1,1,1],[1,1,1]], row = 1, col = 1, color = 2 +Output: [[2,2,2],[2,1,2],[2,2,2]] + + +Constraints: + +m == grid.length +n == grid[i].length +1 <= m, n <= 50 +1 <= grid[i][j], color <= 1000 +0 <= row < m +0 <= col < n +""" + + +class Solution: + def __init__(self): + self.dirs = [(0, 1), (0, -1), (1, 0), (-1, 0)] + + def colorBorder(self, grid: List[List[int]], row: int, col: int, color: int) -> List[List[int]]: + """ + In any direction, it has other color then color it + in four direction, same color, then not color + """ + origin = grid[row][col] + m = len(grid) + n = len(grid[0]) + visited = [ + [False for j in range(n)] + for i in range(m) + ] + should_color = [ + [False for j in range(n)] + for i in range(m) + ] + self.dfs(grid, row, col, visited, should_color) + + for i in range(m): + for j in range(n): + if should_color[i][j]: + grid[i][j] = color + + return grid + + def dfs(self, grid, i, j, visited, should_color): + m = len(grid) + n = len(grid[0]) + + visited[i][j] = True + cnt = 0 + for d in self.dirs: + I = i + d[0] + J = j + d[1] + if 0 <= I < m and 0 <= J < n: + if not visited[I][J] and grid[I][J] == grid[i][j]: + self.dfs(grid, I, J, visited, should_color) + + if grid[I][J] == grid[i][j]: + cnt += 1 + if cnt < 4: + should_color[i][j] = True diff --git a/1038 Binary Search Tree to Greater Sum Tree.py b/1038 Binary Search Tree to Greater Sum Tree.py new file mode 100644 index 0000000..49598cc --- /dev/null +++ b/1038 Binary Search Tree to Greater Sum Tree.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +Given the root of a Binary Search Tree (BST), convert it to a Greater Tree such that every key of the original BST is changed to the original key plus the sum of all keys greater than the original key in BST. + +As a reminder, a binary search tree is a tree that satisfies these constraints: + +The left subtree of a node contains only nodes with keys less than the node's key. +The right subtree of a node contains only nodes with keys greater than the node's key. +Both the left and right subtrees must also be binary search trees. + + +Example 1: + + +Input: root = [4,1,6,0,2,5,7,null,null,null,3,null,null,null,8] +Output: [30,36,21,36,35,26,15,null,null,null,33,null,null,null,8] +Example 2: + +Input: root = [0,null,1] +Output: [1,null,1] + + +Constraints: + +The number of nodes in the tree is in the range [1, 100]. +0 <= Node.val <= 100 +All the values in the tree are unique. +""" + + +class Solution: + def __init__(self): + self.accu = 0 + + def bstToGst(self, root: Optional[TreeNode]) -> Optional[TreeNode]: + """ + sum the right subtree + BST: to print in order (asc), in-order traversal + to sum greater keys: mirroed in-order traversal + + Build a sample sum tree to find pattern + """ + self.update_and_sum(root) + return root + + def update_and_sum(self, cur): + if cur is None: + return + + self.update_and_sum(cur.right) + cur.val += self.accu + self.accu = cur.val + self.update_and_sum(cur.left) \ No newline at end of file diff --git a/104 Maximum Depth of Binary Tree.py b/104 Maximum Depth of Binary Tree.py index 34fb57a..a19515d 100644 --- a/104 Maximum Depth of Binary Tree.py +++ b/104 Maximum Depth of Binary Tree.py @@ -4,14 +4,16 @@ The maximum depth is the number of nodes along the longest path from the root node down to the farthest leaf node. """ __author__ = 'Danyang' -# Definition for a binary tree node -class TreeNode: + + +class TreeNode(object): def __init__(self, x): self.val = x self.left = None self.right = None -class Solution: + +class Solution(object): # @param root, a tree node # @return an integer def maxDepth(self, root): @@ -25,6 +27,5 @@ def fathom(self, root, depth): """ DFS """ - if not root: - return depth - return max(self.fathom(root.left, depth+1), self.fathom(root.right, depth+1)) + if not root: return depth + else: return max(self.fathom(root.left, depth+1), self.fathom(root.right, depth+1)) diff --git a/1040 Moving Stones Until Consecutive II.py b/1040 Moving Stones Until Consecutive II.py new file mode 100644 index 0000000..8f9f7e1 --- /dev/null +++ b/1040 Moving Stones Until Consecutive II.py @@ -0,0 +1,158 @@ +#!/usr/bin/python3 +""" +There are some stones in different positions on the X-axis. You are given an integer array stones, the positions of the stones. + +Call a stone an endpoint stone if it has the smallest or largest position. In one move, you pick up an endpoint stone and move it to an unoccupied position so that it is no longer an endpoint stone. + +In particular, if the stones are at say, stones = [1,2,5], you cannot move the endpoint stone at position 5, since moving it to any position (such as 0, or 3) will still keep that stone as an endpoint stone. +The game ends when you cannot make any more moves (i.e., the stones are in three consecutive positions). + +Return an integer array answer of length 2 where: + +answer[0] is the minimum number of moves you can play, and +answer[1] is the maximum number of moves you can play. + + +Example 1: + +Input: stones = [7,4,9] +Output: [1,2] +Explanation: We can move 4 -> 8 for one move to finish the game. +Or, we can move 9 -> 5, 4 -> 6 for two moves to finish the game. +Example 2: + +Input: stones = [6,5,4,3,10] +Output: [2,3] +Explanation: We can move 3 -> 8 then 10 -> 7 to finish the game. +Or, we can move 3 -> 7, 4 -> 8, 5 -> 9 to finish the game. +Notice we cannot move 10 -> 2 to finish the game, because that would be an illegal move. + + +Constraints: + +3 <= stones.length <= 10^4 +1 <= stones[i] <= 10^9 +All the values of stones are unique. +""" +class Solution: + def numMovesStonesII(self, stones: List[int]) -> List[int]: + A = sorted(stones) + n = len(A) + # Calculate Max: + # move every endpoint stone to every hole + hi = max( + # move A[0] + A[~0] - A[1] + 1 - (n - 1), + # move A[~0] + A[~1] - A[0] + 1 - (n - 1), + ) + + # Calcualte Min: + # sliding window + lo = n + i = 0 + for j in range(n): + while i < j and A[j] - A[i] + 1 > n: + i += 1 + + total_slots = A[j] - A[i] + 1 + existing = j - i + 1 + + if total_slots == n - 1 and existing == n - 1: + # edge case: [1, 2, 3, 10] + lo = min(lo, 2) + else: + # move stones outside the window into it or adjacent to it + lo = min(lo, n - existing) + + return lo, hi + + +from collections import deque + + +class SolutionWrongTLE: + def numMovesStonesII(self, stones: List[int]) -> List[int]: + """ + calculate gap array + max = sum(gaps)? Has to move it s.t. no longer endpoint + greedy, move to max / min gap + greedy, move to elimate the max / min gap at two ends + + To get max + greedy, move the min gap, to the other end, so the other end has better chance + to become min gap + + To get min + greedy, move the max gap, to the other end, so the other end's other end has + better chance become max gap + """ + stones.sort() + gaps = [stones[i + 1] - stones[i] - 1 for i in range(len(stones) - 1)] + + # to get max, pop the min gap + d = deque(gaps) + cnt = 0 + while d: + while d and d[0] == 0: + d.popleft() + while d and d[~0] == 0: + d.pop() + + if not d: + break + if len(d) == 1: + cnt += d[0] + d[0] = 0 + elif d[0] > d[~0]: + d.pop() + cnt += 1 + d[0] -= 1 + if d[0] > 0: + d[0] -= 1 + d.appendleft(1) + else: + cnt += 1 + d.popleft() + d[~0] -= 1 + if d[~0] > 0: + d[~0] -= 1 + d.append(1) + + # to get min, pop the max gap + d = deque(gaps) + cnt2 = 0 + while d: + while d and d[0] == 0: + d.popleft() + while d and d[~0] == 0: + d.pop() + if not d: + break + if len(d) == 1: + if d[0] >= 2: + cnt2 += 2 + else: + cnt2 += 1 + d[0] = 0 + elif d[0] > d[~0]: + d.popleft() + cnt2 += 1 + d[~0] -= 1 + if d[~0] > 0: + d[~0] -= 1 + d.append(1) + else: + cnt2 += 1 + d.pop() + d[0] -= 1 + if d[0] > 0: + d[0] -= 1 + d.appendleft(1) + + return cnt2, cnt + + + + + diff --git a/1041 Robot Bounded In Circle.py b/1041 Robot Bounded In Circle.py new file mode 100644 index 0000000..7961da3 --- /dev/null +++ b/1041 Robot Bounded In Circle.py @@ -0,0 +1,72 @@ +#!/usr/bin/python3 +""" +On an infinite plane, a robot initially stands at (0, 0) and faces north. The robot can receive one of three instructions: + +"G": go straight 1 unit; +"L": turn 90 degrees to the left; +"R": turn 90 degress to the right. +The robot performs the instructions given in order, and repeats them forever. + +Return true if and only if there exists a circle in the plane such that the +robot never leaves the circle. + + + +Example 1: + +Input: "GGLLGG" +Output: true +Explanation: +The robot moves from (0,0) to (0,2), turns 180 degrees, and then returns to (0,0). +When repeating these instructions, the robot remains in the circle of radius 2 +centered at the origin. +Example 2: + +Input: "GG" +Output: false +Explanation: +The robot moves north indefinitely. +Example 3: + +Input: "GL" +Output: true +Explanation: +The robot moves from (0, 0) -> (0, 1) -> (-1, 1) -> (-1, 0) -> (0, 0) -> ... + + +Note: + +1 <= instructions.length <= 100 +instructions[i] is in {'G', 'L', 'R'} +""" + +dirs = [(-1, 0), (0, 1), (1, 0), (0, -1)] + + +class Solution: + def isRobotBounded(self, instructions: str) -> bool: + """ + LL: op + LLL: R + + L, R 90 degree + (GL) 90 needs 4 cycles to return back + 180 needs 2 cycles + 270 needs 4 cycles + + After 4 cycles, check whether the robot is at (0, 0) + """ + x, y = 0, 0 + i = 0 + for _ in range(4): + for cmd in instructions: + if cmd == "G": + dx, dy = dirs[i] + x += dx + y += dy + elif cmd == "L": + i = (i - 1) % 4 + else: + i = (i + 1) % 4 + + return x == 0 and y == 0 diff --git a/1058 Minimize Rounding Error to Meet Target.py b/1058 Minimize Rounding Error to Meet Target.py new file mode 100644 index 0000000..f735394 --- /dev/null +++ b/1058 Minimize Rounding Error to Meet Target.py @@ -0,0 +1,68 @@ +#!/usr/bin/python3 +""" +Given an array of prices [p1,p2...,pn] and a target, round each price pi to +Roundi(pi) so that the rounded array [Round1(p1),Round2(p2)...,Roundn(pn)] sums +to the given target. Each operation Roundi(pi) could be either Floor(pi) or +Ceil(pi). + +Return the string "-1" if the rounded array is impossible to sum to target. +Otherwise, return the smallest rounding error, which is defined as +Σ |Roundi(pi) - (pi)| for i from 1 to n, as a string with three places after the +decimal. + + + +Example 1: + +Input: prices = ["0.700","2.800","4.900"], target = 8 +Output: "1.000" +Explanation: +Use Floor, Ceil and Ceil operations to get (0.7 - 0) + (3 - 2.8) + (5 - 4.9) = +0.7 + 0.2 + 0.1 = 1.0 . +Example 2: + +Input: prices = ["1.500","2.500","3.500"], target = 10 +Output: "-1" +Explanation: +It is impossible to meet the target. + + +Note: + +1 <= prices.length <= 500. +Each string of prices prices[i] represents a real number which is between 0 and +1000 and has exactly 3 decimal places. +target is between 0 and 1000000. +""" +from typing import List +import math + + +class Solution: + def minimizeError(self, prices: List[str], target: int) -> str: + """ + to determine possible, floor all or ceil all + + floor all, sort by floor error inverse, make the adjustment + """ + A = list(map(float, prices)) + f_sum = sum(map(math.floor, A)) + c_sum = sum(map(math.ceil, A)) + if not f_sum <= target <= c_sum: + return "-1" + + errors = [ + e - math.floor(e) + for e in A + ] + errors.sort(reverse=True) + ret = 0 + remain = target - f_sum + for err in errors: + if remain > 0: + ret += 1 - err + remain -= 1 + else: + ret += err + + return f'{ret:.{3}f}' diff --git a/106 Construct Binary Tree from Preorder and Inorder Traversal.py b/106 Construct Binary Tree from Preorder and Inorder Traversal.py index aaa4c20..0951029 100644 --- a/106 Construct Binary Tree from Preorder and Inorder Traversal.py +++ b/106 Construct Binary Tree from Preorder and Inorder Traversal.py @@ -15,7 +15,7 @@ def __init__(self, x): class Solution: - def buildTree(self, preorder, inorder): + def buildTree_MLE(self, preorder, inorder): """ Recursive algorithm. Pre-order, in-order, post-order traversal relationship @@ -38,3 +38,24 @@ def buildTree(self, preorder, inorder): root.right = self.buildTree(preorder[root_index+1:], inorder[root_index+1:]) return root + + def buildTree(self, preorder, inorder): + """ + Same idea as the last one, just use integer instead of list + + :type preorder: List[int] + :type inorder: List[int] + :rtype: TreeNode + """ + self.preorder = preorder + self.inorder = inorder + return self._buildTree(0, len(preorder), 0, len(inorder)) + + def _buildTree(self, pre_start, pre_end, in_start, in_end): + if pre_start >= pre_end: + return None + root = TreeNode(self.preorder[pre_start]) + offset = self.inorder[in_start:in_end + 1].index(root.val) + root.left = self._buildTree(pre_start + 1, pre_start + offset + 1, in_start, in_start + offset) + root.right = self._buildTree(pre_start + offset + 1, pre_end, in_start + offset + 1, in_end) + return root diff --git a/1072 Flip Columns For Maximum Number of Equal Rows.py b/1072 Flip Columns For Maximum Number of Equal Rows.py new file mode 100644 index 0000000..620bf37 --- /dev/null +++ b/1072 Flip Columns For Maximum Number of Equal Rows.py @@ -0,0 +1,72 @@ +""" +You are given an m x n binary matrix matrix. + +You can choose any number of columns in the matrix and flip every cell in that column (i.e., Change the value of the cell from 0 to 1 or vice versa). + +Return the maximum number of rows that have all values equal after some number of flips. + + + +Example 1: + +Input: matrix = [[0,1],[1,1]] +Output: 1 +Explanation: After flipping no values, 1 row has all values equal. +Example 2: + +Input: matrix = [[0,1],[1,0]] +Output: 2 +Explanation: After flipping values in the first column, both rows have equal values. +Example 3: + +Input: matrix = [[0,0,0],[0,0,1],[1,1,0]] +Output: 2 +Explanation: After flipping values in the first two columns, the last two rows have equal values. + + +Constraints: + +m == matrix.length +n == matrix[i].length +1 <= m, n <= 300 +matrix[i][j] is either 0 or 1. +""" +from collections import defaultdict + + +class Solution: + def maxEqualRowsAfterFlips(self, mat: List[List[int]]) -> int: + """ + 01 + 11 + + 01 + 10 + + 000 + 001 + 110 + + brute force + O(2^N) * O(N^2) + + Each row's pattern is determined by grouping contiguous blocks of identical values. For instance: + Row [0, 0, 0, 1, 1, 0, 0] produces the pattern: ***|**|**| + Row [0, 1, 1, 1, 1, 1, 0] produces the pattern: *|*****|*| + + The solution is simply the frequency of the most common pattern across all rows in the matrix. + """ + M = len(mat) + N = len(mat[0]) + cnt = defaultdict(int) + mask = (1 << N) - 1 + for i in range(M): + cur = 0 + for j in range(N): + cur <<= 1 + cur += mat[i][j] + + cnt[cur] += 1 + cnt[(cur ^ mask) & mask] += 1 + + return max(cnt.values()) \ No newline at end of file diff --git a/1079 Letter Tile Possibilities.py b/1079 Letter Tile Possibilities.py new file mode 100644 index 0000000..0734880 --- /dev/null +++ b/1079 Letter Tile Possibilities.py @@ -0,0 +1,85 @@ +""" +You have n tiles, where each tile has one letter tiles[i] printed on it. + +Return the number of possible non-empty sequences of letters you can make using the letters printed on those tiles. + + + +Example 1: + +Input: tiles = "AAB" +Output: 8 +Explanation: The possible sequences are "A", "B", "AA", "AB", "BA", "AAB", "ABA", "BAA". +Example 2: + +Input: tiles = "AAABBC" +Output: 188 +Example 3: + +Input: tiles = "V" +Output: 1 + + +Constraints: + +1 <= tiles.length <= 7 +tiles consists of uppercase English letters. +""" +import math +from collections import defaultdict + + +class Solution: + def numTilePossibilities(self, tiles: str) -> int: + """ + brute force backtracking + combinatorics + """ + cnt = 0 + ret = set() + self.backtrack(tiles, 0, [], ret) + for s in ret: + if s == "": + continue + cur = math.factorial(len(s)) + counter = defaultdict(int) + for c in s: + counter[c] += 1 + for v in counter.values(): + cur //= math.factorial(v) + cnt += cur + + return cnt + + def backtrack(self, tiles, i, cur, ret): + if i == len(tiles): + ret.add("".join(sorted(cur))) + return + + self.backtrack(tiles, i+1, cur, ret) + + cur.append(tiles[i]) + self.backtrack(tiles, i+1, cur, ret) + cur.pop() + + +class SolutionBruteForce: + def numTilePossibilities(self, tiles: str) -> int: + """ + DFS + all tile are interconnected as neighbors + """ + visited = [False for _ in tiles] + ret = set() + self.dfs(tiles, visited, [], ret) + return len(ret) - 1 # exclude "" + + def dfs(self, tiles, visited, cur, ret): + ret.add("".join(cur)) + + for i, v in enumerate(tiles): + if not visited[i]: + visited[i] = True + cur.append(v) + self.dfs(tiles, visited, cur, ret) + cur.pop() + visited[i] = False \ No newline at end of file diff --git a/1080 Insufficient Nodes in Root to Leaf Paths.py b/1080 Insufficient Nodes in Root to Leaf Paths.py new file mode 100644 index 0000000..e966d1c --- /dev/null +++ b/1080 Insufficient Nodes in Root to Leaf Paths.py @@ -0,0 +1,110 @@ +""" +Given the root of a binary tree and an integer limit, delete all insufficient nodes in the tree simultaneously, and return the root of the resulting binary tree. + +A node is insufficient if every root to leaf path intersecting this node has a sum strictly less than limit. + +A leaf is a node with no children. + + + +Example 1: + + +Input: root = [1,2,3,4,-99,-99,7,8,9,-99,-99,12,13,-99,14], limit = 1 +Output: [1,2,3,4,null,null,7,8,9,null,14] +Example 2: + + +Input: root = [5,4,8,11,null,17,4,7,1,null,null,5,3], limit = 22 +Output: [5,4,8,11,null,17,4,7,null,null,null,5] +Example 3: + + +Input: root = [1,2,-3,-5,null,4,null], limit = -1 +Output: [1,null,-3,4] + + +Constraints: + +The number of nodes in the tree is in the range [1, 5000]. +-10^5 <= Node.val <= 10^5 +-10^9 <= limit <= 10^9 +""" +import sys + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + +class SolutionError: + def sufficientSubset(self, root: Optional[TreeNode], limit: int) -> Optional[TreeNode]: + """ + every path sum < limit => max(path_sums) < limit + dfs to find the max pathsum + """ + pi = TreeNode(val=0) + pi.left = root + self.dfs(pi, limit) + return pi.left + + def dfs(self, node, limit): + max_path_sum = 0 + if node.left: + left_sum = self.dfs(node.left, limit) + if left_sum < limit: + node.left = None + max_path_sum = max(max_path_sum, left_sum) + if node.right: + right_sum = self.dfs(node.right, limit) + if right_sum < limit: + node.right = None + max_path_sum = max(max_path_sum, right_sum) + + return max_path_sum + node.val + + +class Solution: + def sufficientSubset(self, root: Optional[TreeNode], limit: int) -> Optional[TreeNode]: + """ + root to path intersection this node < limit + path_sum: + 1. root to node: [root, node] + 2. node to leaf: [node, leaf] + + every path sum < limit => max path sum < limit + """ + self.limit = limit + pi = TreeNode(0) + pi.left = root + self.dfs(pi, 0) + return pi.left + + def dfs(self, node, root_sum): + """ + delete the node.left or node.right if insufficient + return the max leaf sum + """ + if not node.left and not node.right: + return node.val + + root_sum += node.val + leaf_sum = -sys.maxsize-1 + if node.left: + l = self.dfs(node.left, root_sum) + if root_sum + l < self.limit: + node.left = None + + leaf_sum = max(leaf_sum, l) + + if node.right: + r = self.dfs(node.right, root_sum) + if root_sum + r < self.limit: + node.right = None + + leaf_sum = max(leaf_sum, r) + + return leaf_sum + node.val \ No newline at end of file diff --git a/1091 Shortest Path in Binary Matrix.py b/1091 Shortest Path in Binary Matrix.py new file mode 100644 index 0000000..67ad2c2 --- /dev/null +++ b/1091 Shortest Path in Binary Matrix.py @@ -0,0 +1,71 @@ +""" +Given an n x n binary matrix grid, return the length of the shortest clear path in the matrix. If there is no clear path, return -1. + +A clear path in a binary matrix is a path from the top-left cell (i.e., (0, 0)) to the bottom-right cell (i.e., (n - 1, n - 1)) such that: + +All the visited cells of the path are 0. +All the adjacent cells of the path are 8-directionally connected (i.e., they are different and they share an edge or a corner). +The length of a clear path is the number of visited cells of this path. + + + +Example 1: + + +Input: grid = [[0,1],[1,0]] +Output: 2 +Example 2: + + +Input: grid = [[0,0,0],[1,1,0],[1,1,0]] +Output: 4 +Example 3: + +Input: grid = [[1,0,0],[1,1,0],[1,1,0]] +Output: -1 + + +Constraints: + +n == grid.length +n == grid[i].length +1 <= n <= 100 +grid[i][j] is 0 or 1 +""" +import sys + + +class Solution: + def shortestPathBinaryMatrix(self, grid: List[List[int]]) -> int: + """ + BFS + """ + if grid[0][0] != 0: + return -1 + + M = len(grid) + N = len(grid[0]) + dirs = [(0, -1), (0, 1), (-1, 0), (1, 0), (-1, -1), (-1, 1), (1, -1), (1, 1)] + q = [(0, 0)] + dist = [ + [sys.maxsize for _ in range(N)] + for _ in range(M) + ] + dist[0][0] = 1 + while q: + new_q = [] + for i, j in q: + d = dist[i][j] + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < M and 0 <= J < N and grid[I][J] == 0: + if dist[I][J] > d + 1: + dist[I][J] = d + 1 + new_q.append((I, J)) + q = new_q + + ret = dist[M-1][N-1] + if ret != sys.maxsize: + return ret + return -1 \ No newline at end of file diff --git a/110 Balanced Binary Tree.py b/110 Balanced Binary Tree.py index af1eb57..d365791 100644 --- a/110 Balanced Binary Tree.py +++ b/110 Balanced Binary Tree.py @@ -5,14 +5,49 @@ every node never differ by more than 1. """ __author__ = 'Danyang' -# Definition for a binary tree node -class TreeNode: + + +class TreeNode(object): def __init__(self, x): self.val = x self.left = None self.right = None -class Solution: + +class Solution(object): + def __init__(self): + self.depth_bottom = {} + + def isBalanced(self, root): + self.fathom(root, 0) + return self._is_balanced(root, 0) + + def _is_balanced(self, cur, depth): + """ + :param depth: depth from root to current node. + """ + if not cur: + return True + + h1 = h2 = depth + if cur.left: h1 = self.depth_bottom[cur.left] + if cur.right: h2 = self.depth_bottom[cur.right] + + if abs(h1 - h2) > 1: + return False + + return all([self._is_balanced(cur.left, depth+1), self._is_balanced(cur.right, depth+1)]) + + def fathom(self, root, depth): + if not root: + return depth-1 + + ret = max(self.fathom(root.left, depth+1), self.fathom(root.right, depth+1)) + self.depth_bottom[root] = ret + return ret + + +class SolutionSlow(object): def isBalanced(self, root): """ pre-order traversal @@ -22,7 +57,7 @@ def isBalanced(self, root): """ if not root: return True - if abs(self.fathom(root.left, 0)-self.fathom(root.right, 0))>1: + if abs(self.fathom(root.left, 0)-self.fathom(root.right, 0)) > 1: return False if self.isBalanced(root.left) and self.isBalanced(root.right): @@ -30,12 +65,10 @@ def isBalanced(self, root): else: return False - - def fathom(self, root, depth): """ DFS """ if not root: return depth-1 # test cases - return max(self.fathom(root.left, depth + 1), self.fathom(root.right, depth + 1)) + return max(self.fathom(root.left, depth+1), self.fathom(root.right, depth+1)) diff --git a/1104 Path In Zigzag Labelled Binary Tree.py b/1104 Path In Zigzag Labelled Binary Tree.py new file mode 100644 index 0000000..60066eb --- /dev/null +++ b/1104 Path In Zigzag Labelled Binary Tree.py @@ -0,0 +1,43 @@ +""" +In an infinite binary tree where every node has two children, the nodes are labelled in row order. + +In the odd numbered rows (ie., the first, third, fifth,...), the labelling is left to right, while in the even numbered rows (second, fourth, sixth,...), the labelling is right to left. + +Given the label of a node in this tree, return the labels in the path from the root of the tree to the node with that label. + +Example 1: + +Input: label = 14 +Output: [1,3,4,14] +Example 2: + +Input: label = 26 +Output: [1,2,6,10,26] + + +Constraints: + +1 <= label <= 10^6 +""" +class Solution: + def pathInZigZagTree(self, label: int) -> List[int]: + """ + Brute force, construct the tree + + If not zig zag, pi = x // 2 + If zig zag, + complement of pi = x // 2, for every level by observation + """ + stk = [label] + while stk[-1] > 1: + cur = stk[-1] >> 1 + # 2^lo <= val < 2^hi + msb = 0 + while cur >> msb > 0: + msb += 1 + delta = cur - (1 << msb - 1) + t = (1 << msb) - 1 - delta + stk.append(t) + + return stk[::-1] + \ No newline at end of file diff --git a/111 Minimum Depth of Binary Tree.py b/111 Minimum Depth of Binary Tree.py index 1739f4a..4fd023c 100644 --- a/111 Minimum Depth of Binary Tree.py +++ b/111 Minimum Depth of Binary Tree.py @@ -4,14 +4,16 @@ The minimum depth is the number of nodes along the shortest path from the root node down to the nearest leaf node. """ __author__ = 'Danyang' -# Definition for a binary tree node -class TreeNode: + + +class TreeNode(object): def __init__(self, x): self.val = x self.left = None self.right = None -class Solution: + +class Solution(object): def minDepth(self, root): """ :param root: TreeNode @@ -23,11 +25,8 @@ def fathom(self, root, depth): """ DFS """ - if not root: - return depth # whether -1 or not depends on whether depth starts from 0 or 1 - if root.left is None and root.right is not None: - return self.fathom(root.right, depth+1) - if root.right is None and root.left is not None: - return self.fathom(root.left, depth+1) - - return min(self.fathom(root.left, depth+1), self.fathom(root.right, depth+1)) \ No newline at end of file + if not root: return depth + elif root.right and not root.left: return self.fathom(root.right, depth+1) + elif root.left and not root.right: return self.fathom(root.left, depth+1) + else: return min(self.fathom(root.left, depth+1), + self.fathom(root.right, depth+1)) \ No newline at end of file diff --git a/1110 Delete Nodes And Return Forest.py b/1110 Delete Nodes And Return Forest.py new file mode 100644 index 0000000..7038087 --- /dev/null +++ b/1110 Delete Nodes And Return Forest.py @@ -0,0 +1,68 @@ +""" +Given the root of a binary tree, each node in the tree has a distinct value. + +After deleting all nodes with a value in to_delete, we are left with a forest (a disjoint union of trees). + +Return the roots of the trees in the remaining forest. You may return the result in any order. + + + +Example 1: + + +Input: root = [1,2,3,4,5,6,7], to_delete = [3,5] +Output: [[1,2,null,4],[6],[7]] +Example 2: + +Input: root = [1,2,4,null,3], to_delete = [3] +Output: [[1,2,4]] + + +Constraints: + +The number of nodes in the given tree is at most 1000. +Each node has a distinct value between 1 and 1000. +to_delete.length <= 1000 +to_delete contains distinct values between 1 and 1000. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def delNodes(self, root: Optional[TreeNode], to_delete: List[int]) -> List[TreeNode]: + """ + after deletion, children become new tree + """ + pi = TreeNode() + pi.left = root + acc = [] + self.dfs(pi, True, pi.left, set(to_delete), acc) + if pi.left: + acc.append(pi.left) + + return acc + + def dfs(self, pi, is_left, cur, to_delete, acc): + if cur.left: + self.dfs(cur, True, cur.left, to_delete, acc) + if cur.right: + self.dfs(cur, False, cur.right, to_delete, acc) + + # after dfs delete the child + if cur.val in to_delete: + if cur.left: + acc.append(cur.left) + + if cur.right: + acc.append(cur.right) + + if is_left: + pi.left = None + else: + pi.right = None + \ No newline at end of file diff --git a/1114 Print in Order.py b/1114 Print in Order.py new file mode 100644 index 0000000..e64757f --- /dev/null +++ b/1114 Print in Order.py @@ -0,0 +1,98 @@ +#!/usr/bin/python3 +""" +Suppose we have a class: + +public class Foo { + public void first() { print("first"); } + public void second() { print("second"); } + public void third() { print("third"); } +} +The same instance of Foo will be passed to three different threads. Thread A +will call first(), thread B will call second(), and thread C will call third(). +Design a mechanism and modify the program to ensure that second() is executed +after first(), and third() is executed after second(). + + + +Example 1: + +Input: [1,2,3] +Output: "firstsecondthird" +Explanation: There are three threads being fired asynchronously. The input +[1,2,3] means thread A calls first(), thread B calls second(), and thread C +calls third(). "firstsecondthird" is the correct output. +Example 2: + +Input: [1,3,2] +Output: "firstsecondthird" +Explanation: The input [1,3,2] means thread A calls first(), thread B calls +third(), and thread C calls second(). "firstsecondthird" is the correct output. +""" +from typing import Callable +from threading import Lock + + +class Foo: + def __init__(self): + """ + Two locks + """ + self.locks = [Lock(), Lock()] + self.locks[0].acquire() + self.locks[1].acquire() + + + def first(self, printFirst: Callable[[], None]) -> None: + # printFirst() outputs "first". Do not change or remove this line. + printFirst() + self.locks[0].release() + + + + def second(self, printSecond: Callable[[], None]) -> None: + with self.locks[0]: + # printSecond() outputs "second". Do not change or remove this line. + printSecond() + self.locks[1].release() + + + def third(self, printThird: Callable[[], None]) -> None: + with self.locks[1]: + # printThird() outputs "third". Do not change or remove this line. + printThird() + + +class FooError: + def __init__(self): + """ + Have a counter, and only the corresponding method can change update the + counter. + + Error, will miss an input. + """ + self._value = 1 + self._lock = Lock() + + + def first(self, printFirst: 'Callable[[], None]') -> None: + with self._lock: + if self._value == 1: + # printFirst() outputs "first". Do not change or remove this line. + self._value += 1 + printFirst() + + + def second(self, printSecond: 'Callable[[], None]') -> None: + with self._lock: + if self._value == 2: + # printSecond() outputs "second". Do not change or remove this line. + self._value += 1 + printSecond() + + + def third(self, printThird: 'Callable[[], None]') -> None: + with self._lock: + if self._value == 3: + # printThird() outputs "third". Do not change or remove this line. + self._value += 1 + printThird() diff --git a/1115 Print FooBar Alternately.py b/1115 Print FooBar Alternately.py new file mode 100644 index 0000000..50deac2 --- /dev/null +++ b/1115 Print FooBar Alternately.py @@ -0,0 +1,60 @@ +#!/usr/bin/python3 +""" +Suppose you are given the following code: + +class FooBar { + public void foo() { + for (int i = 0; i < n; i++) { + print("foo"); + } + } + + public void bar() { + for (int i = 0; i < n; i++) { + print("bar"); + } + } +} +The same instance of FooBar will be passed to two different threads. Thread A +will call foo() while thread B will call bar(). Modify the given program to +output "foobar" n times. + + + +Example 1: + +Input: n = 1 +Output: "foobar" +Explanation: There are two threads being fired asynchronously. One of them calls +foo(), while the other calls bar(). "foobar" is being output 1 time. +Example 2: + +Input: n = 2 +Output: "foobarfoobar" +Explanation: "foobar" is being output 2 times. +""" +from threading import Lock +from typing import Callable + + +class FooBar: + def __init__(self, n): + self.n = n + self.locks = [Lock(), Lock()] + self.locks[1].acquire() + + + def foo(self, printFoo: Callable[[], None]) -> None: + for i in range(self.n): + self.locks[0].acquire() + # printFoo() outputs "foo". Do not change or remove this line. + printFoo() + self.locks[1].release() + + + def bar(self, printBar: Callable[[], None]) -> None: + for i in range(self.n): + self.locks[1].acquire() + # printBar() outputs "bar". Do not change or remove this line. + printBar() + self.locks[0].release() diff --git a/1116 Print Zero Even Odd.py b/1116 Print Zero Even Odd.py new file mode 100644 index 0000000..d7caee2 --- /dev/null +++ b/1116 Print Zero Even Odd.py @@ -0,0 +1,95 @@ +#!/usr/bin/python3 +""" +uppose you are given the following code: + +class ZeroEvenOdd { + public ZeroEvenOdd(int n) { ... } // constructor + public void zero(printNumber) { ... } // only output 0's + public void even(printNumber) { ... } // only output even numbers + public void odd(printNumber) { ... } // only output odd numbers +} +The same instance of ZeroEvenOdd will be passed to three different threads: + +Thread A will call zero() which should only output 0's. +Thread B will call even() which should only ouput even numbers. +Thread C will call odd() which should only output odd numbers. +Each of the threads is given a printNumber method to output an integer. Modify +the given program to output the series 010203040506... where the length of the +series must be 2n. + + +Example 1: + +Input: n = 2 +Output: "0102" +Explanation: There are three threads being fired asynchronously. One of them +calls zero(), the other calls even(), and the last one calls odd(). "0102" is +the correct output. +Example 2: + +Input: n = 5 +Output: "0102030405" +""" +from typing import Callable +from threading import Lock + + +class ZeroEvenOdd: + def __init__(self, n): + """ + only use 3 locks, and zero() knows and commonds which lock to release, + determing whether even() or odd() will run. + """ + self.n = n + self.locks = [Lock() for _ in range(3)] + self.locks[1].acquire() + self.locks[2].acquire() + + # printNumber(x) outputs "x", where x is an integer. + def zero(self, printNumber: Callable[[int], None]) -> None: + for i in range(self.n): + self.locks[0].acquire() + printNumber(0) + if (i + 1) % 2 == 1: + self.locks[1].release() + else: + self.locks[2].release() + + def odd(self, printNumber: Callable[[int], None]) -> None: + for i in range((self.n + 1) // 2): + self.locks[1].acquire() + printNumber(i * 2 + 1) + self.locks[0].release() + + def even(self, printNumber: Callable[[int], None]) -> None: + for i in range(self.n // 2): + self.locks[2].acquire() + printNumber(i * 2 + 2) + self.locks[0].release() + + +class ZeroEvenOddError: + def __init__(self, n): + """ + Like 1115, two layer of locks can do: zero and non-zero alternating, + odd and even alternating. 4 locks required. + + Using only 3 locks? + """ + self.n = n + self.locks = [Lock(), Lock(), Lock(), Lock()] + for i in range(1, len(self.locks)): + self.locks[i].acquire() + + # printNumber(x) outputs "x", where x is an integer. + def zero(self, printNumber: 'Callable[[int], None]') -> None: + with self.locks[0]: + printNumber(0) + + def even(self, printNumber: 'Callable[[int], None]') -> None: + # cannot lock self.locks[1] from both "even" and "odd" + pass + + + def odd(self, printNumber: 'Callable[[int], None]') -> None: + pass diff --git a/1117 Building H2O.py b/1117 Building H2O.py new file mode 100644 index 0000000..a1da72e --- /dev/null +++ b/1117 Building H2O.py @@ -0,0 +1,122 @@ +#!/usr/bin/python3 +""" +There are two kinds of threads, oxygen and hydrogen. Your goal is to group these +threads to form water molecules. There is a barrier where each thread has to +wait until a complete molecule can be formed. Hydrogen and oxygen threads will +be given releaseHydrogen and releaseOxygen methods respectively, which will +allow them to pass the barrier. These threads should pass the barrier in groups +of three, and they must be able to immediately bond with each other to form a +water molecule. You must guarantee that all the threads from one molecule bond +before any other threads from the next molecule do. + +In other words: +If an oxygen thread arrives at the barrier when no hydrogen threads are +present, it has to wait for two hydrogen threads. +If a hydrogen thread arrives at the barrier when no other threads are present, +it has to wait for an oxygen thread and another hydrogen thread. +We don’t have to worry about matching the threads up explicitly; that is, the +threads do not necessarily know which other threads they are paired up with. The +key is just that threads pass the barrier in complete sets; thus, if we examine +the sequence of threads that bond and divide them into groups of three, each +group should contain one oxygen and two hydrogen threads. + +Write synchronization code for oxygen and hydrogen molecules that enforces these +constraints. + +Example 1: + +Input: "HOH" +Output: "HHO" +Explanation: "HOH" and "OHH" are also valid answers. +Example 2: + +Input: "OOHHHH" +Output: "HHOHHO" +Explanation: "HOHHHO", "OHHHHO", "HHOHOH", "HOHHOH", "OHHHOH", "HHOOHH", +"HOHOHH" and "OHHOHH" are also valid answers. + +Constraints: + +Total length of input string will be 3n, where 1 ≤ n ≤ 20. +Total number of H will be 2n in the input string. +Total number of O will be n in the input string. +""" +from typing import Callable +from threading import Semaphore + +from collections import deque + +class H2O: + def __init__(self): + self.hq = deque() + self.oq = deque() + + def hydrogen(self, releaseHydrogen: Callable[[], None]) -> None: + self.hq.append(releaseHydrogen) + self.try_output() + + def oxygen(self, releaseOxygen: Callable[[], None]) -> None: + self.oq.append(releaseOxygen) + self.try_output() + + def try_output(self): + if len(self.hq) >= 2 and len(self.oq) >= 1: + self.hq.popleft()() + self.hq.popleft()() + self.oq.popleft()() + + +class H2O_TLE2: + def __init__(self): + """ + Conditional Variable as counter? - Semaphore + """ + self.gates = [Semaphore(2), Semaphore(0)] # inititally allow 2 H, 0 O + + def hydrogen(self, releaseHydrogen: Callable[[], None]) -> None: + self.gates[0].acquire() + # releaseHydrogen() outputs "H". Do not change or remove this line. + releaseHydrogen() + if self.gates[0].acquire(blocking=False): # self.gates[0]._value > 0 + # still have available count + self.gates[0].release() + else: + self.gates[1].release() + + + def oxygen(self, releaseOxygen: Callable[[], None]) -> None: + self.gates[1].acquire() + # releaseOxygen() outputs "O". Do not change or remove this line. + releaseOxygen() + self.gates[0].release() + self.gates[0].release() + + +class H2O_TLE: + def __init__(self): + """ + Conditional Variable as counter? + Fixed at HHO pattern + """ + self.h_cnt = 0 + self.locks = [Lock() for _ in range(3)] + self.locks[1].acquire() + + + def hydrogen(self, releaseHydrogen: Callable[[], None]) -> None: + self.locks[0].acquire() + self.h_cnt += 1 + # releaseHydrogen() outputs "H". Do not change or remove this line. + releaseHydrogen() + if self.h_cnt < 2: + self.locks[0].release() + else: + self.locks[1].release() + + + def oxygen(self, releaseOxygen: Callable[[], None]) -> None: + self.locks[1].acquire() + # releaseOxygen() outputs "O". Do not change or remove this line. + releaseOxygen() + self.h_cnt = 0 + self.locks[0].release() diff --git a/1123 Lowest Common Ancestor of Deepest Leaves.py b/1123 Lowest Common Ancestor of Deepest Leaves.py new file mode 100644 index 0000000..a2d0b4f --- /dev/null +++ b/1123 Lowest Common Ancestor of Deepest Leaves.py @@ -0,0 +1,88 @@ +""" +Given the root of a binary tree, return the lowest common ancestor of its deepest leaves. + +Recall that: + +The node of a binary tree is a leaf if and only if it has no children +The depth of the root of the tree is 0. if the depth of a node is d, the depth of each of its children is d + 1. +The lowest common ancestor of a set S of nodes, is the node A with the largest depth such that every node in S is in the subtree with root A. + + +Example 1: + + +Input: root = [3,5,1,6,2,0,8,null,null,7,4] +Output: [2,7,4] +Explanation: We return the node with value 2, colored in yellow in the diagram. +The nodes coloured in blue are the deepest leaf-nodes of the tree. +Note that nodes 6, 0, and 8 are also leaf nodes, but the depth of them is 2, but the depth of nodes 7 and 4 is 3. +Example 2: + +Input: root = [1] +Output: [1] +Explanation: The root is the deepest node in the tree, and it's the lca of itself. +Example 3: + +Input: root = [0,1,3,null,2] +Output: [2] +Explanation: The deepest leaf node in the tree is 2, the lca of one node is itself. + + +Constraints: + +The number of nodes in the tree will be in the range [1, 1000]. +0 <= Node.val <= 1000 +The values of the nodes in the tree are unique. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def lcaDeepestLeaves(self, root: Optional[TreeNode]) -> Optional[TreeNode]: + """ + know the depth, then walk backward + """ + self.maxdepth = 0 + self.deepest_leaves = set() + self.depth(root, 0) + + self.ancestor = None + self.lca(root) + + return self.ancestor + + def lca(self, node): + """ + return number of node found of the targets + """ + if not node: + return 0 + + l = self.lca(node.left) + r = self.lca(node.right) + m = 1 if node in self.deepest_leaves else 0 + ret = l + r + m + if ret == len(self.deepest_leaves) and not self.ancestor: + # only keep the lowest + self.ancestor = node + return ret + + def depth(self, node, d): + if not node: + return + + if d > self.maxdepth: + self.deepest_leaves = set() + self.maxdepth = d + self.deepest_leaves.add(node) + + elif d == self.maxdepth: + self.deepest_leaves.add(node) + + self.depth(node.left, d+1) + self.depth(node.right, d+1) diff --git a/1124 Longest Well-Performing Interval.py b/1124 Longest Well-Performing Interval.py new file mode 100644 index 0000000..d70054a --- /dev/null +++ b/1124 Longest Well-Performing Interval.py @@ -0,0 +1,72 @@ +""" +We are given hours, a list of the number of hours worked per day for a given employee. + +A day is considered to be a tiring day if and only if the number of hours worked is (strictly) greater than 8. + +A well-performing interval is an interval of days for which the number of tiring days is strictly larger than the number of non-tiring days. + +Return the length of the longest well-performing interval. + + + +Example 1: + +Input: hours = [9,9,6,0,6,6,9] +Output: 3 +Explanation: The longest well-performing interval is [9,9,6]. +Example 2: + +Input: hours = [6,6,6] +Output: 0 + + +Constraints: + +1 <= hours.length <= 10^4 +0 <= hours[i] <= 16 +""" +class Solution: + def longestWPI_TLE(self, hours: List[int]) -> int: + """ + Use a stack to hold tiring day? + + Not necessarily + + use prefix sum + """ + A = [1 if hour > 8 else -1 for hour in hours] + N = len(A) + prefix = [0 for _ in range(N+1)] # A[:i] + for i in range(1, N+1): + prefix[i] = prefix[i-1] + A[i-1] + + ret = 0 + for i in range(N+1): # not from 1 + for j in range(i+1, N+1): + if prefix[j] - prefix[i] > 0: + ret = max(ret, j - i) + + return ret + + def longestWPI(self, hours: List[int]) -> int: + """ + use prefix sum + monotonic stack + """ + A = [1 if hour > 8 else -1 for hour in hours] + N = len(A) + prefix = [0 for _ in range(N+1)] # A[:i] + for i in range(1, N+1): + prefix[i] = prefix[i-1] + A[i-1] + + stk = [] # monotonic decreasing stack with increasing index + for i in range(N+1): + if not stk or prefix[stk[~0]] > prefix[i]: + stk.append(i) + + ret = 0 + for j in range(N, 0, -1): + while stk and prefix[j] - prefix[stk[~0]] > 0: + i = stk.pop() + ret = max(ret, j - i) + + return ret \ No newline at end of file diff --git a/1130 Minimum Cost Tree From Leaf Values.py b/1130 Minimum Cost Tree From Leaf Values.py new file mode 100644 index 0000000..37edefb --- /dev/null +++ b/1130 Minimum Cost Tree From Leaf Values.py @@ -0,0 +1,108 @@ +""" +Given an array arr of positive integers, consider all binary trees such that: + +Each node has either 0 or 2 children; +The values of arr correspond to the values of each leaf in an in-order traversal of the tree. +The value of each non-leaf node is equal to the product of the largest leaf value in its left and right subtree, respectively. +Among all possible binary trees considered, return the smallest possible sum of the values of each non-leaf node. It is guaranteed this sum fits into a 32-bit integer. + +A node is a leaf if and only if it has zero children. + + + +Example 1: + + +Input: arr = [6,2,4] +Output: 32 +Explanation: There are two possible trees shown. +The first has a non-leaf node sum 36, and the second has non-leaf node sum 32. +Example 2: + + +Input: arr = [4,11] +Output: 44 + + +Constraints: + +2 <= arr.length <= 40 +1 <= arr[i] <= 15 +It is guaranteed that the answer fits into a 32-bit signed integer (i.e., it is less than 2^31). +""" +import functools + + +class SolutionDP: + def mctFromLeafValues(self, A: List[int]) -> int: + """ + The value of each non-leaf node is equal to the product of the largest leaf value in its left and right subtree, respectively. + We cannot sort A + We need to combine neighbor into 1 operation + + Smallest non-leaf sum + + Brute force? + + [6, 2, 4] + + Let F_{i, j} be the smallest in A[i:j] + + Then partion F_{i, j} + F_{i, j} = F_{i, k} + F{k, j} + max(A[i:k])*max(A[k:j]) + min over k \in [i, j) + + How to build this DP? memoization + """ + return self.F(0, len(A), tuple(A)) + + @functools.lru_cache(maxsize=None) + def F(self, i, j, A): + return min( + ( + self.F(i, k, A) + self.F(k, j, A) + + max(A[i:k]) * max(A[k:j]) + for k in range(i+1, j) + ), + default=0, + ) + + +class Solution: + def mctFromLeafValues(self, A: List[int]) -> int: + """ + Max leaf is used at each inner node => put big leaf nodes close to the root. + => greedily start with the smallest leaf + + To remove any number a, it costs a * b, where b >= a. + So `a` has to be removed by a bigger neighbor `b`. + To minimize this cost, we need to minimize b. + + i = A.index(min(A)) + cost += A[i] * min(A[i-1], A[i+1]) + A.pop(i) + O(N^2) + + How to efficiently find the min index + We need to find i s.t. A[i-1] > A[i] < A[i+1] + Keep a monotonic stack for A[:i], till the monotonicity break by A[i], then we need to pop and maintain the monotonicity + """ + cost = 0 + stk = [] + for a in A: + while stk and stk[-1] <= a: + mid = stk.pop() + if stk: + left = stk[-1] + cost += mid * min(left, a) + else: + cost += mid * a + + stk.append(a) + + while len(stk) > 1: + mid = stk.pop() + left = stk[-1] + cost += mid * left + + return cost diff --git a/1139 Largest 1-Bordered Square.py b/1139 Largest 1-Bordered Square.py new file mode 100644 index 0000000..80973ae --- /dev/null +++ b/1139 Largest 1-Bordered Square.py @@ -0,0 +1,68 @@ +""" +Given a 2D grid of 0s and 1s, return the number of elements in the largest square subgrid that has all 1s on its border, or 0 if such a subgrid doesn't exist in the grid. + +Example 1: + +Input: grid = [[1,1,1],[1,0,1],[1,1,1]] +Output: 9 +Example 2: + +Input: grid = [[1,1,0,0]] +Output: 1 + + +Constraints: + +1 <= grid.length <= 100 +1 <= grid[0].length <= 100 +grid[i][j] is 0 or 1 +""" +class Solution: + def largest1BorderedSquare(self, grid: List[List[int]]) -> int: + """ + 111 + 101 + 111 + + brute force, check boarder + + Reduce from 2D to 1D? + + 111 + 011 + 111 + number of consecutive 1 ending at i, j + + then check 4 boarders + """ + M = len(grid) + N = len(grid[0]) + # row + R = [ + [0 for _ in range(N+1)] + for _ in range(M+1) + ] + # col + C = [ + [0 for _ in range(N+1)] + for _ in range(M+1) + ] + for i in range(1, M+1): + for j in range(1, N+1): + R[i][j] = R[i][j-1] + 1 if grid[i-1][j-1] == 1 else 0 + C[i][j] = C[i-1][j] + 1 if grid[i-1][j-1] == 1 else 0 + + maxa = 0 + # looking at point i, j + for i in range(M): + for j in range(N): + for l in range(1, min(M, N)+1): + left = j - l + 1 + top = i - l + 1 + if left >= 0 and top >= 0: + # print(i, j, left, top) + if min(R[i+1][j+1], R[top+1][j+1], C[i+1][j+1], C[i+1][left+1]) >= l: + maxa = max(maxa, l) + + return maxa * maxa + \ No newline at end of file diff --git a/1143 Longest Common Subsequence.py b/1143 Longest Common Subsequence.py new file mode 100644 index 0000000..d5bef10 --- /dev/null +++ b/1143 Longest Common Subsequence.py @@ -0,0 +1,51 @@ +#!/usr/bin/python3 +""" +Given two strings text1 and text2, return the length of their longest common subsequence. If there is no common subsequence, return 0. + +A subsequence of a string is a new string generated from the original string with some characters (can be none) deleted without changing the relative order of the remaining characters. + +For example, "ace" is a subsequence of "abcde". +A common subsequence of two strings is a subsequence that is common to both strings. + + + +Example 1: + +Input: text1 = "abcde", text2 = "ace" +Output: 3 +Explanation: The longest common subsequence is "ace" and its length is 3. +Example 2: + +Input: text1 = "abc", text2 = "abc" +Output: 3 +Explanation: The longest common subsequence is "abc" and its length is 3. +Example 3: + +Input: text1 = "abc", text2 = "def" +Output: 0 +Explanation: There is no such common subsequence, so the result is 0. + + +Constraints: + +1 <= text1.length, text2.length <= 1000 +text1 and text2 consist of only lowercase English characters. +""" +class Solution: + def longestCommonSubsequence(self, a: str, b: str) -> int: + """ + Let F_{i, j} be the longest common subsequence of a[:i] and b[:j] + """ + m, n = len(a), len(b) + F = [ + [0 for _ in range(n+1)] + for _ in range(m+1) + ] + for i in range(1, m+1): + for j in range(1, n+1): + if a[i-1] == b[j-1]: + F[i][j] = F[i-1][j-1] + 1 + else: + F[i][j] = max(F[i-1][j], F[i][j-1]) + + return F[m][n] diff --git a/1145 Binary Tree Coloring Game.py b/1145 Binary Tree Coloring Game.py new file mode 100644 index 0000000..ddd1f7e --- /dev/null +++ b/1145 Binary Tree Coloring Game.py @@ -0,0 +1,111 @@ +""" +Two players play a turn based game on a binary tree. We are given the root of this binary tree, and the number of nodes n in the tree. n is odd, and each node has a distinct value from 1 to n. + +Initially, the first player names a value x with 1 <= x <= n, and the second player names a value y with 1 <= y <= n and y != x. The first player colors the node with value x red, and the second player colors the node with value y blue. + +Then, the players take turns starting with the first player. In each turn, that player chooses a node of their color (red if player 1, blue if player 2) and colors an uncolored neighbor of the chosen node (either the left child, right child, or parent of the chosen node.) + +If (and only if) a player cannot choose such a node in this way, they must pass their turn. If both players pass their turn, the game ends, and the winner is the player that colored more nodes. + +You are the second player. If it is possible to choose such a y to ensure you win the game, return true. If it is not possible, return false. + + + +Example 1: + + +Input: root = [1,2,3,4,5,6,7,8,9,10,11], n = 11, x = 3 +Output: true +Explanation: The second player can choose the node with value 2. +Example 2: + +Input: root = [1,2,3], n = 3, x = 1 +Output: false + + +Constraints: + +The number of nodes in the tree is n. +1 <= x <= n <= 100 +n is odd. +1 <= Node.val <= n +All the values of the tree are unique. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class SolutionTwoPasses: + def btreeGameWinningMove(self, root: Optional[TreeNode], n: int, x: int) -> bool: + """ + taking control of the root with larger subtree + block the parent, left or right + """ + self.root_count = self.count(root) + self.ret = False + self.dfs(root, x) + return self.ret + + def count(self, cur): + if not cur: + return 0 + + s = 1 + s += self.count(cur.left) + s += self.count(cur.right) + return s + + def dfs(self, cur, x): + if not cur: + return 0 + + l = self.dfs(cur.left, x) + r = self.dfs(cur.right, x) + c = l + r + 1 + if cur.val == x: + # block left: + if l > self.root_count - l: + self.ret = True + # block right + if r > self.root_count - r: + self.ret = True + # block parent: + if self.root_count - c > c: + self.ret = True + + return c + + +class Solution: + def btreeGameWinningMove(self, root: Optional[TreeNode], n: int, x: int) -> bool: + self.x_left = 0 + self.x_right = 0 + self.x_root = 0 + root_count = self.dfs(root, x) + + if self.x_left > root_count - self.x_left: + return True + if self.x_right > root_count - self.x_right: + return True + if root_count - self.x_root > self.x_root: + return True + return False + + + def dfs(self, cur, x): + if not cur: + return 0 + + l = self.dfs(cur.left, x) + r = self.dfs(cur.right, x) + c = 1 + l + r + if cur.val == x: + self.x_left = l + self.x_right = r + self.x_root = c + + return c \ No newline at end of file diff --git a/1161 Maximum Level Sum of a Binary Tree.py b/1161 Maximum Level Sum of a Binary Tree.py new file mode 100644 index 0000000..98ecf2a --- /dev/null +++ b/1161 Maximum Level Sum of a Binary Tree.py @@ -0,0 +1,66 @@ +""" +Given the root of a binary tree, the level of its root is 1, the level of its children is 2, and so on. + +Return the smallest level x such that the sum of all the values of nodes at level x is maximal. + + + +Example 1: + + +Input: root = [1,7,0,7,-8,null,null] +Output: 2 +Explanation: +Level 1 sum = 1. +Level 2 sum = 7 + 0 = 7. +Level 3 sum = 7 + -8 = -1. +So we return the level with the maximum sum which is level 2. +Example 2: + +Input: root = [989,null,10250,98693,-89388,null,null,null,-32127] +Output: 2 + + +Constraints: + +The number of nodes in the tree is in the range [1, 10^4]. +-10^5 <= Node.val <= 10^5 +""" +import sys + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def maxLevelSum(self, root: Optional[TreeNode]) -> int: + """ + bfs + """ + level = 1 + q = [root] + maxa = -sys.maxsize-1 + maxlevel = 1 + while q: + new_q = [] + cur = 0 + for e in q: + cur += e.val + if e.left: + new_q.append(e.left) + if e.right: + new_q.append(e.right) + + if cur > maxa: + maxlevel = level + maxa = cur + + q = new_q + level += 1 + + return maxlevel diff --git a/1219 Path with Maximum Gold.py b/1219 Path with Maximum Gold.py new file mode 100644 index 0000000..ea58044 --- /dev/null +++ b/1219 Path with Maximum Gold.py @@ -0,0 +1,112 @@ +""" +In a gold mine grid of size m x n, each cell in this mine has an integer representing the amount of gold in that cell, 0 if it is empty. + +Return the maximum amount of gold you can collect under the conditions: + +Every time you are located in a cell you will collect all the gold in that cell. +From your position, you can walk one step to the left, right, up, or down. +You can't visit the same cell more than once. +Never visit a cell with 0 gold. +You can start and stop collecting gold from any position in the grid that has some gold. + + +Example 1: + +Input: grid = [[0,6,0],[5,8,7],[0,9,0]] +Output: 24 +Explanation: +[[0,6,0], + [5,8,7], + [0,9,0]] +Path to get the maximum gold, 9 -> 8 -> 7. +Example 2: + +Input: grid = [[1,0,7],[2,0,6],[3,4,5],[0,3,0],[9,0,20]] +Output: 28 +Explanation: +[[1,0,7], + [2,0,6], + [3,4,5], + [0,3,0], + [9,0,20]] +Path to get the maximum gold, 1 -> 2 -> 3 -> 4 -> 5 -> 6 -> 7. + + +Constraints: + +m == grid.length +n == grid[i].length +1 <= m, n <= 15 +0 <= grid[i][j] <= 100 +There are at most 25 cells containing gold. +""" +class Solution: + def getMaximumGold(self, grid: List[List[int]]) -> int: + """ + DFS + """ + self.grid = grid + self.M = len(grid) + self.N = len(grid[0]) + self.dirs = [(0, -1), (0, 1), (-1, 0), (1, 0)] + self.maxa = 0 + visited = [ + [False for _ in range(self.N)] + for _ in range(self.M) + ] + for i in range(self.M): + for j in range(self.N): + if grid[i][j] != 0: + self.dfs(i, j, 0, visited) + + return self.maxa + + def dfs(self, i, j, path_sum, visited): + path_sum += self.grid[i][j] + self.maxa = max(self.maxa, path_sum) + visited[i][j] = True + for di, dj in self.dirs: + I = i + di + J = j + dj + if 0 <= I < self.M and 0 <= J < self.N and self.grid[I][J] != 0 and not visited[I][J]: + self.dfs(I, J, path_sum, visited) + + visited[i][j] = False + path_sum -= self.grid[i][j] + + +class SolutionStyle: + def getMaximumGold(self, grid: List[List[int]]) -> int: + """ + DFS + """ + self.grid = grid + self.M = len(grid) + self.N = len(grid[0]) + self.dirs = [(0, -1), (0, 1), (-1, 0), (1, 0)] + self.maxa = 0 + visited = [ + [False for _ in range(self.N)] + for _ in range(self.M) + ] + for i in range(self.M): + for j in range(self.N): + self.dfs(i, j, 0, visited) + + return self.maxa + + def dfs(self, i, j, path_sum, visited): + if self.grid[i][j] == 0 or visited[i][j]: + return + + path_sum += self.grid[i][j] + self.maxa = max(self.maxa, path_sum) + visited[i][j] = True + for di, dj in self.dirs: + I = i + di + J = j + dj + if 0 <= I < self.M and 0 <= J < self.N: + self.dfs(I, J, path_sum, visited) + + visited[i][j] = False + path_sum -= self.grid[i][j] \ No newline at end of file diff --git a/122 Best Time to Buy and Sell Stock.py b/122 Best Time to Buy and Sell Stock.py index 7c842ce..7f8fe2f 100644 --- a/122 Best Time to Buy and Sell Stock.py +++ b/122 Best Time to Buy and Sell Stock.py @@ -7,8 +7,26 @@ __author__ = 'Danyang' -class Solution: - def maxProfit(self, prices): +class Solution(object): + def maxProfit(self, A): + """ + Maximum subarray sum + DP version + Let F[i] be the maximum subarray sum ending at A[i-1] + """ + if len(A) <= 1: + return 0 + + n = len(A) + F = [0 for _ in xrange(n+1)] + maxa = 0 + for i in xrange(2, n+1): + F[i] = max(F[i-1] + A[i-1] - A[i-2], 0) # revert the previous transaction + maxa = max(maxa, F[i]) + + return maxa + + def maxProfitDelta(self, prices): """ Only long position allowed, cannot short @@ -31,14 +49,11 @@ def maxProfit(self, prices): max_sub_array = 0 current_sub_array = 0 for j in xrange(len(delta_prices)): - if current_sub_array+delta_prices[j] >= 0: - current_sub_array += delta_prices[j] - else: - current_sub_array = 0 + current_sub_array = max(0, current_sub_array+delta_prices[j]) max_sub_array = max(max_sub_array, current_sub_array) return max_sub_array if __name__ == "__main__": - print Solution().maxProfit([3, 2, 1, 4, 5, 6, 2]) \ No newline at end of file + assert Solution().maxProfit([3, 2, 1, 4, 5, 6, 2]) == 5 \ No newline at end of file diff --git a/125 Valid Palindrome.py b/125 Valid Palindrome.py index f598be6..d76b13b 100644 --- a/125 Valid Palindrome.py +++ b/125 Valid Palindrome.py @@ -11,7 +11,9 @@ For the purpose of this problem, we define empty string as valid palindrome. """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): def isPalindrome(self, s): """ @@ -25,5 +27,4 @@ def isPalindrome(self, s): if not s: return True - s2 = s[::-1] - return s2==s \ No newline at end of file + return s == s[::-1] \ No newline at end of file diff --git a/1261 Find Elements in a Contaminated Binary Tree.py b/1261 Find Elements in a Contaminated Binary Tree.py new file mode 100644 index 0000000..ef879a8 --- /dev/null +++ b/1261 Find Elements in a Contaminated Binary Tree.py @@ -0,0 +1,107 @@ +""" +Given a binary tree with the following rules: + +root.val == 0 +For any treeNode: +If treeNode.val has a value x and treeNode.left != null, then treeNode.left.val == 2 * x + 1 +If treeNode.val has a value x and treeNode.right != null, then treeNode.right.val == 2 * x + 2 +Now the binary tree is contaminated, which means all treeNode.val have been changed to -1. + +Implement the FindElements class: + +FindElements(TreeNode* root) Initializes the object with a contaminated binary tree and recovers it. +bool find(int target) Returns true if the target value exists in the recovered binary tree. + + +Example 1: + + +Input +["FindElements","find","find"] +[[[-1,null,-1]],[1],[2]] +Output +[null,false,true] +Explanation +FindElements findElements = new FindElements([-1,null,-1]); +findElements.find(1); // return False +findElements.find(2); // return True +Example 2: + + +Input +["FindElements","find","find","find"] +[[[-1,-1,-1,-1,-1]],[1],[3],[5]] +Output +[null,true,true,false] +Explanation +FindElements findElements = new FindElements([-1,-1,-1,-1,-1]); +findElements.find(1); // return True +findElements.find(3); // return True +findElements.find(5); // return False +Example 3: + + +Input +["FindElements","find","find","find","find"] +[[[-1,null,-1,-1,null,-1]],[2],[3],[4],[5]] +Output +[null,true,false,false,true] +Explanation +FindElements findElements = new FindElements([-1,null,-1,-1,null,-1]); +findElements.find(2); // return True +findElements.find(3); // return False +findElements.find(4); // return False +findElements.find(5); // return True + + +Constraints: + +TreeNode.val == -1 +The height of the binary tree is less than or equal to 20 +The total number of nodes is between [1, 10^4] +Total calls of find() is between [1, 10^4] +0 <= target <= 10^6 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class FindElements: + def __init__(self, root: Optional[TreeNode]): + self.root = root + self.dfs(root, 0) + + def dfs(self, cur, val): + if not cur: + return + + cur.val = val + self.dfs(cur.left, 2*val+1) + self.dfs(cur.right, 2*val+2) + + def find(self, target: int) -> bool: + return self.s(self.root, target) + + def s(self, node, target): + if not node: + return False + if node.val == target: + return True + if node.val > target: + return False + + if self.s(node.left, target): + return True + if self.s(node.right, target): + return True + + return False + + +# Your FindElements object will be instantiated and called as such: +# obj = FindElements(root) +# param_1 = obj.find(target) \ No newline at end of file diff --git a/127 Word Ladder.py b/127 Word Ladder.py index 4e7962d..0dbaf7b 100644 --- a/127 Word Ladder.py +++ b/127 Word Ladder.py @@ -19,7 +19,40 @@ All words contain only lowercase alphabetic characters. """ __author__ = 'Danyang' + + class Solution: + def is_neighbor(self, p, q): + diff = 0 + for a, b in zip(p, q): + if a != b: + diff += 1 + if diff > 1: + return False + return True + + def ladderLength(self, start, end, dct): + """ + bfs + """ + q = [start] + visited = {start} + lvl = 1 + while q: + cur_q = [] + for a in q: + if a == end: + return lvl + for b in dct: + if b not in visited and self.is_neighbor(a, b): + visited.add(b) + cur_q.append(b) + + lvl += 1 + q = cur_q + + return 0 + def ladderLength_TLE(self, start, end, dict): """ bfs @@ -115,7 +148,7 @@ def diff_count(str1, str2): return path_len - def ladderLength(self, start, end, dict): + def ladderLength_complex(self, start, end, dict): """ bfs @@ -160,7 +193,7 @@ def ladderLength(self, start, end, dict): if __name__=="__main__": - print Solution().ladderLength("sand", "acne", set( + assert Solution().ladderLength("sand", "acne", set( ["slit", "bunk", "wars", "ping", "viva", "wynn", "wows", "irks", "gang", "pool", "mock", "fort", "heel", "send", "ship", "cols", "alec", "foal", "nabs", "gaze", "giza", "mays", "dogs", "karo", "cums", "jedi", "webb", "lend", "mire", "jose", "catt", "grow", "toss", "magi", "leis", "bead", "kara", "hoof", "than", "ires", "baas", "vein", @@ -364,4 +397,5 @@ def ladderLength(self, start, end, dict): "oral", "gets", "chid", "yens", "snub", "ages", "wide", "bail", "verb", "lamb", "bomb", "army", "yoke", "gels", "tits", "bork", "mils", "nary", "barn", "hype", "odom", "avon", "hewn", "rios", "cams", "tact", "boss", "oleo", "duke", "eris", "gwen", "elms", "deon", "sims", "quit", "nest", "font", "dues", "yeas", "zeta", "bevy", "gent", - "torn", "cups", "worm", "baum", "axon", "purr", "vise", "grew", "govs", "meat", "chef", "rest", "lame"])) \ No newline at end of file + "torn", "cups", "worm", "baum", "axon", "purr", "vise", "grew", "govs", "meat", "chef", "rest", "lame"]) + ) == 11 diff --git a/1302 Deepest Leaves Sum.py b/1302 Deepest Leaves Sum.py new file mode 100644 index 0000000..2ab897a --- /dev/null +++ b/1302 Deepest Leaves Sum.py @@ -0,0 +1,52 @@ +""" +Given the root of a binary tree, return the sum of values of its deepest leaves. + + +Example 1: + + +Input: root = [1,2,3,4,5,null,6,7,null,null,null,null,8] +Output: 15 +Example 2: + +Input: root = [6,7,8,2,7,1,3,9,null,1,4,null,null,null,5] +Output: 19 + + +Constraints: + +The number of nodes in the tree is in the range [1, 10^4]. +1 <= Node.val <= 100 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def deepestLeavesSum(self, root: Optional[TreeNode]) -> int: + """ + dfs + """ + self.ret = 0 + self.maxdepth = 0 + self.dfs(root, 0) + return self.ret + + def dfs(self, cur, d): + if not cur: + return + + if d == self.maxdepth: + self.ret += cur.val + elif d > self.maxdepth: + self.maxdepth = d + self.ret = cur.val + + self.dfs(cur.left, d+1) + self.dfs(cur.right, d+1) + + diff --git a/1305 All Elements in Two Binary Search Trees.py b/1305 All Elements in Two Binary Search Trees.py new file mode 100644 index 0000000..86f631b --- /dev/null +++ b/1305 All Elements in Two Binary Search Trees.py @@ -0,0 +1,76 @@ +""" +Given two binary search trees root1 and root2, return a list containing all the integers from both trees sorted in ascending order. + + + +Example 1: + + +Input: root1 = [2,1,4], root2 = [1,0,3] +Output: [0,1,1,2,3,4] +Example 2: + + +Input: root1 = [1,null,8], root2 = [8,1] +Output: [1,1,8,8] + + +Constraints: + +The number of nodes in each tree is in the range [0, 5000]. +-10^5 <= Node.val <= 10^5 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def getAllElements(self, root1: Optional[TreeNode], root2: Optional[TreeNode]) -> List[int]: + """ + maintain two lists and + like merge sort, morris traversal? + """ + gen1 = self.morris(root1) + gen2 = self.morris(root2) + ret = [] + a = next(gen1, None) + b = next(gen2, None) + # None is different from 0 + while a is not None or b is not None: + if a is not None and b is not None: + if a > b: + ret.append(b) + b = next(gen2, None) + else: + ret.append(a) + a = next(gen1, None) + elif a is not None: + ret.append(a) + a = next(gen1, None) + else: + ret.append(b) + b = next(gen2, None) + + return ret + + def morris(self, cur): + while cur: + if not cur.left: + yield cur.val + cur = cur.right + else: + pre = cur.left + while pre.right and pre.right != cur: + pre = pre.right + + if not pre.right: + pre.right = cur + cur = cur.left + else: + pre.right = None + yield cur.val + cur = cur.right diff --git a/131 Palindrome Partitioning.py b/131 Palindrome Partitioning.py index a869452..3d80eaa 100644 --- a/131 Palindrome Partitioning.py +++ b/131 Palindrome Partitioning.py @@ -35,8 +35,8 @@ def get_partition(self, seq, cur, result): def is_palindrome(self, s): # O(n) - # return s==reversed(s) # error, need to use ''.join(reversed(s)) - return s==s[::-1] + # return s == reversed(s) # error, need to use ''.join(reversed(s)) + return s == s[::-1] if __name__=="__main__": - assert Solution().partition("aab")==[['a', 'a', 'b'], ['aa', 'b']] \ No newline at end of file + assert Solution().partition("aab")==[['a', 'a', 'b'], ['aa', 'b']] diff --git a/1315 Sum of Nodes with Even-Valued Grandparent.py b/1315 Sum of Nodes with Even-Valued Grandparent.py new file mode 100644 index 0000000..d14e823 --- /dev/null +++ b/1315 Sum of Nodes with Even-Valued Grandparent.py @@ -0,0 +1,64 @@ +""" +Given the root of a binary tree, return the sum of values of nodes with an even-valued grandparent. If there are no nodes with an even-valued grandparent, return 0. + +A grandparent of a node is the parent of its parent if it exists. + + + +Example 1: + + +Input: root = [6,7,8,2,7,1,3,9,null,1,4,null,null,null,5] +Output: 18 +Explanation: The red nodes are the nodes with even-value grandparent while the blue nodes are the even-value grandparents. +Example 2: + + +Input: root = [1] +Output: 0 + + +Constraints: + +The number of nodes in the tree is in the range [1, 10^4]. +1 <= Node.val <= 100 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def sumEvenGrandparent(self, root: Optional[TreeNode]) -> int: + """ + 1. maintain a predecessor pointer + 2. dfs + """ + self.ret = 0 + self.dfs(root) + return self.ret + + def dfs(self, node): + if not node: + return + + if node.val % 2 == 0: + self.plus(node, 0) + + self.dfs(node.left) + self.dfs(node.right) + + def plus(self, node, d): + if not node: + return + + if d == 2: + self.ret += node.val + return + + self.plus(node.left, d+1) + self.plus(node.right, d+1) + diff --git a/132 Palindrome Partitioning II.py b/132 Palindrome Partitioning II.py index a1f7c2c..3e5c2b2 100644 --- a/132 Palindrome Partitioning II.py +++ b/132 Palindrome Partitioning II.py @@ -7,7 +7,106 @@ Return 1 since the palindrome partitioning ["aa","b"] could be produced using 1 cut. """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): + def minCut(self, s): + """ + Let P[i][j] indicates whether s[i:j] is palindrome + P[i][j] = P[i+1][j-1] && s[i] == s[j-1] + + Left C[i] represents the min cut for s[:i] + C[i] = 0 if s[:i] is palindrome + C[i] = min(C[j]+1 for j Optional[TreeNode]: + """ + dfs + """ + dummy = TreeNode() + dummy.left = root + self.dfs(dummy, True, root, target) + return dummy.left + + def dfs(self, pi, is_left, cur, target): + if not cur: + return + + # delete children first, post-order traversal + self.dfs(cur, True, cur.left, target) + self.dfs(cur, False, cur.right, target) + + if not cur.left and not cur.right and cur.val == target: + if is_left: + pi.left = None + else: + pi.right = None + + \ No newline at end of file diff --git a/1339 Maximum Product of Splitted Binary Tree.py b/1339 Maximum Product of Splitted Binary Tree.py new file mode 100644 index 0000000..c4877f3 --- /dev/null +++ b/1339 Maximum Product of Splitted Binary Tree.py @@ -0,0 +1,75 @@ +""" +Given the root of a binary tree, split the binary tree into two subtrees by removing one edge such that the product of the sums of the subtrees is maximized. + +Return the maximum product of the sums of the two subtrees. Since the answer may be too large, return it modulo 109 + 7. + +Note that you need to maximize the answer before taking the mod and not after taking it. + + + +Example 1: + + +Input: root = [1,2,3,4,5,6] +Output: 110 +Explanation: Remove the red edge and get 2 binary trees with sum 11 and 10. Their product is 110 (11*10) +Example 2: + + +Input: root = [1,null,2,3,4,null,null,5,6] +Output: 90 +Explanation: Remove the red edge and get 2 binary trees with sum 15 and 6.Their product is 90 (15*6) + + +Constraints: + +The number of nodes in the tree is in the range [2, 5 * 10^4]. +1 <= Node.val <= 10^4 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +MOD = int(1e9+7) +class Solution: + def maxProduct(self, root: Optional[TreeNode]) -> int: + """ + Brute force: remove edge O(N) * calculate sum, O(N) + + cache sum O(1) + only need to root sum, and subtree sum] + + probably only need to store root sum, not every node's sum + """ + self.s = {} + self.dfs(root) + self.maxa = 0 + self.dfs_remove(root, root) + return self.maxa % MOD + + def dfs(self, cur): + if not cur: + return 0 + + s = cur.val + s += self.dfs(cur.left) + s += self.dfs(cur.right) + self.s[cur] = s + return s + + def dfs_remove(self, cur, root): + if not cur: + return + + for child in [cur.left, cur.right]: + if child: + a = self.s[child] + b = (self.s[root] - a) + self.maxa = max(self.maxa, a * b) + + self.dfs_remove(cur.left, root) + self.dfs_remove(cur.right, root) \ No newline at end of file diff --git a/1361 Validate Binary Tree Nodes.py b/1361 Validate Binary Tree Nodes.py new file mode 100644 index 0000000..8b4b655 --- /dev/null +++ b/1361 Validate Binary Tree Nodes.py @@ -0,0 +1,82 @@ +""" +You have n binary tree nodes numbered from 0 to n - 1 where node i has two children leftChild[i] and rightChild[i], return true if and only if all the given nodes form exactly one valid binary tree. + +If node i has no left child then leftChild[i] will equal -1, similarly for the right child. + +Note that the nodes have no values and that we only use the node numbers in this problem. + + + +Example 1: + + +Input: n = 4, leftChild = [1,-1,3,-1], rightChild = [2,-1,-1,-1] +Output: true +Example 2: + + +Input: n = 4, leftChild = [1,-1,3,-1], rightChild = [2,3,-1,-1] +Output: false +Example 3: + + +Input: n = 2, leftChild = [1,0], rightChild = [-1,-1] +Output: false + + +Constraints: + +n == leftChild.length == rightChild.length +1 <= n <= 10^4 +-1 <= leftChild[i], rightChild[i] <= n - 1 +""" +from collections import defaultdict + + +class Solution: + def validateBinaryTreeNodes(self, n: int, leftChild: List[int], rightChild: List[int]) -> bool: + """ + graph visit to check repeatetion, disconnetion, single root + """ + has_parent = [False for _ in range(n)] + visited = [False for _ in range(n)] + G = defaultdict(list) + for i in range(n): + if leftChild[i] >= 0: + has_parent[leftChild[i]] = True + G[i].append(leftChild[i]) + if rightChild[i] >= 0: + has_parent[rightChild[i]] = True + G[i].append(rightChild[i]) + + root = None + for i in range(n): + if not has_parent[i]: + if root is None: + root = i + else: + return False + + if root is None: + return False + + self.ret = True + self.dfs(G, root, visited) + if not self.ret: + return False + + for i in range(n): + if not visited[i]: + return False + + return True + + + def dfs(self, G, cur, visited): + if visited[cur]: + self.ret = False + return + + visited[cur] = True + for nbr in G[cur]: + self.dfs(G, nbr, visited) \ No newline at end of file diff --git a/1367 Linked List in Binary Tree.py b/1367 Linked List in Binary Tree.py new file mode 100644 index 0000000..d054b20 --- /dev/null +++ b/1367 Linked List in Binary Tree.py @@ -0,0 +1,56 @@ +""" +Given a binary tree root and a linked list with head as the first node. + +Return True if all the elements in the linked list starting from the head correspond to some downward path connected in the binary tree otherwise return False. + +In this context downward path means a path that starts at some node and goes downwards. + + + +Example 1: + + + +Input: head = [4,2,8], root = [1,4,4,null,2,2,null,1,null,6,8,null,null,null,null,1,3] +Output: true +Explanation: Nodes in blue form a subpath in the binary Tree. +Example 2: + + + +Input: head = [1,4,2,6], root = [1,4,4,null,2,2,null,1,null,6,8,null,null,null,null,1,3] +Output: true +Example 3: + +Input: head = [1,4,2,6,8], root = [1,4,4,null,2,2,null,1,null,6,8,null,null,null,null,1,3] +Output: false +Explanation: There is no path in the binary tree that contains all the elements of the linked list from head. + + +Constraints: + +The number of nodes in the tree will be in the range [1, 2500]. +The number of nodes in the list will be in the range [1, 100]. +1 <= Node.val <= 100 for each node in the linked list and binary tree. +""" +class Solution: + def isSubPath(self, head: Optional[ListNode], root: Optional[TreeNode]) -> bool: + self.ret = False + self.dfs(head, root, False) + return self.ret + + def dfs(self, head, cur, found): + if head is None: + self.ret = True + return + + if cur is None: + return + + if cur.val == head.val: + self.dfs(head.next, cur.left, True) + self.dfs(head.next, cur.right, True) + + if not found: + self.dfs(head, cur.left, False) + self.dfs(head, cur.right, False) \ No newline at end of file diff --git a/1372 Longest ZigZag Path in a Binary Tree.py b/1372 Longest ZigZag Path in a Binary Tree.py new file mode 100644 index 0000000..f4bf58b --- /dev/null +++ b/1372 Longest ZigZag Path in a Binary Tree.py @@ -0,0 +1,105 @@ +""" +You are given the root of a binary tree. + +A ZigZag path for a binary tree is defined as follow: + +Choose any node in the binary tree and a direction (right or left). +If the current direction is right, move to the right child of the current node; otherwise, move to the left child. +Change the direction from right to left or from left to right. +Repeat the second and third steps until you can't move in the tree. +Zigzag length is defined as the number of nodes visited - 1. (A single node has a length of 0). + +Return the longest ZigZag path contained in that tree. + + + +Example 1: + + +Input: root = [1,null,1,1,1,null,null,1,1,null,1,null,null,null,1] +Output: 3 +Explanation: Longest ZigZag path in blue nodes (right -> left -> right). +Example 2: + + +Input: root = [1,1,1,null,1,null,null,1,1,null,1] +Output: 4 +Explanation: Longest ZigZag path in blue nodes (left -> right -> left -> right). +Example 3: + +Input: root = [1] +Output: 0 + + +Constraints: + +The number of nodes in the tree is in the range [1, 5 * 10^4]. +1 <= Node.val <= 100 +""" +import functools + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class SolutionN2: + def longestZigZag(self, root: Optional[TreeNode]) -> int: + """ + Brute force visit every node, choose left or right, O(N^2) + + Memoization: O(N) + """ + self.maxa = 0 + self.visit(root) + return self.maxa + + @functools.lru_cache(maxsize=None) + def dfs(self, node, is_left) -> int: + if not node: + return 0 + + if is_left: + l = self.dfs(node.right, False) + else: + l = self.dfs(node.left, True) + + ret = l + 1 + self.maxa = max(self.maxa, ret-1) + return ret + + def visit(self, node): + if not node: + return + + self.dfs(node, True) + self.dfs(node, False) + self.visit(node.left) + self.visit(node.right) + + +class Solution: + def longestZigZag(self, root: Optional[TreeNode]) -> int: + self.maxa = 0 + self.dfs(root, True, 0) + self.dfs(root, False, 0) # redundant + return self.maxa - 1 + + def dfs(self, node, is_left, l): + if not node: + return + + l += 1 + self.maxa = max(self.maxa, l) + + if is_left: + self.dfs(node.right, False, l) + # restart from node + self.dfs(node.left, True, 1) + else: + self.dfs(node.left, True, l) + # restart from node + self.dfs(node.right, False, 1) \ No newline at end of file diff --git a/1376 Time Needed to Inform All Employees.py b/1376 Time Needed to Inform All Employees.py new file mode 100644 index 0000000..fd9bb8f --- /dev/null +++ b/1376 Time Needed to Inform All Employees.py @@ -0,0 +1,61 @@ +""" +A company has n employees with a unique ID for each employee from 0 to n - 1. The head of the company is the one with headID. + +Each employee has one direct manager given in the manager array where manager[i] is the direct manager of the i-th employee, manager[headID] = -1. Also, it is guaranteed that the subordination relationships have a tree structure. + +The head of the company wants to inform all the company employees of an urgent piece of news. He will inform his direct subordinates, and they will inform their subordinates, and so on until all employees know about the urgent news. + +The i-th employee needs informTime[i] minutes to inform all of his direct subordinates (i.e., After informTime[i] minutes, all his direct subordinates can start spreading the news). + +Return the number of minutes needed to inform all the employees about the urgent news. + + + +Example 1: + +Input: n = 1, headID = 0, manager = [-1], informTime = [0] +Output: 0 +Explanation: The head of the company is the only employee in the company. +Example 2: + + +Input: n = 6, headID = 2, manager = [2,2,-1,2,2,2], informTime = [0,0,1,0,0,0] +Output: 1 +Explanation: The head of the company with id = 2 is the direct manager of all the employees in the company and needs 1 minute to inform them all. +The tree structure of the employees in the company is shown. + + +Constraints: + +1 <= n <= 10^5 +0 <= headID < n +manager.length == n +0 <= manager[i] < n +manager[headID] == -1 +informTime.length == n d +0 <= informTime[i] <= d +informTime[i] == 0 if employee i has no subordinates. +It is guaranteed that all the employees can be informed. +""" +from collections import defaultdict + + +class Solution: + def numOfMinutes(self, n: int, headID: int, manager: List[int], informTime: List[int]) -> int: + """ + it is a graph problem + """ + G = defaultdict(list) + time = defaultdict(int) + + for i, pi in enumerate(manager): + G[pi].append(i) + + self.dfs(G, time, headID, informTime) + return max(time.values()) + + def dfs(self, G, time, cur, inform_time): + t = time[cur] + inform_time[cur] + for nbr in G[cur]: + time[nbr] = t + self.dfs(G, time, nbr, inform_time) diff --git a/1382 Balance a Binary Search Tree.py b/1382 Balance a Binary Search Tree.py new file mode 100644 index 0000000..ae31878 --- /dev/null +++ b/1382 Balance a Binary Search Tree.py @@ -0,0 +1,61 @@ +""" +Given the root of a binary search tree, return a balanced binary search tree with the same node values. If there is more than one answer, return any of them. + +A binary search tree is balanced if the depth of the two subtrees of every node never differs by more than 1. + + + +Example 1: + + +Input: root = [1,null,2,null,3,null,4,null,null] +Output: [2,1,3,null,null,null,4] +Explanation: This is not the only correct answer, [3,1,4,null,2] is also correct. +Example 2: + + +Input: root = [2,1,3] +Output: [2,1,3] + + +Constraints: + +The number of nodes in the tree is in the range [1, 10^4]. +1 <= Node.val <= 10^5 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def balanceBST(self, root: Optional[TreeNode]) -> Optional[TreeNode]: + """ + To find the root: middle point of the array + To construct balance binary search tree: recurisively + """ + self.A = [] + self.to_array(root) + return self.balance(self.A, 0, len(self.A)) + + def to_array(self, node): + if not node: + return + + self.to_array(node.left) + self.A.append(node.val) + self.to_array(node.right) + + def balance(self, A, lo, hi): + # [lo, hi) + if lo >= hi: + return None + + mid = (lo + hi) // 2 + left = self.balance(A, lo, mid) + right = self.balance(A, mid+1, hi) + node = TreeNode(A[mid], left, right) + return node \ No newline at end of file diff --git a/140 Word Break II.py b/140 Word Break II.py index 1532550..e57f588 100644 --- a/140 Word Break II.py +++ b/140 Word Break II.py @@ -11,6 +11,9 @@ A solution is ["cats and dog", "cat sand dog"]. """ __author__ = 'Danyang' +from collections import deque + + class Solution: def wordBreak(self, s, dict): """ @@ -37,39 +40,44 @@ def wordBreak(self, s, dict): :return: a list of strings """ # dp = [[]] * (len(s) + 1) # namespace reuse - dp = [[] for _ in range(len(s)+1)] + dp = [[] for _ in range(len(s) + 1)] dp[0].append("dummy") for i in range(len(s)): if not dp[i]: continue + for word in dict: - if s[i: i+len(word)]==word: - dp[i+len(word)].append(word) + if s[i:i + len(word)] == word: + dp[i + len(word)].append(word) # build result if not dp[-1]: return [] result = [] - cur_sentence = [] - self.__build_result(dp, len(s), cur_sentence, result) + self.build_result(dp, len(s), deque(), result) return result - def __build_result(self, dp, cur_index, cur_sentence, result): + def build_result(self, dp, cur_index, cur_sentence, result): """ dfs recursive + + from right to left """ # reached, build the result from cur_sentence - if cur_index==0: - result.append(" ".join(cur_sentence[::-1])) + if cur_index == 0: + result.append(" ".join(cur_sentence)) return # dfs for prefix in dp[cur_index]: - self.__build_result(dp, cur_index-len(prefix), cur_sentence+[prefix], result) + cur_sentence.appendleft(prefix) + self.build_result(dp, cur_index - len(prefix), cur_sentence, result) + cur_sentence.popleft() + if __name__=="__main__": - assert Solution().wordBreak("catsanddog", ["cat", "cats", "and", "sand", "dog"])==['cat sand dog', 'cats and dog'] \ No newline at end of file + assert Solution().wordBreak("catsanddog", ["cat", "cats", "and", "sand", "dog"])==['cat sand dog', 'cats and dog'] diff --git a/1438 Longest Continuous Subarray With Absolute Diff Less Than or Equal to Limit.py b/1438 Longest Continuous Subarray With Absolute Diff Less Than or Equal to Limit.py new file mode 100644 index 0000000..1da5c38 --- /dev/null +++ b/1438 Longest Continuous Subarray With Absolute Diff Less Than or Equal to Limit.py @@ -0,0 +1,75 @@ +""" +Given an array of integers nums and an integer limit, return the size of the longest non-empty subarray such that the absolute difference between any two elements of this subarray is less than or equal to limit. + +Example 1: + +Input: nums = [8,2,4,7], limit = 4 +Output: 2 +Explanation: All subarrays are: +[8] with maximum absolute diff |8-8| = 0 <= 4. +[8,2] with maximum absolute diff |8-2| = 6 > 4. +[8,2,4] with maximum absolute diff |8-2| = 6 > 4. +[8,2,4,7] with maximum absolute diff |8-2| = 6 > 4. +[2] with maximum absolute diff |2-2| = 0 <= 4. +[2,4] with maximum absolute diff |2-4| = 2 <= 4. +[2,4,7] with maximum absolute diff |2-7| = 5 > 4. +[4] with maximum absolute diff |4-4| = 0 <= 4. +[4,7] with maximum absolute diff |4-7| = 3 <= 4. +[7] with maximum absolute diff |7-7| = 0 <= 4. +Therefore, the size of the longest subarray is 2. +Example 2: + +Input: nums = [10,1,2,4,7,2], limit = 5 +Output: 4 +Explanation: The subarray [2,4,7,2] is the longest since the maximum absolute diff is |2-7| = 5 <= 5. +Example 3: + +Input: nums = [4,2,2,2,4,4,2,2], limit = 0 +Output: 3 + + +Constraints: + +1 <= nums.length <= 10^5 +1 <= nums[i] <= 10^9 +0 <= limit <= 10^9 +""" +from collections import deque + + +class Solution: + def longestSubarray(self, A: List[int], limit: int) -> int: + """ + Keep track the max in a sliding window -> use a monotonic queue + * when iterating j, q represent the max indicies in the window ending at j + + monotonic queue + """ + q_max = deque() # q_max[0] represent the current max, monotonically decreasing + q_min = deque() # q_min[0] represent the current min, monotonically increasing + i = 0 # left + j = 0 # right + ret = 0 + + while j < len(A): + # process A[j] + while q_max and A[q_max[~0]] <= A[j]: + q_max.pop() + q_max.append(j) + while q_min and A[q_min[~0]] >= A[j]: + q_min.pop() + q_min.append(j) + + while q_max and q_min and A[q_max[0]] - A[q_min[0]] > limit: + # q need to store indices + # move to the smaller index + if q_max[0] < q_min[0]: + i = q_max.popleft() + 1 + else: + i = q_min.popleft() + 1 + + l = j - i + 1 + ret = max(ret, l) + j += 1 + + return ret \ No newline at end of file diff --git a/144 Binary Tree Preorder Traversal.py b/144 Binary Tree Preorder Traversal.py index e4c345d..792f991 100644 --- a/144 Binary Tree Preorder Traversal.py +++ b/144 Binary Tree Preorder Traversal.py @@ -13,15 +13,41 @@ Note: Recursive solution is trivial, could you do it iteratively? - see preTraverse_itr """ __author__ = 'Danyang' + + # Definition for a binary tree node -class TreeNode: +class TreeNode(object): def __init__(self, x): self.val = x self.left = None self.right = None -class Solution: + +class Solution(object): def preorderTraversal(self, root): + """Morris""" + ret = [] + cur = root + while cur: + if not cur.left: + ret.append(cur.val) + cur = cur.right + else: + pre = cur.left + while pre.right and pre.right != cur: + pre = pre.right + + if not pre.right: + pre.right = cur + ret.append(cur.val) + cur = cur.left + else: + pre.right = None + cur = cur.right + + return ret + + def preorderTraversal_memory(self, root): """ dfs :param root: diff --git a/1443 Minimum Time to Collect All Apples in a Tree.py b/1443 Minimum Time to Collect All Apples in a Tree.py new file mode 100644 index 0000000..3955456 --- /dev/null +++ b/1443 Minimum Time to Collect All Apples in a Tree.py @@ -0,0 +1,77 @@ +""" +Given an undirected tree consisting of n vertices numbered from 0 to n-1, which has some apples in their vertices. You spend 1 second to walk over one edge of the tree. Return the minimum time in seconds you have to spend to collect all apples in the tree, starting at vertex 0 and coming back to this vertex. + +The edges of the undirected tree are given in the array edges, where edges[i] = [ai, bi] means that exists an edge connecting the vertices ai and bi. Additionally, there is a boolean array hasApple, where hasApple[i] = true means that vertex i has an apple; otherwise, it does not have any apple. + + + +Example 1: + + +Input: n = 7, edges = [[0,1],[0,2],[1,4],[1,5],[2,3],[2,6]], hasApple = [false,false,true,false,true,true,false] +Output: 8 +Explanation: The figure above represents the given tree where red vertices have an apple. One optimal path to collect all apples is shown by the green arrows. +Example 2: + + +Input: n = 7, edges = [[0,1],[0,2],[1,4],[1,5],[2,3],[2,6]], hasApple = [false,false,true,false,false,true,false] +Output: 6 +Explanation: The figure above represents the given tree where red vertices have an apple. One optimal path to collect all apples is shown by the green arrows. +Example 3: + +Input: n = 7, edges = [[0,1],[0,2],[1,4],[1,5],[2,3],[2,6]], hasApple = [false,false,false,false,false,false,false] +Output: 0 + + +Constraints: + +1 <= n <= 10^5 +edges.length == n - 1 +edges[i].length == 2 +0 <= ai < bi <= n - 1 +hasApple.length == n +""" +from collections import defaultdict + + +class Solution: + def minTime(self, n: int, edges: List[List[int]], hasApple: List[bool]) -> int: + """ + first DFS, construct a map of has_apple in the subtree + second DFS, count time + """ + G = defaultdict(list) + for u, v in edges: + G[u].append(v) + G[v].append(u) + + self.has_apple = hasApple + self.contain = defaultdict(bool) + self.contain_apple(G, 0, defaultdict(bool)) + + self.ret = 0 + if 0 in self.contain: + self.dfs(G, 0, defaultdict(bool)) + + return max(0, self.ret - 2) + + def contain_apple(self, G, node, visited): + visited[node] = True + contain_apple = self.has_apple[node] + for nbr in G[node]: + if not visited[nbr]: + contain_apple |= self.contain_apple(G, nbr, visited) + + if contain_apple: + self.contain[node] = True + + return contain_apple + + def dfs(self, G, node, visited): + visited[node] = True + self.ret += 1 + for nbr in G[node]: + if not visited[nbr] and self.contain[nbr]: + self.dfs(G, nbr, visited) + + self.ret += 1 \ No newline at end of file diff --git a/1448 Count Good Nodes in Binary Tree.py b/1448 Count Good Nodes in Binary Tree.py new file mode 100644 index 0000000..5cd3069 --- /dev/null +++ b/1448 Count Good Nodes in Binary Tree.py @@ -0,0 +1,70 @@ +""" +Given a binary tree root, a node X in the tree is named good if in the path from root to X there are no nodes with a value greater than X. + +Return the number of good nodes in the binary tree. + + + +Example 1: + + + +Input: root = [3,1,4,3,null,1,5] +Output: 4 +Explanation: Nodes in blue are good. +Root Node (3) is always a good node. +Node 4 -> (3,4) is the maximum value in the path starting from the root. +Node 5 -> (3,4,5) is the maximum value in the path +Node 3 -> (3,1,3) is the maximum value in the path. +Example 2: + + + +Input: root = [3,3,null,4,2] +Output: 3 +Explanation: Node 2 -> (3, 3, 2) is not good, because "3" is higher than it. +Example 3: + +Input: root = [1] +Output: 1 +Explanation: Root is considered as good. + + +Constraints: + +The number of nodes in the binary tree is in the range [1, 10^5]. +Each node's value is between [-10^4, 10^4]. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def goodNodes(self, root: TreeNode) -> int: + """ + dfs, maintain a path + check the max(path) against the node + monotonic stack to efficienet find max(path)? + mono asc stack O(1) + """ + self.ret = 0 + self.dfs(root, []) + return self.ret + + def dfs(self, node, stk): + if not node: + return + + if not stk or stk[~0] <= node.val: + stk.append(node.val) + self.ret += 1 + + self.dfs(node.left, stk) + self.dfs(node.right, stk) + + if stk and stk[~0] == node.val: + stk.pop() diff --git a/1457 Pseudo-Palindromic Paths in a Binary Tree.py b/1457 Pseudo-Palindromic Paths in a Binary Tree.py new file mode 100644 index 0000000..fa50e03 --- /dev/null +++ b/1457 Pseudo-Palindromic Paths in a Binary Tree.py @@ -0,0 +1,117 @@ +""" +Given a binary tree where node values are digits from 1 to 9. A path in the binary tree is said to be pseudo-palindromic if at least one permutation of the node values in the path is a palindrome. + +Return the number of pseudo-palindromic paths going from the root node to leaf nodes. + + + +Example 1: + + + +Input: root = [2,3,1,3,1,null,1] +Output: 2 +Explanation: The figure above represents the given binary tree. There are three paths going from the root node to leaf nodes: the red path [2,3,3], the green path [2,1,1], and the path [2,3,1]. Among these paths only red path and green path are pseudo-palindromic paths since the red path [2,3,3] can be rearranged in [3,2,3] (palindrome) and the green path [2,1,1] can be rearranged in [1,2,1] (palindrome). +Example 2: + + + +Input: root = [2,1,1,1,3,null,null,null,null,null,1] +Output: 1 +Explanation: The figure above represents the given binary tree. There are three paths going from the root node to leaf nodes: the green path [2,1,1], the path [2,1,3,1], and the path [2,1]. Among these paths only the green path is pseudo-palindromic since [2,1,1] can be rearranged in [1,2,1] (palindrome). +Example 3: + +Input: root = [9] +Output: 1 + + +Constraints: + +The number of nodes in the tree is in the range [1, 10^5]. +1 <= Node.val <= 9 +""" +from collections import defaultdict + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class SolutionTLE: + def pseudoPalindromicPaths (self, root: Optional[TreeNode]) -> int: + """ + DFS + travel to leave + maintain a counter to check for palindrom + """ + self.ret = 0 + self.dfs(root, []) + return self.ret + + def dfs(self, node, stk): + if not node: + return + + stk.append(node.val) + if not node.left and not node.right: + if self.is_palindrom(stk): + self.ret += 1 + + self.dfs(node.left, stk) + self.dfs(node.right, stk) + stk.pop() + + def is_palindrom(self, stk): + counter = defaultdict(int) + for e in stk: + counter[e] += 1 + + has_odd = False + for cnt in counter.values(): + if cnt % 2 == 1: + if has_odd: + return False + else: + has_odd = True + + return True + + +class Solution: + def pseudoPalindromicPaths (self, root: Optional[TreeNode]) -> int: + """ + DFS + travel to leave + maintain a counter to check for palindrom + """ + self.ret = 0 + self.dfs(root, defaultdict(int)) + return self.ret + + def dfs(self, node, counter): + if not node: + return + + counter[node.val] += 1 + if not node.left and not node.right: + if self.is_palindrom(counter): + self.ret += 1 + + self.dfs(node.left, counter) + self.dfs(node.right, counter) + counter[node.val] -= 1 + + def is_palindrom(self, counter): + has_odd = False + for cnt in counter.values(): + if cnt % 2 == 1: + if has_odd: + return False + else: + has_odd = True + + return True \ No newline at end of file diff --git a/146 LRU Cache py3.py b/146 LRU Cache py3.py new file mode 100644 index 0000000..3ef268e --- /dev/null +++ b/146 LRU Cache py3.py @@ -0,0 +1,95 @@ +#!/usr/bin/python3 +""" +Design and implement a data structure for Least Recently Used (LRU) cache. It +should support the following operations: get and put. + +get(key) - Get the value (will always be positive) of the key if the key exists +in the cache, otherwise return -1. +put(key, value) - Set or insert the value if the key is not already present. +When the cache reached its capacity, it should invalidate the least recently +used item before inserting a new item. + +Follow up: +Could you do both operations in O(1) time complexity? + +Example: + +LRUCache cache = new LRUCache( 2 /* capacity */ ); + +cache.put(1, 1); +cache.put(2, 2); +cache.get(1); // returns 1 +cache.put(3, 3); // evicts key 2 +cache.get(2); // returns -1 (not found) +cache.put(4, 4); // evicts key 1 +cache.get(1); // returns -1 (not found) +cache.get(3); // returns 3 +cache.get(4); // returns 4 +""" + + +class Node: + def __init__(self, key, val): + self.key = key + self.val = val + self.prev, self.next = None, None + + +class LRUCache: + + def __init__(self, capacity: int): + """ + O(1) look up - Map + O(1) update most recent vs. least recent - Linked List + But Single linked list is not enough then Double Linked List + + Need dummy head and tail to avoid over complication of null checking + + Essentially it is the OrderedDict + """ + self.head = Node(None, None) + self.tail = Node(None, None) + self.head.next = self.tail + self.tail.prev = self.head + self.cap = capacity + self.map = {} + + def get(self, key: int) -> int: + if key in self.map: + node = self.map[key] + self._remove(key) + self._appendleft(node) + return node.val + + return -1 + + def put(self, key: int, value: int) -> None: + if key in self.map: + self._remove(key) + elif len(self.map) >= self.cap: + node = self.tail.prev + self._remove(node.key) + + node = Node(key, value) + self._appendleft(node) + + def _appendleft(self, node: Node): + self.map[node.key] = node # update/delete map in these two operators + nxt = self.head.next + self.head.next = node + node.prev = self.head + node.next = nxt + nxt.prev = node + + def _remove(self, key: int): + node = self.map[key] + prev = node.prev + nxt = node.next + prev.next = nxt + nxt.prev = prev + del self.map[key] # update/delete map in these two operators + +# Your LRUCache object will be instantiated and called as such: +# obj = LRUCache(capacity) +# param_1 = obj.get(key) +# obj.put(key,value) diff --git a/146 LRU Cache.py b/146 LRU Cache.py index 519e515..62ed86e 100644 --- a/146 LRU Cache.py +++ b/146 LRU Cache.py @@ -7,7 +7,83 @@ should invalidate the least recently used item before inserting a new item. """ __author__ = 'Danyang' -class LRUCache: + + +class Node(object): + def __init__(self, key, val): + self.key = key + self.val = val + self.pre, self.next = None, None + + +class LRUCache(object): + def __init__(self, capacity): + self.cap = capacity + self.map = {} # key to node + self.head = None + self.tail = None + + def get(self, key): + if key in self.map: + cur = self.map[key] + self._elevate(cur) + return cur.val + + return -1 + + def set(self, key, value): + if key in self.map: + cur = self.map[key] + cur.val = value + self._elevate(cur) + else: + cur = Node(key, value) + self.map[key] = cur + self._appendleft(cur) + + if len(self.map) > self.cap: + last = self._pop() + del self.map[last.key] + + # doubly linked-list operations only + def _appendleft(self, cur): + """Normal or initially empty""" + if not self.head and not self.tail: + self.head = cur + self.tail = cur + return + + head = self.head + cur.next, cur.pre, head.pre = head, None, cur + self.head = cur + + def _pop(self): + """Normal or resulting empty""" + last = self.tail + if self.head == self.tail: + self.head, self.tail = None, None + return last + + pre = last.pre + pre.next = None + self.tail = pre + return last + + def _elevate(self, cur): + """Head, Tail, Middle""" + pre, nxt = cur.pre, cur.next + if not pre: + return + elif not nxt: + assert self.tail == cur + self._pop() + else: + pre.next, nxt.pre = nxt, pre + + self._appendleft(cur) + + +class LRUCache_TLE(object): def __init__(self, capacity): self.capacity = capacity self.q = [] # order by key @@ -34,7 +110,7 @@ def set(self, key, value): self.q.remove(key) self.q.insert(0, key) else: - if len(self.q)+1<=self.capacity: + if len(self.q)+1 <= self.capacity: self.q.insert(0, key) else: self.dic.pop(self.q.pop()) diff --git a/1475 Final Prices With a Special Discount in a Shop.py b/1475 Final Prices With a Special Discount in a Shop.py new file mode 100644 index 0000000..a10a835 --- /dev/null +++ b/1475 Final Prices With a Special Discount in a Shop.py @@ -0,0 +1,80 @@ +""" +You are given an integer array prices where prices[i] is the price of the ith item in a shop. + +There is a special discount for items in the shop. If you buy the ith item, then you will receive a discount equivalent to prices[j] where j is the minimum index such that j > i and prices[j] <= prices[i]. Otherwise, you will not receive any discount at all. + +Return an integer array answer where answer[i] is the final price you will pay for the ith item of the shop, considering the special discount. + + + +Example 1: + +Input: prices = [8,4,6,2,3] +Output: [4,2,4,2,3] +Explanation: +For item 0 with price[0]=8 you will receive a discount equivalent to prices[1]=4, therefore, the final price you will pay is 8 - 4 = 4. +For item 1 with price[1]=4 you will receive a discount equivalent to prices[3]=2, therefore, the final price you will pay is 4 - 2 = 2. +For item 2 with price[2]=6 you will receive a discount equivalent to prices[3]=2, therefore, the final price you will pay is 6 - 2 = 4. +For items 3 and 4 you will not receive any discount at all. +Example 2: + +Input: prices = [1,2,3,4,5] +Output: [1,2,3,4,5] +Explanation: In this case, for all items, you will not receive any discount at all. +Example 3: + +Input: prices = [10,1,1,6] +Output: [9,0,1,6] + + +Constraints: + +1 <= prices.length <= 500 +1 <= prices[i] <= 1000 +""" +class Solution: + def finalPrices_error(self, A: List[int]) -> List[int]: + """ + Brute force O(N^2) + + Maintain a stack from the right, keep the earliest minmum value at the top of the stk + Stk is monotonic decreasing + """ + R = [] + N = len(A) + stk = [] + for i in range(N-1, -1, -1): + if not stk or A[stk[-1]] > A[i]: + stk.append(i) + + for i in range(N): + while stk and stk[-1] <= i: + stk.pop() + price = A[i] + if stk and A[stk[-1]] < A[i]: + price -= A[stk[-1]] + R.append(price) + + return R + + def finalPrices(self, A: List[int]) -> List[int]: + """ + Brute force O(N^2) + + Find the next closest smaller element + -> Find the previous closest larger element + """ + N = len(A) + R = [0 for _ in range(N)] + stk = [] # store the previous, monotonic increasing + for i in range(N): + while stk and A[stk[-1]] >= A[i]: + prev = stk.pop() + R[prev] = A[prev] - A[i] + stk.append(i) + + for i in stk: + R[i] = A[i] + + return R + diff --git a/150 Evaluate Reverse Polish Notation.py b/150 Evaluate Reverse Polish Notation.py index 4213e02..8f4f78c 100644 --- a/150 Evaluate Reverse Polish Notation.py +++ b/150 Evaluate Reverse Polish Notation.py @@ -1,5 +1,7 @@ __author__ = 'Danyang' -class Solution: + + +class Solution(object): def evalRPN(self, tokens): """ stack @@ -9,22 +11,23 @@ def evalRPN(self, tokens): :return: """ ops = ["+", "-", "*", "/"] + def arith(a, b, op): - if (op=="+"): - return a + b - if (op=="-"): - return a - b - if (op=="/"): + if (op == "+"): + return a+b + if (op == "-"): + return a-b + if (op == "/"): # return a/b # python treat differently for division 6/-132 is -1 - return int(float(a) / b) # round towards 0 - if (op=="*"): - return a * b + return int(float(a)/b) # round towards 0 + if (op == "*"): + return a*b # function is first-order class # not supported by leetcode # import operator # ops = { - # "+": operator.add, + # "+": operator.add, # "-": operator.sub, # "*": operator.mul, # "/": operator.div, @@ -46,5 +49,5 @@ def arith(a, b, op): return stack.pop() -if __name__=="__main__": - Solution().evalRPN(["10", "6", "9", "3", "+", "-11", "*", "/", "*", "17", "+", "5", "+"]) \ No newline at end of file +if __name__ == "__main__": + assert Solution().evalRPN(["10", "6", "9", "3", "+", "-11", "*", "/", "*", "17", "+", "5", "+"]) == 22 \ No newline at end of file diff --git a/1504 Count Submatrices With All Ones.py b/1504 Count Submatrices With All Ones.py new file mode 100644 index 0000000..60b5c9c --- /dev/null +++ b/1504 Count Submatrices With All Ones.py @@ -0,0 +1,72 @@ +""" +Given an m x n binary matrix mat, return the number of submatrices that have all ones. + +Example 1: + +Input: mat = [ + [1,0,1], + [1,1,0], + [1,1,0] +] +Output: 13 +Explanation: +There are 6 rectangles of side 1x1. +There are 2 rectangles of side 1x2. +There are 3 rectangles of side 2x1. +There is 1 rectangle of side 2x2. +There is 1 rectangle of side 3x1. +Total number of rectangles = 6 + 2 + 3 + 1 + 1 = 13. +Example 2: + + +Input: mat = [[0,1,1,0],[0,1,1,1],[1,1,1,0]] +Output: 24 +Explanation: +There are 8 rectangles of side 1x1. +There are 5 rectangles of side 1x2. +There are 2 rectangles of side 1x3. +There are 4 rectangles of side 2x1. +There are 2 rectangles of side 2x2. +There are 2 rectangles of side 3x1. +There is 1 rectangle of side 3x2. +Total number of rectangles = 8 + 5 + 2 + 4 + 2 + 2 + 1 = 24. + + +Constraints: + +1 <= m, n <= 150 +mat[i][j] is either 0 or 1. +""" +class Solution: + def numSubmat(self, mat: List[List[int]]) -> int: + """ + 1-D 1-submatrix: + [1, 0, 1, 1, 1] + Let F[j] be number of 1-submatrix ending AT j-1 + + F[j] = F[j] + 1 if F[j-1] == 1 + 0 otherwise + In the end, sum(F) + + 2-D submatrix: + [1, 0, 1, 1, 1] + [1, 1, 0, 1, 1] + Consider a 2-row matrix, Project 2D into 1D: + [1, 0, 0, 1, 1] + """ + ret = 0 + M = len(mat) + N = len(mat[0]) + for lo in range(M): + # is all ones for mat[lo:hi][j] + is_ones_col = [True for j in range(N)] + for hi in range(lo+1, M+1): + for j in range(N): + is_ones_col[j] &= mat[hi-1][j] # mem saving + + F = [0 for _ in range(N+1)] + for j in range(1, N+1): + F[j] = F[j-1] + 1 if is_ones_col[j-1] else 0 + ret += F[j] + + return ret \ No newline at end of file diff --git a/151 Reverse Words in a String.py b/151 Reverse Words in a String.py index 78f57bd..9a612aa 100644 --- a/151 Reverse Words in a String.py +++ b/151 Reverse Words in a String.py @@ -16,6 +16,8 @@ Reduce them to a single space in the reversed string. """ __author__ = 'Danyang' + + class Solution: def reverseWords(self, s): """ @@ -23,6 +25,6 @@ def reverseWords(self, s): :param s: a string :return: a string """ - words_lst = s.split() # not s.split(" ") + words_lst = s.split() # not s.split(" ") words_lst = reversed(words_lst) return ' '.join(words_lst) \ No newline at end of file diff --git a/1519 Number of Nodes in the Sub-Tree With the Same Label.py b/1519 Number of Nodes in the Sub-Tree With the Same Label.py new file mode 100644 index 0000000..5a5ce04 --- /dev/null +++ b/1519 Number of Nodes in the Sub-Tree With the Same Label.py @@ -0,0 +1,75 @@ +""" +You are given a tree (i.e. a connected, undirected graph that has no cycles) consisting of n nodes numbered from 0 to n - 1 and exactly n - 1 edges. The root of the tree is the node 0, and each node of the tree has a label which is a lower-case character given in the string labels (i.e. The node with the number i has the label labels[i]). + +The edges array is given on the form edges[i] = [ai, bi], which means there is an edge between nodes ai and bi in the tree. + +Return an array of size n where ans[i] is the number of nodes in the subtree of the ith node which have the same label as node i. + +A subtree of a tree T is the tree consisting of a node in T and all of its descendant nodes. + + + +Example 1: + + +Input: n = 7, edges = [[0,1],[0,2],[1,4],[1,5],[2,3],[2,6]], labels = "abaedcd" +Output: [2,1,1,1,1,1,1] +Explanation: Node 0 has label 'a' and its sub-tree has node 2 with label 'a' as well, thus the answer is 2. Notice that any node is part of its sub-tree. +Node 1 has a label 'b'. The sub-tree of node 1 contains nodes 1,4 and 5, as nodes 4 and 5 have different labels than node 1, the answer is just 1 (the node itself). +Example 2: + + +Input: n = 4, edges = [[0,1],[1,2],[0,3]], labels = "bbbb" +Output: [4,2,1,1] +Explanation: The sub-tree of node 2 contains only node 2, so the answer is 1. +The sub-tree of node 3 contains only node 3, so the answer is 1. +The sub-tree of node 1 contains nodes 1 and 2, both have label 'b', thus the answer is 2. +The sub-tree of node 0 contains nodes 0, 1, 2 and 3, all with label 'b', thus the answer is 4. +Example 3: + + +Input: n = 5, edges = [[0,1],[0,2],[1,3],[0,4]], labels = "aabab" +Output: [3,2,1,1,1] + + +Constraints: + +1 <= n <= 10^5 +edges.length == n - 1 +edges[i].length == 2 +0 <= ai, bi < n +ai != bi +labels.length == n +labels is consisting of only of lowercase English letters. +""" +from collections import Counter, defaultdict + + +class Solution: + def countSubTrees(self, n: int, edges: List[List[int]], labels: str) -> List[int]: + """ + just collect all labels in hm + """ + self.labels = labels + self.ret = [0 for _ in range(n)] + G = defaultdict(list) + for u, v in edges: + G[u].append(v) + G[v].append(u) + + self.dfs(G, 0, defaultdict(bool)) + return self.ret + + def dfs(self, G, cur, visited): + if visited[cur]: + return Counter() + + visited[cur] = True + cnt = Counter() + cnt[self.labels[cur]] = 1 + for nbr in G[cur]: + if not visited[nbr]: + cnt += self.dfs(G, nbr, visited) + + self.ret[cur] = cnt[self.labels[cur]] + return cnt diff --git a/152 Maximum Product Subarray.py b/152 Maximum Product Subarray.py index 8a3dfb0..01ed007 100644 --- a/152 Maximum Product Subarray.py +++ b/152 Maximum Product Subarray.py @@ -5,7 +5,63 @@ the contiguous subarray [2,3] has the largest product = 6 """ __author__ = 'Danyang' -class Solution: + + +class Solution(object): + def maxProduct_oneline(self, nums): + return max(reduce(lambda A, n: [max(A), min(n, A[1]*n, A[2]*n), max(n, A[1]*n, A[2]*n)], nums[1:], [nums[0]]*3)) + + def maxProduct(self, nums): + """ + DP + State definitions: + let small[i] be the smallest product result ending with i + let large[i] be the largest product result ending with i + Transition functions: + small[i] = min(A[i], small[i-1]*A[i], large[i-1]*A[i] + large[i] = max(A[i], small[i-1]*A[i], large[i-1]*A[i] + + DP space can be optimized + :type nums: List[int] + :rtype: int + """ + small = nums[0] + large = nums[0] + maxa = nums[0] + for a in nums[1:]: + small, large = min(a, small*a, large*a), max(a, small*a, large*a) + maxa = max(maxa, small, large) + + return maxa + + def maxProduct_error2(self, nums): + """ + :type nums: List[int] + :rtype: int + """ + if len(nums) < 2: + return max(nums) + + n = len(nums) + F_pos = [0 for _ in xrange(n+1)] + F_neg = [0 for _ in xrange(n+1)] + + maxa = 1 + for i in xrange(1, n+1): + v = nums[i-1] + if v > 0: + F_pos[i] = F_pos[i-1]*v if F_pos[i-1] != 0 else v + F_neg[i] = F_neg[i-1]*v + elif v == 0: + F_pos[i], F_neg[i] = 0, 0 + else: + F_neg[i] = min(0, F_pos[i-1]*v) + F_pos[i] = max(0, F_neg[i-1]*v) + + maxa = max(maxa, F_pos[i]) + + return maxa + def maxProduct_error(self, A): """ dp, collect number of negative number @@ -51,7 +107,7 @@ def maxProduct_error(self, A): return global_max - def maxProduct(self, A): + def maxProduct_dp(self, A): """ dp, collect number of negative number (notice 0). negative number and 0 will be special in this question @@ -103,12 +159,11 @@ def maxProduct(self, A): global_max = max(global_max, cur) - - return global_max if __name__=="__main__": + print Solution().maxProduct([2,3,-2,4]) assert Solution().maxProduct([2,-5,-2,-4,3])==24 assert Solution().maxProduct([-2, 0, -1])==0 assert Solution().maxProduct([-2])==-2 diff --git a/153 Find Minimum in Rotated Sorted Array.py b/153 Find Minimum in Rotated Sorted Array.py index 473d82e..fd8bc86 100644 --- a/153 Find Minimum in Rotated Sorted Array.py +++ b/153 Find Minimum in Rotated Sorted Array.py @@ -7,32 +7,36 @@ You may assume no duplicate exists in the array. """ +import sys + __author__ = 'Danyang' -class Solution: - def findMin(self, num): + + +class Solution(object): + def findMin(self, A): """ similar to find target in rotated sorted array - :type num: list - :param num: a list of integer + :type A: list + :param A: a list of integer :return: an integer """ - start = 0 - end = len(num) - mini = 1<<32 - while startnum[mid] A[mid] < A[hi-1]: + hi = mid else: - start = mid+1 + lo = mid+1 return mini -if __name__=="__main__": + +if __name__ == "__main__": num = [7, 1, 2, 3, 4, 5, 6] - print Solution().findMin(num) + assert Solution().findMin(num) == 1 diff --git a/1530 Number of Good Leaf Nodes Pairs.py b/1530 Number of Good Leaf Nodes Pairs.py new file mode 100644 index 0000000..0e8bcfb --- /dev/null +++ b/1530 Number of Good Leaf Nodes Pairs.py @@ -0,0 +1,87 @@ +""" +You are given the root of a binary tree and an integer distance. A pair of two different leaf nodes of a binary tree is said to be good if the length of the shortest path between them is less than or equal to distance. + +Return the number of good leaf node pairs in the tree. + + +Example 1: + + +Input: root = [1,2,3,null,4], distance = 3 +Output: 1 +Explanation: The leaf nodes of the tree are 3 and 4 and the length of the shortest path between them is 3. This is the only good pair. +Example 2: + + +Input: root = [1,2,3,4,5,6,7], distance = 3 +Output: 2 +Explanation: The good pairs are [4,5] and [6,7] with shortest path = 2. The pair [4,6] is not good because the length of ther shortest path between them is 4. +Example 3: + +Input: root = [7,1,4,6,null,5,3,null,null,null,null,null,2], distance = 3 +Output: 1 +Explanation: The only good pair is [2,5]. + + +Constraints: + +The number of nodes in the tree is in the range [1, 210]. +1 <= Node.val <= 100 +1 <= distance <= 10 +""" +from collections import defaultdict + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def countPairs(self, root: Optional[TreeNode], distance: int) -> int: + """ + Start DFS from leaf. Create a graph? + + LCA left * right + maintain a counter: distance -> #leaves + """ + self.ret = 0 + self.dist = distance + self.dfs(root) + return self.ret + + def dfs(self, node): + """ + return a map of distance to the cur node + """ + counter = defaultdict(int) + if not node: + return counter + + if not node.left and not node.right: + counter[0] = 1 + return counter + + left = self.dfs(node.left) + right = self.dfs(node.right) + for k, v in left.items(): + for K, V in right.items(): + if (k+1) + (K+1) <= self.dist: + self.ret += v * V + + # merge + for k, v in left.items(): + k += 1 + if k <= self.dist: + counter[k] += v + for k, v in right.items(): + k += 1 + if k <= self.dist: + counter[k] += v + + return counter + + \ No newline at end of file diff --git a/154 Find Minimum in Rotated Sorted Array II.py b/154 Find Minimum in Rotated Sorted Array II.py index cfecb0e..2a1de02 100644 --- a/154 Find Minimum in Rotated Sorted Array II.py +++ b/154 Find Minimum in Rotated Sorted Array II.py @@ -11,34 +11,38 @@ The array may contain duplicates. """ +import sys + __author__ = 'Danyang' -class Solution: - def findMin(self, num): + + +class Solution(object): + def findMin(self, A): """ similar to find target in rotated sorted array - :type num: list - :param num: a list of integer + :type A: list + :param A: a list of integer :return: an integer """ - start = 0 - end = len(num) - mini = 1<<32 - while startnum[mid]<=num[end-1]: - end = mid - else: - start = mid+1 + lo = 0 + hi = len(A) + mini = sys.maxint + while lo < hi: + mid = (lo+hi)/2 + mini = min(mini, A[mid]) + if A[lo] == A[mid]: # JUMP + lo += 1 + elif A[lo] < A[mid] <= A[hi-1]: + return min(mini, A[lo]) + elif A[lo] > A[mid] <= A[hi-1]: # trough + hi = mid + else: # peak + lo = mid+1 return mini -if __name__=="__main__": + +if __name__ == "__main__": num = [7, 1, 2, 2, 3, 4, 5, 6] - print Solution().findMin(num) + assert Solution().findMin(num) == 1 diff --git a/156 Binary Tree Upside Down.py b/156 Binary Tree Upside Down.py new file mode 100644 index 0000000..68f42cc --- /dev/null +++ b/156 Binary Tree Upside Down.py @@ -0,0 +1,67 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution(object): + def upsideDownBinaryTree(self, root): + """ + single recursive + + for each node, upside down the current node's left, and append the current node and its right to the new tree + :type root: TreeNode + :rtype: TreeNode + """ + if not root or not root.left: + return root + + left, right = root.left, root.right + root_new = self.upsideDownBinaryTree(root.left) + left.left, left.right = right, root + root.left, root.right = None, None + return root_new + + +class SolutionComplex(object): + def __init__(self): + self.root = TreeNode(0) + self.cur_new = self.root + + def upsideDownBinaryTree(self, root): + """ + Tree, iterative + recursive + + :type root: TreeNode + :rtype: TreeNode + """ + if not root: + return + + self.traverse(root) + return self.root + + def traverse(self, cur): + """ + Process left first, and add it to the new tree + :param cur: + :return: + """ + if not cur: + return + + if not cur.left: + self.cur_new.val = cur.val + return + + self.traverse(cur.left) + if cur.right: self.cur_new.left = TreeNode(cur.right.val) + self.cur_new.right = TreeNode(cur.val) + self.cur_new = self.cur_new.right \ No newline at end of file diff --git a/157 Read N Characters Given Read4.py b/157 Read N Characters Given Read4.py new file mode 100644 index 0000000..a503a3b --- /dev/null +++ b/157 Read N Characters Given Read4.py @@ -0,0 +1,42 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +def read4(buf): + """ + read 4 chars to buf + + :type buf: List[str] + :rtype: int + """ + return 0 + + +class Solution(object): + def read(self, buf, n): + """ + read n chars to buf + Algorithm: + Two dimensions + 1st dim: buf full or not + 2nd dim: buf4 full or not + + :type buf: Destination buffer (List[str]) + :type n: Maximum number of characters to read (int) + :rtype: The number of characters read (int) + """ + idx = 0 + while idx < n: + buf4 = ["" for _ in xrange(4)] + r = read4(buf4) + if idx+r < n: + buf[idx:idx+r] = buf4[:r] + idx += r + if r < 4: break + else: + buf[idx:n] = buf4[:n-idx] + idx = n + + return idx diff --git a/1574 Shortest Subarray to be Removed to Make Array Sorted.py b/1574 Shortest Subarray to be Removed to Make Array Sorted.py new file mode 100644 index 0000000..da309dc --- /dev/null +++ b/1574 Shortest Subarray to be Removed to Make Array Sorted.py @@ -0,0 +1,165 @@ +""" +Given an integer array arr, remove a subarray (can be empty) from arr such that the remaining elements in arr are non-decreasing. + +Return the length of the shortest subarray to remove. + +A subarray is a contiguous subsequence of the array. + + + +Example 1: + +Input: arr = [1,2,3,10,4,2,3,5] +Output: 3 +Explanation: The shortest subarray we can remove is [10,4,2] of length 3. The remaining elements after that will be [1,2,3,3,5] which are sorted. +Another correct solution is to remove the subarray [3,10,4]. +Example 2: + +Input: arr = [5,4,3,2,1] +Output: 4 +Explanation: Since the array is strictly decreasing, we can only keep a single element. Therefore we need to remove a subarray of length 4, either [5,4,3,2] or [4,3,2,1]. +Example 3: + +Input: arr = [1,2,3] +Output: 0 +Explanation: The array is already non-decreasing. We do not need to remove any elements. + + +Constraints: + +1 <= arr.length <= 10^5 +0 <= arr[i] <= 10^9 +""" +import bisect + + +class SolutionAdditionalMemory: + def findLengthOfShortestSubarray_suboptimal(self, A: List[int]) -> int: + """ + It is subarray, not subsequence. For subsequence, may use DP + + Has to be sorted + [1,2,3,10,4,2,3,5] + option1: [1,2,3,10] + option2: [1,2,3,4,5] + + next larger element? + 0 1 2 3 4 5 6 7 8 + [1,2,3,10,4,2,3,5] + [2,3,10,\0,5,3,5,\0] + [1,2,3,8, 8,6,7,8] + + (val, idx) + does not work , since (3, 2) need to consider (2, 5) + + Complementary: + find the longest increasing subarray prefix + find the longest increasing subarray suffix + + then keep popping either stack to make a single subarray increasing + prefix: [1, 2, 3, 10] + suffix: [5, 3, 2] + O(N^2) to search the stack + or bisect O(N logN) + """ + prefix = [] + for a in A: + if not prefix or prefix[-1] <= a: + prefix.append(a) + else: + break + suffix = [] + for a in A[::-1]: + if not suffix or suffix[-1] >= a: + suffix.append(a) + else: + break + + maxa = 0 + p = list(prefix) + # bisect only works on asc array + suffix_rev = suffix[::-1] + while p: + t = p[-1] + idx = bisect.bisect_right(suffix_rev, t) + maxa = max(maxa, len(p) + len(suffix_rev) - idx) + p.pop() + s = list(suffix) + while s: + t = s[-1] + idx = bisect.bisect_right(prefix, t) + maxa = max(maxa, len(s) + idx) + s.pop() + + return max(0, len(A) - maxa) # handle double counting of the same element + + def findLengthOfShortestSubarray(self, A: List[int]) -> int: + """ + prefix: [1, 2, 3, 10] + suffix: [5, 3, 2] + + Bridge the two sorted arrays can be O(N) + """ + prefix = [] + for a in A: + if not prefix or prefix[-1] <= a: + prefix.append(a) + else: + break + suffix = [] + for a in A[::-1]: + if not suffix or suffix[-1] >= a: + suffix.append(a) + else: + break + + maxa = max(len(suffix), len(prefix)) + j = len(suffix) - 1 + for i in range(len(prefix)): + # this does not handle empty prefix + while j >= 0 and suffix[j] < prefix[i]: + j -= 1 + maxa = max(maxa, i+1 + j+1) + + return max(0, len(A) - maxa) # handle double counting of the same element + + +class Solution: + def findLengthOfShortestSubarray(self, A: List[int]) -> int: + """ + Use pointers instead of additional memory + + Bridget two asc sorted list + [1, 2, 3, 4, 5] + [3, 4, 5] + """ + N = len(A) + + # sorted: A[:prefix] + prefix = 0 + for i in range(N): + if prefix == 0 or A[i] >= A[prefix-1]: + prefix = i + 1 + else: + break + + # sorted: A[suffix:] + suffix = N + for i in range(N-1, -1, -1): + if suffix == N or A[i] <= A[suffix]: + suffix = i + else: + break + + if prefix > suffix: + return 0 + + maxa = 0 + j = suffix + for i in range(prefix+1): + while i-1 >= 0 and j < N and A[i-1] > A[j]: + j += 1 + + maxa = max(maxa, i+(N-j)) + + return N - maxa \ No newline at end of file diff --git a/158 Read N Characters Given Read4 II - Call multiple times.py b/158 Read N Characters Given Read4 II - Call multiple times.py new file mode 100644 index 0000000..c52a1df --- /dev/null +++ b/158 Read N Characters Given Read4 II - Call multiple times.py @@ -0,0 +1,46 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +def read4(buf): + """ + read 4 chars to buf + + :type buf: List[str] + :rtype: int + """ + return 0 + + +class Solution(object): + def __init__(self): + self.prev = [] + + def read(self, buf, n): + """ + read n chars to buf, called multiple times + + :type buf: Destination buffer (List[str]) + :type n: Maximum number of characters to read (int) + :rtype: The number of characters read (int) + """ + l = min(len(self.prev), n) + buf[:l] = self.prev[:l] + self.prev = self.prev[l:] # pitfall self.prev = [] + + idx = l # the next reading + while idx < n: + buf4 = ["" for _ in xrange(4)] + r = read4(buf4) + if idx+r < n: + buf[idx:idx+r] = buf4[:r] + idx += r + if r < 4: return idx + else: + buf[idx:n] = buf4[:n-idx] + self.prev = buf4[n-idx:r] # pitfall buf4[n-idx:] + idx = n + + return idx \ No newline at end of file diff --git a/159 Longest Substring with At Most Two Distinct Characters.py b/159 Longest Substring with At Most Two Distinct Characters.py new file mode 100644 index 0000000..0add713 --- /dev/null +++ b/159 Longest Substring with At Most Two Distinct Characters.py @@ -0,0 +1,35 @@ +""" +Premium Question +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def lengthOfLongestSubstringTwoDistinct(self, s): + """ + Sliding Window + :type s: str + :rtype: int + """ + m = defaultdict(int) + i = 0 + j = 0 + maxa = 0 + for j in xrange(len(s)): + m[s[j]] += 1 + while len(m) > 2: + m[s[i]] -= 1 + if m[s[i]] == 0: + del m[s[i]] + + i += 1 + + maxa = max(maxa, j-i+1) + + return maxa + + +if __name__ == "__main__": + assert Solution().lengthOfLongestSubstringTwoDistinct("ecebaaaaaacdbb") == 7 \ No newline at end of file diff --git a/1600 Throne Inheritance.py b/1600 Throne Inheritance.py new file mode 100644 index 0000000..3ee9abd --- /dev/null +++ b/1600 Throne Inheritance.py @@ -0,0 +1,135 @@ +""" +A kingdom consists of a king, his children, his grandchildren, and so on. Every once in a while, someone in the family dies or a child is born. + +The kingdom has a well-defined order of inheritance that consists of the king as the first member. Let's define the recursive function Successor(x, curOrder), which given a person x and the inheritance order so far, returns who should be the next person after x in the order of inheritance. + +Successor(x, curOrder): + if x has no children or all of x's children are in curOrder: + if x is the king return null + else return Successor(x's parent, curOrder) + else return x's oldest child who's not in curOrder +For example, assume we have a kingdom that consists of the king, his children Alice and Bob (Alice is older than Bob), and finally Alice's son Jack. + +In the beginning, curOrder will be ["king"]. +Calling Successor(king, curOrder) will return Alice, so we append to curOrder to get ["king", "Alice"]. +Calling Successor(Alice, curOrder) will return Jack, so we append to curOrder to get ["king", "Alice", "Jack"]. +Calling Successor(Jack, curOrder) will return Bob, so we append to curOrder to get ["king", "Alice", "Jack", "Bob"]. +Calling Successor(Bob, curOrder) will return null. Thus the order of inheritance will be ["king", "Alice", "Jack", "Bob"]. +Using the above function, we can always obtain a unique order of inheritance. + +Implement the ThroneInheritance class: + +ThroneInheritance(string kingName) Initializes an object of the ThroneInheritance class. The name of the king is given as part of the constructor. +void birth(string parentName, string childName) Indicates that parentName gave birth to childName. +void death(string name) Indicates the death of name. The death of the person doesn't affect the Successor function nor the current inheritance order. You can treat it as just marking the person as dead. +string[] getInheritanceOrder() Returns a list representing the current order of inheritance excluding dead people. + + +Example 1: + +Input +["ThroneInheritance", "birth", "birth", "birth", "birth", "birth", "birth", "getInheritanceOrder", "death", "getInheritanceOrder"] +[["king"], ["king", "andy"], ["king", "bob"], ["king", "catherine"], ["andy", "matthew"], ["bob", "alex"], ["bob", "asha"], [null], ["bob"], [null]] +Output +[null, null, null, null, null, null, null, ["king", "andy", "matthew", "bob", "alex", "asha", "catherine"], null, ["king", "andy", "matthew", "alex", "asha", "catherine"]] + +Explanation +ThroneInheritance t= new ThroneInheritance("king"); // order: king +t.birth("king", "andy"); // order: king > andy +t.birth("king", "bob"); // order: king > andy > bob +t.birth("king", "catherine"); // order: king > andy > bob > catherine +t.birth("andy", "matthew"); // order: king > andy > matthew > bob > catherine +t.birth("bob", "alex"); // order: king > andy > matthew > bob > alex > catherine +t.birth("bob", "asha"); // order: king > andy > matthew > bob > alex > asha > catherine +t.getInheritanceOrder(); // return ["king", "andy", "matthew", "bob", "alex", "asha", "catherine"] +t.death("bob"); // order: king > andy > matthew > bob > alex > asha > catherine +t.getInheritanceOrder(); // return ["king", "andy", "matthew", "alex", "asha", "catherine"] + + +Constraints: + +1 <= kingName.length, parentName.length, childName.length, name.length <= 15 +kingName, parentName, childName, and name consist of lowercase English letters only. +All arguments childName and kingName are distinct. +All name arguments of death will be passed to either the constructor or as childName to birth first. +For each call to birth(parentName, childName), it is guaranteed that parentName is alive. +At most 10^5 calls will be made to birth and death. +At most 10 calls will be made to getInheritanceOrder. +""" +from collections import defaultdict + + +class ThroneInheritanceBruteForce: + + def __init__(self, kingName: str): + self.root = kingName + self.deleted = set() + self.G = defaultdict(list) + self.P = defaultdict(str) + + def birth(self, parentName: str, childName: str) -> None: + self.G[parentName].append(childName) + self.P[childName] = parentName + + def death(self, name: str) -> None: + self.deleted.add(name) + + def getInheritanceOrder(self) -> List[str]: + order = [] + self.succeed(self.root, order, defaultdict(bool)) + + ret = [] + for e in order: + if e not in self.deleted: + ret.append(e) + + return ret + + def succeed(self, cur, order, visited): + if not visited[cur]: + order.append(cur) + visited[cur] = True + + valid = False + for c in self.G[cur]: + if not visited[c]: + valid = True + self.succeed(c, order, visited) + + if not valid: + if cur == self.root: + return + self.succeed(self.P[cur], order, visited) + + +class ThroneInheritance: + def __init__(self, kingName: str): + self.root = kingName + self.deleted = set() + self.G = defaultdict(list) + + def birth(self, parentName: str, childName: str) -> None: + self.G[parentName].append(childName) + + def death(self, name: str) -> None: + self.deleted.add(name) + + def getInheritanceOrder(self) -> List[str]: + order = [] + self.succeed(self.root, order, defaultdict(bool)) + return order + + def succeed(self, cur, order, visited): + if cur not in self.deleted: + order.append(cur) + + visited[cur] = True + for c in self.G[cur]: + if not visited[c]: + self.succeed(c, order, visited) + +# Your ThroneInheritance object will be instantiated and called as such: +# obj = ThroneInheritance(kingName) +# obj.birth(parentName,childName) +# obj.death(name) +# param_3 = obj.getInheritanceOrder() \ No newline at end of file diff --git a/1609 Even Odd Tree.py b/1609 Even Odd Tree.py new file mode 100644 index 0000000..cf4f6c7 --- /dev/null +++ b/1609 Even Odd Tree.py @@ -0,0 +1,84 @@ +""" +A binary tree is named Even-Odd if it meets the following conditions: + +The root of the binary tree is at level index 0, its children are at level index 1, their children are at level index 2, etc. +For every even-indexed level, all nodes at the level have odd integer values in strictly increasing order (from left to right). +For every odd-indexed level, all nodes at the level have even integer values in strictly decreasing order (from left to right). +Given the root of a binary tree, return true if the binary tree is Even-Odd, otherwise return false. + + + +Example 1: + + +Input: root = [1,10,4,3,null,7,9,12,8,6,null,null,2] +Output: true +Explanation: The node values on each level are: +Level 0: [1] +Level 1: [10,4] +Level 2: [3,7,9] +Level 3: [12,8,6,2] +Since levels 0 and 2 are all odd and increasing and levels 1 and 3 are all even and decreasing, the tree is Even-Odd. +Example 2: + + +Input: root = [5,4,2,3,3,7] +Output: false +Explanation: The node values on each level are: +Level 0: [5] +Level 1: [4,2] +Level 2: [3,3,7] +Node values in level 2 must be in strictly increasing order, so the tree is not Even-Odd. +Example 3: + + +Input: root = [5,9,1,3,5,7] +Output: false +Explanation: Node values in the level 1 should be even integers. + + +Constraints: + +The number of nodes in the tree is in the range [1, 10^5]. +1 <= Node.val <= 10^6 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def isEvenOddTree(self, root: Optional[TreeNode]) -> bool: + """ + bfs + """ + q = [root] + l = 0 + while q: + new_q = [] + for i in range(len(q)): + if l % 2 == 0: + if q[i].val % 2 != 1: + return False + if i > 0: + if not q[i-1].val < q[i].val: + return False + else: + if q[i].val % 2 != 0: + return False + if i > 0: + if not q[i-1].val > q[i].val: + return False + + if q[i].left: + new_q.append(q[i].left) + if q[i].right: + new_q.append(q[i].right) + + q = new_q + l += 1 + + return True diff --git a/161 One Edit Distance.py b/161 One Edit Distance.py new file mode 100644 index 0000000..cdee136 --- /dev/null +++ b/161 One Edit Distance.py @@ -0,0 +1,62 @@ +""" +Premium question +Non-dp version of edit distance +""" +__author__ = 'Daniel' + + +class Solution(object): + def isOneEditDistance(self, s, t): + """ + String + + :type s: str + :type t: str + :rtype: bool + """ + m, n = len(s), len(t) + if m > n: return self.isOneEditDistance(t, s) + if n-m > 1: return False + + diff = 0 + i, j = 0, 0 + while i < m and j < n and diff < 2: + if s[i] == t[j]: + i += 1 + j += 1 + else: + if m != n: + j += 1 # delete + else: # replace s[i] + i += 1 + j += 1 + + diff += 1 + + return diff == 1 or diff == 0 and m != n + + +class Solution1(object): + def isOneEditDistance(self, s, t): + """ + Iterator version + """ + m, n = len(s), len(t) + if m > n: return self.isOneEditDistance(t, s) + if n-m > 1: return False + + diff = 0 + i, j = iter(s), iter(t) + a, b = next(i, None), next(j, None) + while a and b and diff < 2: + if a == b: + a, b = next(i, None), next(j, None) + else: + if m != n: + b = next(j, None) + else: + a, b = next(i, None), next(j, None) + + diff += 1 + + return diff == 1 or diff == 0 and m != n diff --git a/163 Missing Ranges.py b/163 Missing Ranges.py new file mode 100644 index 0000000..4506ecf --- /dev/null +++ b/163 Missing Ranges.py @@ -0,0 +1,39 @@ +""" +Given a sorted integer array where the range of elements are [lower, upper] inclusive, return its missing ranges. + +For example, given [0, 1, 3, 50, 75], lower = 0 and upper = 99, return ["2", "4->49", "51->74", "76->99"]. +""" +__author__ = 'Daniel' + + +class Solution(object): + def findMissingRanges(self, nums, lower, upper): + """ + :type nums: List[int] + :type lower: int + :type upper: int + :rtype: List[str] + """ + n = len(nums) + ret = [] + if not nums: + ret.append([lower, upper]) + return map(self.mapper, ret) + + if nums[0] > lower: + ret.append([lower, nums[0]-1]) + + for i in xrange(1, n): + if nums[i] > nums[i-1]+1: + ret.append([nums[i-1]+1, nums[i]-1]) + + if upper > nums[-1]: + ret.append([nums[-1]+1, upper]) + + return map(self.mapper, ret) + + def mapper(self, x): + if x[0] == x[1]: + return "%d" % x[0] + else: + return "%d->%d" % tuple(x) diff --git a/167 Two Sum II - Input array is sorted.py b/167 Two Sum II - Input array is sorted.py new file mode 100644 index 0000000..154569f --- /dev/null +++ b/167 Two Sum II - Input array is sorted.py @@ -0,0 +1,26 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Solution(object): + def twoSum(self, numbers, target): + """ + :type numbers: List[int] + :type target: int + :rtype: List[int] + """ + n = len(numbers) + i = 0 + j = n-1 + while i < j: + s = numbers[i] + numbers[j] + if s == target: + return i+1, j+1 + elif s < target: + i += 1 + else: + j -= 1 + + return -1, -1 diff --git a/1673 Find the Most Competitive Subsequence.py b/1673 Find the Most Competitive Subsequence.py new file mode 100644 index 0000000..45c3915 --- /dev/null +++ b/1673 Find the Most Competitive Subsequence.py @@ -0,0 +1,56 @@ +""" +Given an integer array nums and a positive integer k, return the most competitive subsequence of nums of size k. + +An array's subsequence is a resulting sequence obtained by erasing some (possibly zero) elements from the array. + +We define that a subsequence a is more competitive than a subsequence b (of the same length) if in the first position where a and b differ, subsequence a has a number less than the corresponding number in b. For example, [1,3,4] is more competitive than [1,3,5] because the first position they differ is at the final number, and 4 is less than 5. + + + +Example 1: + +Input: nums = [3,5,2,6], k = 2 +Output: [2,6] +Explanation: Among the set of every possible subsequence: {[3,5], [3,2], [3,6], [5,2], [5,6], [2,6]}, [2,6] is the most competitive. +Example 2: + +Input: nums = [2,4,3,3,5,4,9,6], k = 4 +Output: [2,3,3,4] + + +Constraints: + +1 <= nums.length <= 10^5 +0 <= nums[i] <= 10^9 +1 <= k <= nums.length +""" +class Solution: + def mostCompetitive(self, A: List[int], k: int) -> List[int]: + """ + sort and get the min? + subsequence still maintain the order + + find the next smaller number of each element + build the k-size subsequence from next smaller element + then take the min + O(NK) + + Can we reduce time compexlity? + short curcit when reach A[N_K:K] + sort, start from smallest O(N logN) + + Can we do better? + Monotonic stack in one pass + Different than finding the next smaller number + """ + # monotonically increasing stk as the result + stk = [] + N = len(A) + for i in range(N): + # remaining >= required + while stk and A[stk[-1]] > A[i] and N - i >= k - (len(stk) - 1): + stk.pop() + stk.append(i) + + ret = [A[stk[i]] for i in range(k)] + return ret \ No newline at end of file diff --git a/1696 Jump Game VI.py b/1696 Jump Game VI.py new file mode 100644 index 0000000..583679b --- /dev/null +++ b/1696 Jump Game VI.py @@ -0,0 +1,87 @@ +""" +You are given a 0-indexed integer array nums and an integer k. + +You are initially standing at index 0. In one move, you can jump at most k steps forward without going outside the boundaries of the array. That is, you can jump from index i to any index in the range [i + 1, min(n - 1, i + k)] inclusive. + +You want to reach the last index of the array (index n - 1). Your score is the sum of all nums[j] for each index j you visited in the array. + +Return the maximum score you can get. + + + +Example 1: + +Input: nums = [1,-1,-2,4,-7,3], k = 2 +Output: 7 +Explanation: You can choose your jumps forming the subsequence [1,-1,4,3] (underlined above). The sum is 7. +Example 2: + +Input: nums = [10,-5,-2,4,0,3], k = 3 +Output: 17 +Explanation: You can choose your jumps forming the subsequence [10,4,3] (underlined above). The sum is 17. +Example 3: + +Input: nums = [1,-5,-20,4,-1,3,-6,-3], k = 2 +Output: 0 + + +Constraints: + +1 <= nums.length, k <= 10^5 +-104 <= nums[i] <= 10^4 +""" +import sys +from collections import deque + + +class Solution: + def maxResultTLE(self, A: List[int], k: int) -> int: + """ + DP + Let F[i] be the maximum at A[i] + F[i] = A[i] + max( + F[i-1] + F[i-2] + ... + F[i-k] + ) + """ + N = len(A) + F = [-sys.maxsize-1 for _ in range(N)] + F[0] = A[0] + for i in range(1, N): + for j in range(i-1, max(0, i-k) -1, -1): + F[i] = max(F[i], F[j]) + F[i] += A[i] + + return F[~0] + + def maxResult(self, A: List[int], k: int) -> int: + """ + DP + Let F[i] be the maximum at A[i] + F[i] = A[i] + max( + F[i-1] + F[i-2] + ... + F[i-k] + ) + use monotonic queue to keep track the max in window F[i-k:i] + """ + N = len(A) + F = [-sys.maxsize-1 for _ in range(N)] + F[0] = A[0] + q = deque() # max, monotonic decreasing to keep track 1st, 2nd, 3rd largest + for i in range(1, N): + # processing F[i-1] + while q and F[q[~0]] <= F[i-1]: + q.pop() + q.append(i-1) + + # indices falling out of window + while q and q[0] < i - k: + q.popleft() + + F[i] = A[i] + F[q[0]] + + return F[~0] \ No newline at end of file diff --git a/170 Two Sum III - Data structure design.py b/170 Two Sum III - Data structure design.py new file mode 100644 index 0000000..c14c7a0 --- /dev/null +++ b/170 Two Sum III - Data structure design.py @@ -0,0 +1,45 @@ +""" +Premium Question +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class TwoSum(object): + def __init__(self): + """ + initialize your data structure here + """ + self.hash_map = defaultdict(int) + + def add(self, number): + """ + Add the number to an internal data structure. + :rtype: nothing + """ + self.hash_map[number] += 1 + + def find(self, value): + """ + Find if there exists any pair of numbers which sum is equal to the value. + :type value: int + :rtype: bool + """ + return any( + value-k in self.hash_map and (value-k != k or self.hash_map[k] > 1) + for k in self.hash_map + ) + + def find_TLE(self, value): + """ + Find if there exists any pair of numbers which sum is equal to the value. + :type value: int + :rtype: bool + """ + for k in self.hash_map.keys(): + target = value - k + if target in self.hash_map and (target != k or self.hash_map[target] > 1): + return True + + return False diff --git a/1718 Construct the Lexicographically Largest Valid Sequence.py b/1718 Construct the Lexicographically Largest Valid Sequence.py new file mode 100644 index 0000000..7b3e6ff --- /dev/null +++ b/1718 Construct the Lexicographically Largest Valid Sequence.py @@ -0,0 +1,78 @@ +""" +""" +class SolutionTLE: + def constructDistancedSequence(self, n: int) -> List[int]: + """ + backtrack enumeration + + brute-force + * iterate through numbers + * iterate through position + """ + maxa = [-1 for _ in range(2*n-1)] + self.backtrack(list(maxa), n, 1, maxa) + return maxa + + def backtrack(self, A, n, x, maxa): + if all(a != -1 for a in A): + maxa[:] = max(maxa, A) # modify in place + return + + for j in range(len(A)): + if A[j] == -1: + if x == 1: + A[j] = x + self.backtrack(A, n, x+1, maxa) + A[j] = -1 + elif j + x < len(A) and A[j+x] == -1: + A[j] = x + A[j+x] = x + self.backtrack(A, n, x+1, maxa) + A[j] = -1 + A[j+x] = -1 + + +class Solution: + def constructDistancedSequence(self, n: int) -> List[int]: + """ + backtrack enumeration + + brute-force + * iterate through position first + * iterate through numbers + """ + maxa = [-1 for _ in range(2*n-1)] + visited = [False for _ in range(n+1)] + self.backtrack(list(maxa), 0, n, visited, maxa) + return maxa + + def backtrack(self, A, i, n, visited, maxa): + if all(a != -1 for a in A): + maxa[:] = max(maxa, A) # modify in place + return True + + for x in range(n, 0, -1): + if not visited[x]: + if A[i] == -1: + if x == 1: + A[i] = x + visited[x] = True + if self.backtrack(A, i+1, n, visited, maxa): + return True + A[i] = -1 + visited[x] = False + elif i+x < len(A) and A[i+x] == -1: + A[i] = x + A[i+x] = x + visited[x] = True + if self.backtrack(A, i+1, n, visited, maxa): + return True + A[i] = -1 + A[i+x] = -1 + visited[x] = False + else: + return self.backtrack(A, i+1, n, visited, maxa) + + return False + + \ No newline at end of file diff --git a/1765 Map of Highest Peak.py b/1765 Map of Highest Peak.py new file mode 100644 index 0000000..3542062 --- /dev/null +++ b/1765 Map of Highest Peak.py @@ -0,0 +1,84 @@ +""" +You are given an integer matrix isWater of size m x n that represents a map of land and water cells. + +If isWater[i][j] == 0, cell (i, j) is a land cell. +If isWater[i][j] == 1, cell (i, j) is a water cell. +You must assign each cell a height in a way that follows these rules: + +The height of each cell must be non-negative. +If the cell is a water cell, its height must be 0. +Any two adjacent cells must have an absolute height difference of at most 1. A cell is adjacent to another cell if the former is directly north, east, south, or west of the latter (i.e., their sides are touching). +Find an assignment of heights such that the maximum height in the matrix is maximized. + +Return an integer matrix height of size m x n where height[i][j] is cell (i, j)'s height. If there are multiple solutions, return any of them. + + + +Example 1: + + + +Input: isWater = [[0,1],[0,0]] +Output: [[1,0],[2,1]] +Explanation: The image shows the assigned heights of each cell. +The blue cell is the water cell, and the green cells are the land cells. +Example 2: + + + +Input: isWater = [[0,0,1],[1,0,0],[0,0,0]] +Output: [[1,1,0],[0,1,1],[1,2,2]] +Explanation: A height of 2 is the maximum possible height of any assignment. +Any height assignment that has a maximum height of 2 while still meeting the rules will also be accepted. + + +Constraints: + +m == isWater.length +n == isWater[i].length +1 <= m, n <= 1000 +isWater[i][j] is 0 or 1. +There is at least one water cell. + + +Note: This question is the same as 542: https://leetcode.com/problems/01-matrix/ +""" +from collections import deque +import sys + + +class Solution: + def highestPeak(self, isWater: List[List[int]]) -> List[List[int]]: + """ + BFS + + not maximize height, but find the distance to water + """ + M = len(isWater) + N = len(isWater[0]) + q = deque() + dist = [ + [sys.maxsize for _ in range(N)] + for _ in range(M) + ] + for i in range(M): + for j in range(N): + if isWater[i][j] == 1: + q.append((i, j)) + dist[i][j] = 0 + + + dirs = [(0, -1), (0, 1), (-1, 0), (1, 0)] + while q: + i, j = q.popleft() + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < M and 0 <= J < N and isWater[I][J] == 0: + d = dist[i][j] + 1 + if d < dist[I][J]: + dist[I][J] = d + q.append((I, J)) + + return dist + diff --git a/1856 Maximum Subarray Min-Product.py b/1856 Maximum Subarray Min-Product.py new file mode 100644 index 0000000..d05d481 --- /dev/null +++ b/1856 Maximum Subarray Min-Product.py @@ -0,0 +1,89 @@ +""" +The min-product of an array is equal to the minimum value in the array multiplied by the array's sum. + +For example, the array [3,2,5] (minimum value is 2) has a min-product of 2 * (3+2+5) = 2 * 10 = 20. +Given an array of integers nums, return the maximum min-product of any non-empty subarray of nums. Since the answer may be large, return it modulo 10^9 + 7. + +Note that the min-product should be maximized before performing the modulo operation. Testcases are generated such that the maximum min-product without modulo will fit in a 64-bit signed integer. + +A subarray is a contiguous part of an array. + + + +Example 1: + +Input: nums = [1,2,3,2] +Output: 14 +Explanation: The maximum min-product is achieved with the subarray [2,3,2] (minimum value is 2). +2 * (2+3+2) = 2 * 7 = 14. +Example 2: + +Input: nums = [2,3,3,1,2] +Output: 18 +Explanation: The maximum min-product is achieved with the subarray [3,3] (minimum value is 3). +3 * (3+3) = 3 * 6 = 18. +Example 3: + +Input: nums = [3,1,5,6,4,2] +Output: 60 +Explanation: The maximum min-product is achieved with the subarray [5,6,4] (minimum value is 4). +4 * (5+6+4) = 4 * 15 = 60. + + +Constraints: + +1 <= nums.length <= 10^5 +1 <= nums[i] <= 10^7 +""" +import sys + + +MOD = int(1e9+7) + + +class Solution: + def maxSumMinProduct(self, A: List[int]) -> int: + """ + min(A[i:j]) * sum(A[i:j]) + shrink i, j will make min larger while sum smaller + sum can be get in O(1) by prefix sum + min(A[i:j]) is O(1) by keeping track of min when iterating j + O(N^2) + + Can we do in O(N) by some two pointers? + + Can we find the maximum min-product for every value in the array? + For every value, find the next smaller on the right, and similarly on the left + """ + N = len(A) + P = [0 for _ in range(N+1)] # prefix sum of A[:i] + for i in range(1, N+1): + P[i] = P[i-1] + A[i-1] + + R = [N for _ in range(N)] # next smaller on right + # monotonic increasing stack, storing pending candidate that have not found the next smaller element, + # til monotonicity break, pop and process it + stk = [] + for i in range(N): + while stk and A[stk[~0]] > A[i]: + t = stk.pop() + R[t] = i + stk.append(i) + + L = [-1 for _ in range(N)] # next smaller on the left + for i in range(N-1, -1, -1): + while stk and A[stk[~0]] > A[i]: + t = stk.pop() + L[t] = i + stk.append(i) + + maxa = -sys.maxsize-1 + for i in range(N): + l = L[i] + r = R[i] + # sum(A[l+1:r]) + s = P[r] - P[l+1] + maxa = max(maxa, s * A[i]) + + return maxa % MOD + \ No newline at end of file diff --git a/186 Reverse Words in a String II.py b/186 Reverse Words in a String II.py new file mode 100644 index 0000000..5d43c16 --- /dev/null +++ b/186 Reverse Words in a String II.py @@ -0,0 +1,36 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Solution(object): + def reverseWords(self, s): + """ + in-place without allocating extra space + + :type s: a list of 1 length strings (List[str]) + :rtype: nothing + """ + self.reverse(s, 0, len(s)) + i = 0 + while i < len(s): + j = i+1 + while j < len(s) and s[j] != " ": + j += 1 + + self.reverse(s, i, j) + i = j+1 + + def reverse(self, s, start, end): + i = start + j = end + while i < j-1: + s[i], s[j-1] = s[j-1], s[i] + i += 1 + j -= 1 + +if __name__ == "__main__": + lst = list("the sky is blue") + Solution().reverseWords(lst) + assert "".join(lst) == "blue is sky the" \ No newline at end of file diff --git a/187 Repeated DNA Sequences py3.py b/187 Repeated DNA Sequences py3.py new file mode 100644 index 0000000..358c318 --- /dev/null +++ b/187 Repeated DNA Sequences py3.py @@ -0,0 +1,30 @@ +#!/usr/bin/python3 +""" +All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, +for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to +identify repeated sequences within the DNA. + +Write a function to find all the 10-letter-long sequences (substrings) that +occur more than once in a DNA molecule. + +Example: + +Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" + +Output: ["AAAAACCCCC", "CCCCCAAAAA"] +""" +from typing import List + + +class Solution: + def findRepeatedDnaSequences(self, s: str) -> List[str]: + ret = set() + seen = set() + for i in range(len(s) - 10 + 1): + sub = s[i:i+10] + if sub in seen and sub not in ret: + ret.add(sub) + else: + seen.add(sub) + + return list(ret) diff --git a/187 Repeated DNA Sequences.py b/187 Repeated DNA Sequences.py index b0e61e3..48f128f 100644 --- a/187 Repeated DNA Sequences.py +++ b/187 Repeated DNA Sequences.py @@ -19,6 +19,8 @@ def findRepeatedDnaSequences(self, s): """ Limited space of possible values --> rewrite hash function + Rolling hash + "A": 0 (00) "C": 1 (01) "G": 2 (10) @@ -32,26 +34,25 @@ def findRepeatedDnaSequences(self, s): s = map(self.mapping, list(s)) h = set() - added = set() - ret = [] + # in_ret = set() + ret = set() cur = 0 for i in xrange(10): cur <<= 2 cur &= 0xFFFFF cur += s[i] - h.add(cur) + for i in xrange(10, len(s)): cur <<= 2 - cur &= 0xFFFFF + cur &= 0xFFFFF # 10 * 2 = 20 position cur += s[i] - if cur in h and cur not in added: - ret.append(self.decode(cur)) - added.add(cur) + if cur in h and cur not in ret: + ret.add(cur) else: h.add(cur) - return ret + return map(self.decode, ret) def decode(self, s): dic = { @@ -78,4 +79,4 @@ def mapping(self, a): return dic[a] if __name__ == "__main__": - assert Solution().findRepeatedDnaSequences("AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT") == ['AAAAACCCCC', 'CCCCCAAAAA'] \ No newline at end of file + assert Solution().findRepeatedDnaSequences("AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT") == ['CCCCCAAAAA', 'AAAAACCCCC'] diff --git a/198 House Robber.py b/198 House Robber.py index 5623401..f0a7cd9 100644 --- a/198 House Robber.py +++ b/198 House Robber.py @@ -14,7 +14,14 @@ def rob(self, nums): """ DP O(n) - f_i = max(f_{i-1}, f_{i-2} + A[i]) + Let F_i be max value END AT or BEFORE i + F_i = max(F_{i-1}, F_{i-2} + A[i]) + + Notes: + If change the definition of F_i + Let F_i be mex value END AT i + F_i = max(F_{i-2-k}+A[i] for k \in [0, i-2]), + Then time complexity is quadratic """ n = len(nums) f = [0 for _ in xrange(n+2)] diff --git a/1993 Operations on Tree.py b/1993 Operations on Tree.py new file mode 100644 index 0000000..eb1240e --- /dev/null +++ b/1993 Operations on Tree.py @@ -0,0 +1,126 @@ +""" +You are given a tree with n nodes numbered from 0 to n - 1 in the form of a parent array parent where parent[i] is the parent of the ith node. The root of the tree is node 0, so parent[0] = -1 since it has no parent. You want to design a data structure that allows users to lock, unlock, and upgrade nodes in the tree. + +The data structure should support the following functions: + +Lock: Locks the given node for the given user and prevents other users from locking the same node. You may only lock a node using this function if the node is unlocked. +Unlock: Unlocks the given node for the given user. You may only unlock a node using this function if it is currently locked by the same user. +Upgrade: Locks the given node for the given user and unlocks all of its descendants regardless of who locked it. You may only upgrade a node if all 3 conditions are true: +The node is unlocked, +It has at least one locked descendant (by any user), and +It does not have any locked ancestors. +Implement the LockingTree class: + +LockingTree(int[] parent) initializes the data structure with the parent array. +lock(int num, int user) returns true if it is possible for the user with id user to lock the node num, or false otherwise. If it is possible, the node num will become locked by the user with id user. +unlock(int num, int user) returns true if it is possible for the user with id user to unlock the node num, or false otherwise. If it is possible, the node num will become unlocked. +upgrade(int num, int user) returns true if it is possible for the user with id user to upgrade the node num, or false otherwise. If it is possible, the node num will be upgraded. + + +Example 1: + + +Input +["LockingTree", "lock", "unlock", "unlock", "lock", "upgrade", "lock"] +[[[-1, 0, 0, 1, 1, 2, 2]], [2, 2], [2, 3], [2, 2], [4, 5], [0, 1], [0, 1]] +Output +[null, true, false, true, true, true, false] + +Explanation +LockingTree lockingTree = new LockingTree([-1, 0, 0, 1, 1, 2, 2]); +lockingTree.lock(2, 2); // return true because node 2 is unlocked. + // Node 2 will now be locked by user 2. +lockingTree.unlock(2, 3); // return false because user 3 cannot unlock a node locked by user 2. +lockingTree.unlock(2, 2); // return true because node 2 was previously locked by user 2. + // Node 2 will now be unlocked. +lockingTree.lock(4, 5); // return true because node 4 is unlocked. + // Node 4 will now be locked by user 5. +lockingTree.upgrade(0, 1); // return true because node 0 is unlocked and has at least one locked descendant (node 4). + // Node 0 will now be locked by user 1 and node 4 will now be unlocked. +lockingTree.lock(0, 1); // return false because node 0 is already locked. + + +Constraints: + +n == parent.length +2 <= n <= 2000 +0 <= parent[i] <= n - 1 for i != 0 +parent[0] == -1 +0 <= num <= n - 1 +1 <= user <= 10^4 +parent represents a valid tree. +At most 2000 calls in total will be made to lock, unlock, and upgrade. +""" +from collections import defaultdict + + +class LockingTree: + def __init__(self, parent: List[int]): + self.G = defaultdict(list) + self.P = defaultdict(int) + for i, p in enumerate(parent): + if i != 0: + self.G[p].append(i) + self.P[i] = p + + self.locks = defaultdict(int) + + def lock(self, num: int, user: int) -> bool: + if num in self.locks: + return False + + self.locks[num] = user + return True + + def unlock(self, num: int, user: int) -> bool: + if num in self.locks and self.locks[num] == user: + del self.locks[num] + return True + + return False + + def upgrade(self, num: int, user: int) -> bool: + if num in self.locks: + return False + + cur = num + while cur in self.P: + if self.P[cur] in self.locks: + return False + cur = self.P[cur] + + for c in self.G[num]: + if self.dfs(c): + break # break for-else statement + else: + return False + + self.locks[num] = user + for c in self.G[num]: + self.dfs_unlock(c) + + return True + + def dfs(self, cur): + if cur in self.locks: + return True + + for c in self.G[cur]: + if self.dfs(c): + return True + + return False + + def dfs_unlock(self, cur): + if cur in self.locks: + del self.locks[cur] + + for c in self.G[cur]: + self.dfs_unlock(c) + + +# Your LockingTree object will be instantiated and called as such: +# obj = LockingTree(parent) +# param_1 = obj.lock(num,user) +# param_2 = obj.unlock(num,user) +# param_3 = obj.upgrade(num,user) \ No newline at end of file diff --git a/1996 The Number of Weak Characters in the Game.py b/1996 The Number of Weak Characters in the Game.py new file mode 100644 index 0000000..cc573c6 --- /dev/null +++ b/1996 The Number of Weak Characters in the Game.py @@ -0,0 +1,54 @@ +""" +You are playing a game that contains multiple characters, and each of the characters has two main properties: attack and defense. You are given a 2D integer array properties where properties[i] = [attacki, defensei] represents the properties of the ith character in the game. + +A character is said to be weak if any other character has both attack and defense levels strictly greater than this character's attack and defense levels. More formally, a character i is said to be weak if there exists another character j where attackj > attacki and defensej > defensei. + +Return the number of weak characters. + + + +Example 1: + +Input: properties = [[5,5],[6,3],[3,6]] +Output: 0 +Explanation: No character has strictly greater attack and defense than the other. +Example 2: + +Input: properties = [[2,2],[3,3]] +Output: 1 +Explanation: The first character is weak because the second character has a strictly greater attack and defense. +Example 3: + +Input: properties = [[1,5],[10,4],[4,3]] +Output: 1 +Explanation: The third character is weak because the second character has a strictly greater attack and defense. + + +Constraints: + +2 <= properties.length <= 10^5 +properties[i].length == 2 +1 <= attacki, defensei <= 10^5 +""" +class Solution: + def numberOfWeakCharacters(self, A: List[List[int]]) -> int: + """ + If it is 1D, it is just to find the local min, not global (\exists vs. \forall) + If it is 1D, just find the max, anything under max is weak + + Reduce 2D to 1D? + Points on the pareto effiency curve, anything below is weak + Sort by x-axis, then check y-axis? + Keep a stack of monotonically decreasing y-axis + """ + stk = [] # y monotonically decreasing + A.sort(key=lambda x: (x[0], -x[1])) # sort x asc and then y desc + ret = 0 + for i, v in enumerate(A): + x, y = v + while stk and A[stk[-1]][0] < x and A[stk[-1]][1] < y: + stk.pop() + ret += 1 + stk.append(i) + + return ret \ No newline at end of file diff --git a/200 Number of Islands.py b/200 Number of Islands.py index c18ef72..2b04ab2 100644 --- a/200 Number of Islands.py +++ b/200 Number of Islands.py @@ -57,10 +57,10 @@ def dfs(self, grid, i, j, visited): visited[i][j] = True for dir in self.dirs: - n_i = i+dir[0] - n_j = j+dir[1] - if 0 <= n_i < m and 0 <= n_j < n and not visited[n_i][n_j] and grid[n_i][n_j] == "1": - self.dfs(grid, n_i, n_j, visited) + I = i+dir[0] + J = j+dir[1] + if 0 <= I < m and 0 <= J < n and not visited[I][J] and grid[I][J] == "1": + self.dfs(grid, I, J, visited) if __name__ == "__main__": diff --git a/202 Happy Number.py b/202 Happy Number.py index b4002de..c64d94e 100644 --- a/202 Happy Number.py +++ b/202 Happy Number.py @@ -20,6 +20,9 @@ class Solution: def isHappy(self, n): """ Start with several simple cases and find the pattern. + + if converge to 1, return True + if loop, return False :param n: :rtype: bool """ diff --git a/2049 Count Nodes With the Highest Score.py b/2049 Count Nodes With the Highest Score.py new file mode 100644 index 0000000..861e21d --- /dev/null +++ b/2049 Count Nodes With the Highest Score.py @@ -0,0 +1,81 @@ +""" +There is a binary tree rooted at 0 consisting of n nodes. The nodes are labeled from 0 to n - 1. You are given a 0-indexed integer array parents representing the tree, where parents[i] is the parent of node i. Since node 0 is the root, parents[0] == -1. + +Each node has a score. To find the score of a node, consider if the node and the edges connected to it were removed. The tree would become one or more non-empty subtrees. The size of a subtree is the number of the nodes in it. The score of the node is the product of the sizes of all those subtrees. + +Return the number of nodes that have the highest score. + + + +Example 1: + +example-1 +Input: parents = [-1,2,0,2,0] +Output: 3 +Explanation: +- The score of node 0 is: 3 * 1 = 3 +- The score of node 1 is: 4 = 4 +- The score of node 2 is: 1 * 1 * 2 = 2 +- The score of node 3 is: 4 = 4 +- The score of node 4 is: 4 = 4 +The highest score is 4, and three nodes (node 1, node 3, and node 4) have the highest score. +Example 2: + +example-2 +Input: parents = [-1,2,0] +Output: 2 +Explanation: +- The score of node 0 is: 2 = 2 +- The score of node 1 is: 2 = 2 +- The score of node 2 is: 1 * 1 = 1 +The highest score is 2, and two nodes (node 0 and node 1) have the highest score. + + +Constraints: + +n == parents.length +2 <= n <= 10^5 +parents[0] == -1 +0 <= parents[i] <= n - 1 for i != 0 +parents represents a valid binary tree. +""" +from collections import defaultdict + + +class Solution: + def countHighestScoreNodes(self, parents: List[int]) -> int: + """ + 3 parts: + * l + * r + * total - (l+r+1) + """ + self.N = len(parents) + G = defaultdict(list) + for i, v in enumerate(parents): + G[v].append(i) + + self.maxa = 0 + self.max_count = 0 + self.count(G, 0) + return self.max_count + + def count(self, G, cur): + A = [] + for nbr in G[cur]: + A.append(self.count(G, nbr)) + + c = sum(A) + 1 + + product = 1 + for a in A: + product *= max(1, a) + product *= max(1, self.N - c) + + if product > self.maxa: + self.maxa = product + self.max_count = 1 + elif product == self.maxa: + self.max_count += 1 + + return c diff --git a/206 Reverse Linked List py3.py b/206 Reverse Linked List py3.py new file mode 100644 index 0000000..b7e607a --- /dev/null +++ b/206 Reverse Linked List py3.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +Reverse a singly linked list. + +Example: + +Input: 1->2->3->4->5->NULL +Output: 5->4->3->2->1->NULL +Follow up: + +A linked list can be reversed either iteratively or recursively. Could you +implement both? +""" + + +# Definition for singly-linked list. +class ListNode: + def __init__(self, x): + self.val = x + self.next = None + + +class Solution: + def reverseList(self, head: ListNode) -> ListNode: + prev = None + cur = head + while cur: + nxt = cur.next + cur.next = prev + + prev = cur + cur = nxt + + return prev + + def reverseList_complex(self, head: ListNode) -> ListNode: + if not head: + return None + + prev = head + cur = head.next + head.next = None + while prev and cur: + nxt = cur.next + cur.next = prev + + prev = cur + cur = nxt + + return prev diff --git a/206 Reverse Linked List.py b/206 Reverse Linked List.py index 6a7f777..59096c2 100644 --- a/206 Reverse Linked List.py +++ b/206 Reverse Linked List.py @@ -4,13 +4,13 @@ __author__ = 'Daniel' -class ListNode: +class ListNode(object): def __init__(self, x): self.val = x self.next = None -class Solution: +class Solution(object): def reverseList(self, head): """ :type head: ListNode @@ -26,6 +26,8 @@ def reverseList(self, head): cur = pre.next while pre and cur: pre, cur.next, cur = cur, pre, cur.next + # incorrect evaluation order + # pre, cur, cur.next = cur, cur.next, pre dummy.next.next = None # original head return pre # new head diff --git a/209 Minimum Size Subarray Sum.py b/209 Minimum Size Subarray Sum.py index b40d33a..0c54d82 100644 --- a/209 Minimum Size Subarray Sum.py +++ b/209 Minimum Size Subarray Sum.py @@ -23,23 +23,20 @@ def minSubArrayLen(self, s, nums): """ n = len(nums) - f = [0 for _ in xrange(n+1)] + S = [0 for _ in xrange(n+1)] for i in xrange(1, n+1): - f[i] = f[i-1]+nums[i-1] + S[i] = S[i-1]+nums[i-1] - b, e = 0, 1 + lo, hi = 0, 1 mini = sys.maxint - while e <= n: - if f[e]-f[b] >= s: - mini = min(mini, e-b) - b += 1 + while hi <= n: + if S[hi]-S[lo] >= s: + mini = min(mini, hi-lo) + lo += 1 else: - e += 1 + hi += 1 - if mini == sys.maxint: - mini = 0 - - return mini + return mini if mini != sys.maxint else 0 if __name__ == "__main__": diff --git a/2096 Step-By-Step Directions From a Binary Tree Node to Another.py b/2096 Step-By-Step Directions From a Binary Tree Node to Another.py new file mode 100644 index 0000000..19e52c6 --- /dev/null +++ b/2096 Step-By-Step Directions From a Binary Tree Node to Another.py @@ -0,0 +1,113 @@ +""" +You are given the root of a binary tree with n nodes. Each node is uniquely assigned a value from 1 to n. You are also given an integer startValue representing the value of the start node s, and a different integer destValue representing the value of the destination node t. + +Find the shortest path starting from node s and ending at node t. Generate step-by-step directions of such path as a string consisting of only the uppercase letters 'L', 'R', and 'U'. Each letter indicates a specific direction: + +'L' means to go from a node to its left child node. +'R' means to go from a node to its right child node. +'U' means to go from a node to its parent node. +Return the step-by-step directions of the shortest path from node s to node t. + + + +Example 1: + + +Input: root = [5,1,2,3,null,6,4], startValue = 3, destValue = 6 +Output: "UURL" +Explanation: The shortest path is: 3 → 1 → 5 → 2 → 6. +Example 2: + + +Input: root = [2,1], startValue = 2, destValue = 1 +Output: "L" +Explanation: The shortest path is: 2 → 1. + + +Constraints: + +The number of nodes in the tree is n. +2 <= n <= 10^5 +1 <= Node.val <= n +All the values in the tree are unique. +1 <= startValue, destValue <= n +startValue != destValue +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def getDirections(self, root: Optional[TreeNode], startValue: int, destValue: int) -> str: + """ + find the LCA first, then reconstruct the path + + do it one path + dfs -> has_start, has_dest, path + path use LR, it can degrade to U + path to itself + """ + self.start = startValue + self.dest = destValue + self.ret = None + self.dfs(root) + return self.ret + + + def dfs(self, cur): + if not cur: + return (False, False, []) + + s = False + d = False + p = [] + if cur.val == self.start: + s = True + if cur.val == self.dest: + d = True + + ls, ld, lp = self.dfs(cur.left) + rs, rd, rp = self.dfs(cur.right) + if (ls ^ rs ^ s) & (ld ^ rd ^ d) & self.ret is None: + if ls: + builder = ["U" for _ in lp] + builder.append("U") + if rd: + builder.append("R") + builder += rp[::-1] + self.ret = "".join(builder) + elif rs: + builder = ["U" for _ in rp] + builder.append("U") + if ld: + builder.append("L") + builder += lp[::-1] + self.ret = "".join(builder) + elif s: + builder = [] + if ld: + builder.append("L") + builder += lp[::-1] + else: + builder.append("R") + builder += rp[::-1] + self.ret = "".join(builder) + + if s | d: + p = [] + elif ls | ld: + p = lp + p.append("L") + elif rs | rd: + p = rp + p.append("R") + + return ( + ls | rs | s, + ld | rd | d, + p + ) \ No newline at end of file diff --git a/2104 Sum of Subarray Ranges.py b/2104 Sum of Subarray Ranges.py new file mode 100644 index 0000000..e2b469f --- /dev/null +++ b/2104 Sum of Subarray Ranges.py @@ -0,0 +1,116 @@ +""" +You are given an integer array nums. The range of a subarray of nums is the difference between the largest and smallest element in the subarray. + +Return the sum of all subarray ranges of nums. + +A subarray is a contiguous non-empty sequence of elements within an array. + + + +Example 1: + +Input: nums = [1,2,3] +Output: 4 +Explanation: The 6 subarrays of nums are the following: +[1], range = largest - smallest = 1 - 1 = 0 +[2], range = 2 - 2 = 0 +[3], range = 3 - 3 = 0 +[1,2], range = 2 - 1 = 1 +[2,3], range = 3 - 2 = 1 +[1,2,3], range = 3 - 1 = 2 +So the sum of all ranges is 0 + 0 + 0 + 1 + 1 + 2 = 4. +Example 2: + +Input: nums = [1,3,3] +Output: 4 +Explanation: The 6 subarrays of nums are the following: +[1], range = largest - smallest = 1 - 1 = 0 +[3], range = 3 - 3 = 0 +[3], range = 3 - 3 = 0 +[1,3], range = 3 - 1 = 2 +[3,3], range = 3 - 3 = 0 +[1,3,3], range = 3 - 1 = 2 +So the sum of all ranges is 0 + 0 + 0 + 2 + 0 + 2 = 4. +Example 3: + +Input: nums = [4,-2,-3,4,1] +Output: 59 +Explanation: The sum of all subarray ranges of nums is 59. + + +Constraints: + +1 <= nums.length <= 1000 +-109 <= nums[i] <= 10^9 + + +Follow-up: Could you find a solution with O(n) time complexity? +""" +import sys + + +class Solution: + def subArrayRanges_brute(self, A: List[int]) -> int: + """ + Get a range -> get the min and max + Get all subarrays -> iterate i and j, keep tracks of min and max -> O(N^2) + + Get a range over a sliding window -> monotonic queue? + + Brute force + """ + N = len(A) + ret = 0 + for i in range(N): + mini = A[i] + maxa = A[i] + for j in range(i+1, N): + mini = min(mini, A[j]) + maxa = max(maxa, A[j]) + ret += maxa - mini + + return ret + + def subArrayRanges(self, A: List[int]) -> int: + """ + Get a range -> get the min and max + Get all subarrays -> iterate i and j, keep tracks of min and max -> O(N^2) + \sum{range} + = \sum{max - min} + = \sum max - \sum min + \sum min + = #times of min * min val + = #times of local min * min val + <- find the boundary of local min + <- monotonic stk + """ + N = len(A) + ret = 0 + + sum_max = 0 + stk = [] # monotonically decreasing stk for local max + A.append(sys.maxsize) + for i in range(N+1): + while stk and A[stk[-1]] < A[i]: + mid = stk.pop() + lo = stk[-1] if stk else -1 + # times: [mid, i), (lo, mid] + cnt = (i - mid) * (mid - lo) + sum_max += cnt * A[mid] + stk.append(i) + A.pop() + + sum_min = 0 + stk = [] # monotonically increasing stk for local min + A.append(-sys.maxsize-1) + for i in range(N+1): + while stk and A[stk[-1]] > A[i]: + mid = stk.pop() + lo = stk[-1] if stk else -1 + # times: [mid, i), (lo, mid] + cnt = (i-mid) * (mid - lo) + sum_min += cnt * A[mid] + stk.append(i) + A.pop() + + return sum_max - sum_min diff --git a/212 Word Search II py3.py b/212 Word Search II py3.py new file mode 100644 index 0000000..705d28a --- /dev/null +++ b/212 Word Search II py3.py @@ -0,0 +1,71 @@ +#!/usr/bin/python3 +""" +Given a 2D board and a list of words from the dictionary, find all words in the board. + +Each word must be constructed from letters of sequentially adjacent cell, where "adjacent" cells are those horizontally +or vertically neighboring. The same letter cell may not be used more than once in a word. + +For example, +Given words = ["oath","pea","eat","rain"] and board = + +[ + ['o','a','a','n'], + ['e','t','a','e'], + ['i','h','k','r'], + ['i','f','l','v'] +] +Return ["eat","oath"]. +Note: +You may assume that all inputs are consist of lowercase letters a-z. +""" +from typing import List +from collections import defaultdict + + +dirs = [(0, 1), (0, -1), (-1, 0), (1, 0)] + + +class TrieNode: + def __init__(self): + self.word = None + self.children = defaultdict(TrieNode) + + +class Solution: + def findWords(self, board: List[List[str]], words: List[str]) -> List[str]: + root = self.construct(words) + m, n = len(board), len(board[0]) + visited = [[False for _ in range(n)] for _ in range(m)] + ret = set() + for i in range(m): + for j in range(n): + self.dfs(board, visited, i, j, root, ret) + + return list(ret) + + def dfs(self, board, visited, i, j, cur, ret): + m, n = len(board), len(board[0]) + visited[i][j] = True + c = board[i][j] + if c in cur.children: + nxt = cur.children[c] + if nxt.word is not None: + ret.add(nxt.word) + + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n and not visited[I][J]: + self.dfs(board, visited, I, J, nxt, ret) + + visited[i][j] = False + + def construct(self, words): + root = TrieNode() + for w in words: + cur = root + for c in w: + cur = cur.children[c] + cur.word = w + + return root diff --git a/213 House Robber II.py b/213 House Robber II.py index 33dc1e3..599c601 100644 --- a/213 House Robber II.py +++ b/213 House Robber II.py @@ -15,6 +15,7 @@ class Solution: def rob(self, nums): """ + Two cases: cannot touch 1st element vs. cannot touch 2nd element. There are two cases here 1) 1st element is included and last is not included 2) 1st is not included and last is included. :type nums: list @@ -25,15 +26,15 @@ def rob(self, nums): return sum(nums) # include first but exclude last - dp = [0 for _ in xrange(n-1+2)] + F = [0 for _ in xrange(n-1+2)] for i in xrange(2, n+1): - dp[i] = max(dp[i-1], dp[i-2]+nums[i-2]) - ret = dp[-1] + F[i] = max(F[i-1], F[i-2]+nums[i-2]) + ret = F[-1] # exclude first but include last - dp = [0 for _ in xrange(n-1+2)] + F = [0 for _ in xrange(n-1+2)] for i in xrange(2, n+1): - dp[i] = max(dp[i-1], dp[i-2]+nums[i-1]) + F[i] = max(F[i-1], F[i-2]+nums[i-1]) - ret = max(ret, dp[-1]) + ret = max(ret, F[-1]) return ret diff --git a/216 Combination Sum III.py b/216 Combination Sum III.py index e4601b3..0547efa 100644 --- a/216 Combination Sum III.py +++ b/216 Combination Sum III.py @@ -42,17 +42,18 @@ def dfs(self, remain_k, remain_n, cur, ret): ret.append(list(cur)) return - if remain_k*9 < remain_n or remain_k*1 > remain_n: + # check max and min reach + if remain_k * 9 < remain_n or remain_k * 1 > remain_n: return start = 1 if cur: - start = cur[-1]+1 # unique + start = cur[-1] + 1 # unique for i in xrange(start, 10): cur.append(i) - self.dfs(remain_k-1, remain_n-i, cur, ret) + self.dfs(remain_k - 1, remain_n - i, cur, ret) cur.pop() if __name__ == "__main__": - assert Solution().combinationSum3(3, 9) == [[1, 2, 6], [1, 3, 5], [2, 3, 4]] \ No newline at end of file + assert Solution().combinationSum3(3, 9) == [[1, 2, 6], [1, 3, 5], [2, 3, 4]] diff --git a/218 The Skyline Problem.py b/218 The Skyline Problem.py index 0ae19da..cc269b8 100644 --- a/218 The Skyline Problem.py +++ b/218 The Skyline Problem.py @@ -54,6 +54,8 @@ class Solution: def getSkyline(self, buildings): """ Sweep line + The change of skyline only happens at start and end of buildings. + Treat a building as entering line and leaving line :type buildings: list[list[int]] :rtype: list[list[int]] @@ -65,28 +67,28 @@ def getSkyline(self, buildings): events[left].starts.append(building) # possible multiple building at the same x-coordinate. events[right].ends.append(building) - cur_heap = [] # Heap of buildings currently standing. - cur_max_h = 0 # current max height of standing buildings. + heap_h = [] # Heap of buildings currently standing. + cur_h = 0 # current max height of standing buildings. the current skyline ret = [] # Process events in order by x-coordinate. for x, event in sorted(events.items()): # sort the dictionary by key for building in event.starts: - heapq.heappush(cur_heap, building) + heapq.heappush(heap_h, building) for building in event.ends: building.deleted = True # Pop any finished buildings from the top of the heap. # To avoid using multiset - lazy deletion. - while cur_heap and cur_heap[0].deleted: - heapq.heappop(cur_heap) + while heap_h and heap_h[0].deleted: + heapq.heappop(heap_h) # Top of heap (if any) is the highest standing building, so # its height is the current height of the skyline. - new_h = cur_heap[0].h if cur_heap else 0 + new_h = heap_h[0].h if heap_h else 0 - if new_h != cur_max_h: - cur_max_h = new_h - ret.append([x, cur_max_h]) + if new_h != cur_h: + cur_h = new_h + ret.append([x, cur_h]) return ret diff --git a/2196 Create Binary Tree From Descriptions.py b/2196 Create Binary Tree From Descriptions.py new file mode 100644 index 0000000..0073fad --- /dev/null +++ b/2196 Create Binary Tree From Descriptions.py @@ -0,0 +1,69 @@ +""" +You are given a 2D integer array descriptions where descriptions[i] = [parenti, childi, isLefti] indicates that parenti is the parent of childi in a binary tree of unique values. Furthermore, + +If isLefti == 1, then childi is the left child of parenti. +If isLefti == 0, then childi is the right child of parenti. +Construct the binary tree described by descriptions and return its root. + +The test cases will be generated such that the binary tree is valid. + + + +Example 1: + + +Input: descriptions = [[20,15,1],[20,17,0],[50,20,1],[50,80,0],[80,19,1]] +Output: [50,20,80,15,17,19] +Explanation: The root node is the node with value 50 since it has no parent. +The resulting binary tree is shown in the diagram. +Example 2: + + +Input: descriptions = [[1,2,1],[2,3,0],[3,4,1]] +Output: [1,2,null,null,3,4] +Explanation: The root node is the node with value 1 since it has no parent. +The resulting binary tree is shown in the diagram. + + +Constraints: + +1 <= descriptions.length <= 10^4 +descriptions[i].length == 3 +1 <= parenti, childi <= 10^5 +0 <= isLefti <= 1 +The binary tree described by descriptions is valid. +""" +from collections import defaultdict + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def createBinaryTree(self, descriptions: List[List[int]]) -> Optional[TreeNode]: + """ + Given edges, construct a graph: value -> TreeNode + + How to get a root? Maintain has_parent set + """ + G = defaultdict(TreeNode) + has_parent = set() + for val, child_val, is_left in descriptions: + node = G[val] + node.val = val + child = G[child_val] + child.val = child_val + has_parent.add(child_val) + if is_left: + node.left = child + else: + node.right = child + + for val, node in G.items(): + if val not in has_parent: + return node \ No newline at end of file diff --git a/220 Contains Duplicate III.py b/220 Contains Duplicate III.py index 884b78a..2cc72f8 100644 --- a/220 Contains Duplicate III.py +++ b/220 Contains Duplicate III.py @@ -2,9 +2,10 @@ Given an array of integers, find out whether there are two distinct indices i and j in the array such that the difference between nums[i] and nums[j] is at most t and the difference between i and j is at most k. """ -__author__ = 'Daniel' from collections import OrderedDict +__author__ = 'Daniel' + class Solution: def containsNearbyAlmostDuplicate(self, nums, k, t): diff --git a/224 Basic Calculator py3.py b/224 Basic Calculator py3.py new file mode 100644 index 0000000..74a43a3 --- /dev/null +++ b/224 Basic Calculator py3.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +Implement a basic calculator to evaluate a simple expression string. + +The expression string may contain open ( and closing parentheses ), the plus + +or minus sign -, non-negative integers and empty spaces . + +Example 1: + +Input: "1 + 1" +Output: 2 +Example 2: + +Input: " 2-1 + 2 " +Output: 3 +Example 3: + +Input: "(1+(4+5+2)-3)+(6+8)" +Output: 23 +Note: +You may assume that the given expression is always valid. +Do not use the eval built-in library function. +""" +from typing import List + + +class Solution: + def calculate(self, s: str) -> int: + """ + 1. treat +/- as unary operator + 2. maintain stk of operands to sum + 3. handle bracket recursively + """ + ret, _ = self.eval(s + "\0", 0, []) + return ret + + def eval(self, s: str, start: int, stk: List[int]) -> int: + prev_op = "+" + operand = 0 + i = start + while i < len(s): # not using for-loop, since the cursor needs to advance in recursion + if s[i] == " ": + pass + elif s[i].isdigit(): + operand = operand * 10 + int(s[i]) + elif s[i] in ("+", "-", ")", "\0"): # delimited + if prev_op == "+": + stk.append(operand) + elif prev_op == "-": + stk.append(-operand) + + if s[i] in ("+", "-"): + operand = 0 + prev_op = s[i] + elif s[i] in (")", "\0"): + return sum(stk), i + elif s[i] == "(": + # avoid setting operand to 0 + operand, i = self.eval(s, i + 1, []) + else: + raise + + i += 1 + + +if __name__ == "__main__": + assert Solution().calculate("(1+(4+5+2)-3)+(6+8)") == 23 diff --git a/224 Basic Calculator.py b/224 Basic Calculator.py index 31303e0..3169fe4 100644 --- a/224 Basic Calculator.py +++ b/224 Basic Calculator.py @@ -91,6 +91,7 @@ def eval_postfix(self, post): assert len(stk) == 1 return int(stk[-1]) + if __name__ == "__main__": assert Solution().calculate(" 2-1 + 2 ") == 3 assert Solution().calculate("(1+(4+5+2)-3)+(6+8)") == 23 \ No newline at end of file diff --git a/2265 Count Nodes Equal to Average of Subtree.py b/2265 Count Nodes Equal to Average of Subtree.py new file mode 100644 index 0000000..7a90f1e --- /dev/null +++ b/2265 Count Nodes Equal to Average of Subtree.py @@ -0,0 +1,65 @@ +""" +Given the root of a binary tree, return the number of nodes where the value of the node is equal to the average of the values in its subtree. + +Note: + +The average of n elements is the sum of the n elements divided by n and rounded down to the nearest integer. +A subtree of root is a tree consisting of root and all of its descendants. + + +Example 1: + + +Input: root = [4,8,5,0,1,null,6] +Output: 5 +Explanation: +For the node with value 4: The average of its subtree is (4 + 8 + 5 + 0 + 1 + 6) / 6 = 24 / 6 = 4. +For the node with value 5: The average of its subtree is (5 + 6) / 2 = 11 / 2 = 5. +For the node with value 0: The average of its subtree is 0 / 1 = 0. +For the node with value 1: The average of its subtree is 1 / 1 = 1. +For the node with value 6: The average of its subtree is 6 / 1 = 6. +Example 2: + + +Input: root = [1] +Output: 1 +Explanation: For the node with value 1: The average of its subtree is 1 / 1 = 1. + + +Constraints: + +The number of nodes in the tree is in the range [1, 1000]. +0 <= Node.val <= 1000 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def averageOfSubtree(self, root: TreeNode) -> int: + """ + sum and count + """ + self.ret = 0 + self.dfs(root) + return self.ret + + def dfs(self, node): + if not node: + return 0, 0 + + s = node.val + c = 1 + + ls, lc = self.dfs(node.left) + rs, rc = self.dfs(node.right) + s += ls + rs + c += lc + rc + if s // c == node.val: + self.ret += 1 + + return s, c \ No newline at end of file diff --git a/227 Basic Calculator II py3.py b/227 Basic Calculator II py3.py new file mode 100644 index 0000000..983437f --- /dev/null +++ b/227 Basic Calculator II py3.py @@ -0,0 +1,89 @@ +#!/usr/bin/python3 +""" +Implement a basic calculator to evaluate a simple expression string. + +The expression string contains only non-negative integers, +, -, *, / operators +and empty spaces . The integer division should truncate toward zero. + +Example 1: + +Input: "3+2*2" +Output: 7 +Example 2: + +Input: " 3/2 " +Output: 1 +Example 3: + +Input: " 3+5 / 2 " +Output: 5 +Note: + +You may assume that the given expression is always valid. +Do not use the eval built-in library function. +""" + + +class Solution: + def calculate(self, s: str) -> int: + """ + No brackets. Look at previous operand and operator, when finishing + scanning current operand. + """ + operand = 0 + stk = [] + prev_op = "+" + for i, c in enumerate(s): + if c.isdigit(): + operand = operand * 10 + int(c) + + # i == len(s) - 1 + delimited = c in ("+", "-", "*", "/") or i == len(s) - 1 + if delimited: + if prev_op == "+": + cur = operand + elif prev_op == "-": + cur = -operand + elif prev_op == "*": + cur = stk.pop() * operand + else: + assert prev_op == "/" + # instead of op1 // op2 due to negative handling, -3 // 2 == -2 + cur = int(stk.pop() / operand) + + stk.append(cur) + prev_op = c + operand = 0 + + return sum(stk) + + def calculate_error(self, s: str) -> int: + """ + cannot use dictionary, since it is eager evaluation + """ + operand = 0 + stk = [] + prev_op = "+" + for i, c in enumerate(s): + if c.isdigit(): + operand = operand * 10 + int(c) + + # i == len(s) - 1 + delimited = c in ("+", "-", "*", "/") or i == len(s) - 1 + if delimited: + cur = { + "+": operand, + "-": -operand, + "*": stk.pop() * operand, + "/": int(stk.pop() / operand), # instead of op1 // op2 due to negative handling, -3 // 2 == -2 + }[prev_op] + stk.append(cur) + + prev_op = c + operand = 0 + + return sum(stk) + + +if __name__ == "__main__": + assert Solution().calculate("3+2*2") == 7 diff --git a/227 Basic Calculator II.py b/227 Basic Calculator II.py index d8185ea..699a297 100644 --- a/227 Basic Calculator II.py +++ b/227 Basic Calculator II.py @@ -23,11 +23,14 @@ def calculate(self, s): :type s: str :rtype: int """ - lst = self.to_list(s) + lst = self.parse(s) post = self.infix2postfix(lst) return self.eval_postfix(post) - def to_list(self, s): + def parse(self, s): + """ + return tokens + """ i = 0 ret = [] while i < len(s): @@ -47,7 +50,8 @@ def to_list(self, s): return ret def infix2postfix(self, lst): - stk = [] # store operators in strictly increasing precedence + # operator stacks rather than operand + stk = [] # stk only stores operators in strictly increasing precedence ret = [] for elt in lst: if elt.isdigit(): @@ -100,4 +104,4 @@ def eval_postfix(self, post): if __name__ == "__main__": - assert Solution().calculate("3+2*2") == 7 \ No newline at end of file + assert Solution().calculate("3+2*2") == 7 diff --git a/2289 Steps to Make Array Non-decreasing.py b/2289 Steps to Make Array Non-decreasing.py new file mode 100644 index 0000000..2a7641e --- /dev/null +++ b/2289 Steps to Make Array Non-decreasing.py @@ -0,0 +1,108 @@ +""" +You are given a 0-indexed integer array nums. In one step, remove all elements nums[i] where nums[i - 1] > nums[i] for all 0 < i < nums.length. + +Return the number of steps performed until nums becomes a non-decreasing array. + + + +Example 1: + +Input: nums = [5,3,4,4,7,3,6,11,8,5,11] +Output: 3 +Explanation: The following are the steps performed: +- Step 1: [5,3,4,4,7,3,6,11,8,5,11] becomes [5,4,4,7,6,11,11] +- Step 2: [5,4,4,7,6,11,11] becomes [5,4,7,11,11] +- Step 3: [5,4,7,11,11] becomes [5,7,11,11] +[5,7,11,11] is a non-decreasing array. Therefore, we return 3. +Example 2: + +Input: nums = [4,5,7,7,13] +Output: 0 +Explanation: nums is already a non-decreasing array. Therefore, we return 0. + + +Constraints: + +1 <= nums.length <= 10^5 +1 <= nums[i] <= 10^9 +""" +class Solution: + def totalSteps_error(self, A: List[int]) -> int: + """ + use a stack + remove A[i] when A[i-1] > A[i] + it becomes A[lo] < A[i] + Keep a monotonically increasing stack + """ + maxa = 0 + stk = [] # asc stack + cur = 0 + for a in A: + if stk and stk[-1] > a: + cur += 1 + continue + + stk.append(a) + maxa = max(maxa, cur) + cur = 0 + + maxa = max(maxa, cur) + return maxa + + def totalSteps_error(self, A: List[int]) -> int: + """ + How to count the steps? + Find the next larger on the left + """ + N = len(A) + # next larger on the left + L = [i for i in range(N)] + # pending element has yet to find the larger + # scanning from right to left + stk = [] # monotoicallycall decreasing + for i in range(N-1, -1, -1): + while stk and A[stk[-1]] < A[i]: + mid = stk.pop() + L[mid] = i + stk.append(i) + + maxa = 0 + for i, v in enumerate(L): + maxa = max(maxa, i - v) + + return maxa + + def totalSteps(self, A: List[int]) -> int: + """ + How to count the steps? + Find the next larger on the left? + + Requrie DP + Let F[i] be the number of steps A[i] can remove item + + When A[i] is removing A[j] when j > i and A[i] > A[j] + F[i] += 1 + remaining = F[pi] - F[i] + if remaining > 0: + F[i] += remaining + essentially, F[i] = max(F[i], F[j]) + + Example: [14, 13, 2, 6, 13] + """ + N = len(A) + F = [0 for _ in range(N)] + # To find the next larger item + # Store the pending element has yet not find next larger + # monotonically decreasing + stk = [] + for i in range(N-1, -1, -1): + while stk and A[stk[-1]] < A[i]: + pi = stk.pop() + F[i] += 1 + remaining = F[pi] - F[i] + if remaining > 0: + F[i] += remaining + # F[i] = max(F[i], F[pi]) + stk.append(i) + + return max(F) diff --git a/233 Number of Digit One.py b/233 Number of Digit One.py index ed0dae4..2aa9f67 100644 --- a/233 Number of Digit One.py +++ b/233 Number of Digit One.py @@ -11,6 +11,10 @@ class Solution: def countDigitOne(self, n): """ + Count the 1 occurrences at the digit i, due to: + 1. the digits higher than the currently counting digits + 2. the digits lower than the currently counting digits + Divide the question into smaller parts, count appearance at 1LSD, 2LSD, 3LSD respectively. :type n: int :rtype: int @@ -36,4 +40,4 @@ def countDigitOne(self, n): sig = temp - return cnt \ No newline at end of file + return cnt diff --git a/234 Palindrome Linked List.py b/234 Palindrome Linked List.py index 58f581e..44c4fed 100644 --- a/234 Palindrome Linked List.py +++ b/234 Palindrome Linked List.py @@ -18,7 +18,7 @@ def isPalindrome(self, head): """ Algorithms: 1. put into array O(N) - 2. midpoint, reverse the other + 2. midpoint, reverse the other - O(n) time and O(1) space :type head: ListNode :rtype: bool @@ -68,4 +68,4 @@ def reverse(self, head): cur.next = pre pre, cur = cur, nxt if head: head.next = None - return pre \ No newline at end of file + return pre diff --git a/2342 Max Sum of a Pair With Equal Sum of Digits.py b/2342 Max Sum of a Pair With Equal Sum of Digits.py new file mode 100644 index 0000000..19a87ae --- /dev/null +++ b/2342 Max Sum of a Pair With Equal Sum of Digits.py @@ -0,0 +1,55 @@ +""" +You are given a 0-indexed array nums consisting of positive integers. You can choose two indices i and j, such that i != j, and the sum of digits of the number nums[i] is equal to that of nums[j]. + +Return the maximum value of nums[i] + nums[j] that you can obtain over all possible indices i and j that satisfy the conditions. + + + +Example 1: + +Input: nums = [18,43,36,13,7] +Output: 54 +Explanation: The pairs (i, j) that satisfy the conditions are: +- (0, 2), both numbers have a sum of digits equal to 9, and their sum is 18 + 36 = 54. +- (1, 4), both numbers have a sum of digits equal to 7, and their sum is 43 + 7 = 50. +So the maximum sum that we can obtain is 54. +Example 2: + +Input: nums = [10,12,19,14] +Output: -1 +Explanation: There are no two numbers that satisfy the conditions, so we return -1. + + +Constraints: + +1 <= nums.length <= 10^5 +1 <= nums[i] <= 10^9 +""" +from collections import defaultdict + + +class Solution: + def maximumSum(self, nums: List[int]) -> int: + """ + hash map to maintain the maximum two numbers + """ + hm = defaultdict(list) + for n in nums: + # digit sum + s = 0 + cur = n + while cur > 0: + s += cur % 10 + cur //= 10 + if len(hm[s]) < 2: + hm[s].append(n) + else: + if n > min(hm[s]): + hm[s] = [max(hm[s]), n] + + maxa = -1 + for lst in hm.values(): + if len(lst) == 2: + maxa = max(maxa, sum(lst)) + + return maxa diff --git a/235 Lowest Common Ancestor of a Binary Search Tree py3.py b/235 Lowest Common Ancestor of a Binary Search Tree py3.py new file mode 100644 index 0000000..a00607d --- /dev/null +++ b/235 Lowest Common Ancestor of a Binary Search Tree py3.py @@ -0,0 +1,51 @@ +#!/usr/bin/python3 +""" +Given a binary search tree (BST), find the lowest common ancestor (LCA) of two +given nodes in the BST. + +According to the definition of LCA on Wikipedia: “The lowest common ancestor is +defined between two nodes p and q as the lowest node in T that has both p and q +as descendants (where we allow a node to be a descendant of itself).” + +Given binary search tree: root = [6,2,8,0,4,7,9,null,null,3,5] + + + + +Example 1: + +Input: root = [6,2,8,0,4,7,9,null,null,3,5], p = 2, q = 8 +Output: 6 +Explanation: The LCA of nodes 2 and 8 is 6. +Example 2: + +Input: root = [6,2,8,0,4,7,9,null,null,3,5], p = 2, q = 4 +Output: 2 +Explanation: The LCA of nodes 2 and 4 is 2, since a node can be a descendant of +itself according to the LCA definition. + +Note: + +All of the nodes' values will be unique. +p and q are different and both values will exist in the BST. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def lowestCommonAncestor(self, root: TreeNode, p: TreeNode, q: TreeNode) -> TreeNode: + return self.walk(root, p, q) + + def walk(self, node, p, q): + if p.val > node.val and q.val > node.val: + return self.walk(node.right, p, q) + if p.val < node.val and q.val < node.val: + return self.walk(node.left, p, q) + return node diff --git a/236 Lowest Common Ancestor of a Binary Tree py3.py b/236 Lowest Common Ancestor of a Binary Tree py3.py new file mode 100644 index 0000000..d0a0f32 --- /dev/null +++ b/236 Lowest Common Ancestor of a Binary Tree py3.py @@ -0,0 +1,60 @@ +#!/usr/bin/python3 +""" +Given a binary tree, find the lowest common ancestor (LCA) of two given nodes +in the tree. + +According to the definition of LCA on Wikipedia: “The lowest common ancestor is +defined between two nodes p and q as the lowest node in T that has both p and q +as descendants (where we allow a node to be a descendant of itself).” + +Given the following binary tree: root = [3,5,1,6,2,0,8,null,null,7,4] + + + + +Example 1: + +Input: root = [3,5,1,6,2,0,8,null,null,7,4], p = 5, q = 1 +Output: 3 +Explanation: The LCA of nodes 5 and 1 is 3. +Example 2: + +Input: root = [3,5,1,6,2,0,8,null,null,7,4], p = 5, q = 4 +Output: 5 +Explanation: The LCA of nodes 5 and 4 is 5, since a node can be a descendant of +itself according to the LCA definition. + +Note: + +All of the nodes' values will be unique. +p and q are different and both values will exist in the binary tree. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.ans = None + + def lowestCommonAncestor(self, root: TreeNode, p: TreeNode, q: TreeNode) -> TreeNode: + self.count(root, p, q) + return self.ans + + def count(self, node, p, q): + if not node: + return 0 + + lcount = self.count(node.left, p, q) + rcount = self.count(node.right, p, q) + mcount = 1 if node == p or node == q else 0 + ret = lcount + rcount + mcount + if lcount == 1 and rcount == 1 or lcount == 1 and mcount == 1 or rcount == 1 and mcount == 1: + self.ans = node + return ret diff --git a/2368 Reachable Nodes With Restrictions.py b/2368 Reachable Nodes With Restrictions.py new file mode 100644 index 0000000..62bcf47 --- /dev/null +++ b/2368 Reachable Nodes With Restrictions.py @@ -0,0 +1,64 @@ +""" +There is an undirected tree with n nodes labeled from 0 to n - 1 and n - 1 edges. + +You are given a 2D integer array edges of length n - 1 where edges[i] = [ai, bi] indicates that there is an edge between nodes ai and bi in the tree. You are also given an integer array restricted which represents restricted nodes. + +Return the maximum number of nodes you can reach from node 0 without visiting a restricted node. + +Note that node 0 will not be a restricted node. + + + +Example 1: + + +Input: n = 7, edges = [[0,1],[1,2],[3,1],[4,0],[0,5],[5,6]], restricted = [4,5] +Output: 4 +Explanation: The diagram above shows the tree. +We have that [0,1,2,3] are the only nodes that can be reached from node 0 without visiting a restricted node. +Example 2: + + +Input: n = 7, edges = [[0,1],[0,2],[0,5],[0,4],[3,2],[6,5]], restricted = [4,2,1] +Output: 3 +Explanation: The diagram above shows the tree. +We have that [0,5,6] are the only nodes that can be reached from node 0 without visiting a restricted node. + + +Constraints: + +2 <= n <= 10^5 +edges.length == n - 1 +edges[i].length == 2 +0 <= ai, bi < n +ai != bi +edges represents a valid tree. +1 <= restricted.length < n +1 <= restricted[i] < n +All the values of restricted are unique. +""" +from collections import defaultdict + + +class Solution: + def reachableNodes(self, n: int, edges: List[List[int]], restricted: List[int]) -> int: + """ + Just DFS + """ + self.res = set(restricted) + G = defaultdict(list) + for u, v in edges: + G[u].append(v) + G[v].append(u) + + self.ret = 0 + self.dfs(G, 0, defaultdict(bool)) + return self.ret + + def dfs(self, G, cur, visited): + visited[cur] = True + self.ret += 1 + for nbr in G[cur]: + if nbr not in self.res and not visited[nbr]: + self.dfs(G, nbr, visited) + diff --git a/2385 Amount of Time for Binary Tree to Be Infected.py b/2385 Amount of Time for Binary Tree to Be Infected.py new file mode 100644 index 0000000..73830d9 --- /dev/null +++ b/2385 Amount of Time for Binary Tree to Be Infected.py @@ -0,0 +1,63 @@ +""" +You are given the root of a binary tree with unique values, and an integer start. At minute 0, an infection starts from the node with value start. + +Each minute, a node becomes infected if: + +The node is currently uninfected. +The node is adjacent to an infected node. +Return the number of minutes needed for the entire tree to be infected. + + + +Example 1: + + +Input: root = [1,5,3,null,4,10,6,9,2], start = 3 +Output: 4 +Explanation: The following nodes are infected during: +- Minute 0: Node 3 +- Minute 1: Nodes 1, 10 and 6 +- Minute 2: Node 5 +- Minute 3: Node 4 +- Minute 4: Nodes 9 and 2 +It takes 4 minutes for the whole tree to be infected so we return 4. +Example 2: + + +Input: root = [1], start = 1 +Output: 0 +Explanation: At minute 0, the only node in the tree is infected so we return 0. + + +Constraints: + +The number of nodes in the tree is in the range [1, 10^5]. +1 <= Node.val <= 10^5 +Each node has a unique value. +A node with a value of start exists in the tree. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def amountOfTime(self, root: Optional[TreeNode], start: int) -> int: + """ + convert to Graph then BFS + + One-pass DFS + * If root is the start => get depth from left and right subtree + * If start is on one (e.g. left) side of the root => depth to the start + right depth + """ + self.maxa = 0 + self.start = start + self.dfs(root) + return self.maxa + + + + \ No newline at end of file diff --git a/239 Sliding Window Maximum.py b/239 Sliding Window Maximum.py index db2e044..0fd2bf8 100644 --- a/239 Sliding Window Maximum.py +++ b/239 Sliding Window Maximum.py @@ -1,6 +1,6 @@ # -*- coding: utf-8 -*- """ -Given an array nums, there is a sliding window of size k which is moving from the very left of the array to the very +Given an array nums, there is a sliding window of size k which is moving from the very left of the array to the very right. You can only see the k numbers in the window. Each time the sliding window moves right by one position. For example, @@ -16,7 +16,7 @@ 1 3 -1 -3 5 [3 6 7] 7 Therefore, return the max sliding window as [3,3,5,5,6,7]. -Note: +Note: You may assume k is always valid, ie: 1 ≤ k ≤ input array's size for non-empty array. Follow up: @@ -32,6 +32,13 @@ def maxSlidingWindow(self, nums, k): 1. brute force 2. heap with lazy deletion 3. queue + + In the double-ended queue algorithm, you need to assign the queue with a meaning, in a way that you can + access the window's max in O(1). + + Invariant: the queue is storing non-decreasing-ordered elements of current window. + + The queue stores the index rather than element :type nums: list[] :type k: int :rtype: list[] @@ -49,9 +56,3 @@ def maxSlidingWindow(self, nums, k): ret.append(nums[q[0]]) return ret - - - - - - diff --git a/240 Search a 2D Matrix II.py b/240 Search a 2D Matrix II.py index a1f2503..fc32e73 100644 --- a/240 Search a 2D Matrix II.py +++ b/240 Search a 2D Matrix II.py @@ -21,32 +21,64 @@ __author__ = 'Daniel' -class Solution: - def searchMatrix(self, matrix, target): +class Solution(object): + def searchMatrix(self, mat, target): """ + Manhattan work + O(m+n) eliminate a row or a column at a time + Practically: 112 ms - :type matrix: list[int][int] + :type mat: list[int][int] :type target: int :rtype: bool """ - try: - m = len(matrix) - n = len(matrix[0]) - - lst = [matrix[i][0] for i in xrange(m)] - row_by_first = self.bisect(lst, target) - lst = [matrix[i][-1] for i in xrange(m)] - row_by_last = self.bisect(lst, target, False) - for i in range(row_by_first, row_by_last-1, -1): - col = self.bisect(matrix[i], target) - if matrix[i][col] == target: - return True - - return False - except IndexError: - return False - - def bisect(self, A, t, lower=True): + m = len(mat) + n = len(mat[0]) + + i = 0 + j = n-1 + while i < m and 0 <= j: + if mat[i][j] == target: + return True + elif mat[i][j] > target: + j -= 1 + else: + i += 1 + + return False + + +class SolutionBinSearch(object): + def searchMatrix(self, mat, target): + """ + Binary search + + Multiple round of binary search + possible to swap m and n, depends on the size + O(m log n) or O(n log m) + Practically: 204 ms + + :type mat: list[int][int] + :type target: int + :rtype: bool + """ + m = len(mat) + n = len(mat[0]) + + col = [mat[i][0] for i in xrange(m)] + row_by_first = self.bin_search(col, target) + + col = [mat[i][-1] for i in xrange(m)] + row_by_last = self.bin_search(col, target, False) + + for i in range(row_by_first, row_by_last-1, -1): + col = self.bin_search(mat[i], target) + if mat[i][col] == target: + return True + + return False + + def bin_search(self, A, t, lower=True): lo = 0 hi = len(A) while lo < hi: @@ -57,10 +89,12 @@ def bisect(self, A, t, lower=True): lo = mid+1 else: hi = mid + if lower: return lo-1 else: return lo if __name__ == "__main__": - assert Solution().searchMatrix([[1, 4], [2, 5]], 4) == True \ No newline at end of file + assert Solution().searchMatrix([[1, 4], [2, 5]], 4) == True + assert SolutionBinSearch().searchMatrix([[1, 4], [2, 5]], 4) == True diff --git a/241 Different Ways to Add Parentheses.py b/241 Different Ways to Add Parentheses.py index 836943e..6e2ba0f 100644 --- a/241 Different Ways to Add Parentheses.py +++ b/241 Different Ways to Add Parentheses.py @@ -29,6 +29,7 @@ class Solution: def diffWaysToCompute(self, input): """ + Looping + Divide & Conquer :type: input :rtype: list[] @@ -63,4 +64,4 @@ def _eval(self, a, b, op): if __name__ == "__main__": - assert Solution().diffWaysToCompute("1+1") == [2] \ No newline at end of file + assert Solution().diffWaysToCompute("1+1") == [2] diff --git a/2415 Reverse Odd Levels of Binary Tree.py b/2415 Reverse Odd Levels of Binary Tree.py new file mode 100644 index 0000000..b5b4abb --- /dev/null +++ b/2415 Reverse Odd Levels of Binary Tree.py @@ -0,0 +1,96 @@ +""" +Given the root of a perfect binary tree, reverse the node values at each odd level of the tree. + +For example, suppose the node values at level 3 are [2,1,3,4,7,11,29,18], then it should become [18,29,11,7,4,3,1,2]. +Return the root of the reversed tree. + +A binary tree is perfect if all parent nodes have two children and all leaves are on the same level. + +The level of a node is the number of edges along the path between it and the root node. + + + +Example 1: + + +Input: root = [2,3,5,8,13,21,34] +Output: [2,5,3,8,13,21,34] +Explanation: +The tree has only one odd level. +The nodes at level 1 are 3, 5 respectively, which are reversed and become 5, 3. +Example 2: + + +Input: root = [7,13,11] +Output: [7,11,13] +Explanation: +The nodes at level 1 are 13, 11, which are reversed and become 11, 13. +Example 3: + +Input: root = [0,1,2,0,0,0,0,1,1,1,1,2,2,2,2] +Output: [0,2,1,0,0,0,0,2,2,2,2,1,1,1,1] +Explanation: +The odd levels have non-zero values. +The nodes at level 1 were 1, 2, and are 2, 1 after the reversal. +The nodes at level 3 were 1, 1, 1, 1, 2, 2, 2, 2, and are 2, 2, 2, 2, 1, 1, 1, 1 after the reversal. + + +Constraints: + +The number of nodes in the tree is in the range [1, 2^14]. +0 <= Node.val <= 105 +root is a perfect binary tree. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class SolutionBFS: + def reverseOddLevels(self, root: Optional[TreeNode]) -> Optional[TreeNode]: + """ + BFS + just swap the value + """ + q = [root] + l = 0 + while q: + new_q = [] + for node in q: + if node.left: + new_q.append(node.left) + if node.right: + new_q.append(node.right) + + if l % 2 == 1: + vals = [node.val for node in q] + for node, val in zip(q, vals[::-1]): + node.val = val + + q = new_q + l += 1 + + return root + + +class Solution: + def reverseOddLevels(self, root: Optional[TreeNode]) -> Optional[TreeNode]: + """ + swap left's left with right's right + swap left's right with right's left + """ + self.dfs(root.left, root.right, 1) + return root + + def dfs(self, left, right, l): + if not left or not right: + return + + if l % 2 == 1: + left.val, right.val = right.val, left.val + + self.dfs(left.left, right.right, l + 1) + self.dfs(left.right, right.left, l + 1) \ No newline at end of file diff --git a/244 Shortest Word Distance II.py b/244 Shortest Word Distance II.py index d9662fa..d65e3e9 100644 --- a/244 Shortest Word Distance II.py +++ b/244 Shortest Word Distance II.py @@ -8,9 +8,7 @@ __author__ = 'Daniel' -class WordDistance: - # - # @param {string[]} words +class WordDistance(object): def __init__(self, words): """ initialize your data structure here. @@ -36,4 +34,4 @@ def shortest(self, word1, word2): if 0 <= idx+nei < len(self.word_dict[word2]): mini = min(mini, abs(i-self.word_dict[word2][idx+nei])) - return mini \ No newline at end of file + return mini diff --git a/245 Shortest Word Distance III.py b/245 Shortest Word Distance III.py index e854555..f39cd72 100644 --- a/245 Shortest Word Distance III.py +++ b/245 Shortest Word Distance III.py @@ -7,7 +7,7 @@ __author__ = 'Daniel' -class Solution: +class Solution(object): def shortestWordDistance(self, words, word1, word2): """ :type words: list[str] @@ -24,4 +24,4 @@ def shortestWordDistance(self, words, word1, word2): if 0 <= idx+nei < len(pos_lst2) and pos != pos_lst2[idx+nei]: mini = min(mini, abs(pos-pos_lst2[idx+nei])) - return mini \ No newline at end of file + return mini diff --git a/246 Strobogrammatic Number.py b/246 Strobogrammatic Number.py index dcd5143..11119d2 100644 --- a/246 Strobogrammatic Number.py +++ b/246 Strobogrammatic Number.py @@ -1,5 +1,7 @@ """ Premium Question +Checking Strobogrammatic +https://leetcode.com/problems/strobogrammatic-number/ """ __author__ = 'Daniel' @@ -14,15 +16,21 @@ def __init__(self): "0": "0" } - def isStrobogrammatic(self, num): + for i in xrange(len(num)/2+1): + if num[i] not in self.map or self.map[num[i]] != num[len(num)-1-i]: + return False + + return True + + def isStrobogrammatic_tedious(self, num): """ :type num: str :rtype: bool """ num = list(num) - rev = [] + rev = [] # reverse for digit in reversed(num): try: rev.append(self.map[digit]) diff --git a/2467 Most Profitable Path in a Tree.py b/2467 Most Profitable Path in a Tree.py new file mode 100644 index 0000000..74b9d10 --- /dev/null +++ b/2467 Most Profitable Path in a Tree.py @@ -0,0 +1,120 @@ +""" +There is an undirected tree with n nodes labeled from 0 to n - 1, rooted at node 0. You are given a 2D integer array edges of length n - 1 where edges[i] = [ai, bi] indicates that there is an edge between nodes ai and bi in the tree. + +At every node i, there is a gate. You are also given an array of even integers amount, where amount[i] represents: + +the price needed to open the gate at node i, if amount[i] is negative, or, +the cash reward obtained on opening the gate at node i, otherwise. +The game goes on as follows: + +Initially, Alice is at node 0 and Bob is at node bob. +At every second, Alice and Bob each move to an adjacent node. Alice moves towards some leaf node, while Bob moves towards node 0. +For every node along their path, Alice and Bob either spend money to open the gate at that node, or accept the reward. Note that: +If the gate is already open, no price will be required, nor will there be any cash reward. +If Alice and Bob reach the node simultaneously, they share the price/reward for opening the gate there. In other words, if the price to open the gate is c, then both Alice and Bob pay c / 2 each. Similarly, if the reward at the gate is c, both of them receive c / 2 each. +If Alice reaches a leaf node, she stops moving. Similarly, if Bob reaches node 0, he stops moving. Note that these events are independent of each other. +Return the maximum net income Alice can have if she travels towards the optimal leaf node. + + + +Example 1: + + +Input: edges = [[0,1],[1,2],[1,3],[3,4]], bob = 3, amount = [-2,4,2,-4,6] +Output: 6 +Explanation: +The above diagram represents the given tree. The game goes as follows: +- Alice is initially on node 0, Bob on node 3. They open the gates of their respective nodes. + Alice's net income is now -2. +- Both Alice and Bob move to node 1. + Since they reach here simultaneously, they open the gate together and share the reward. + Alice's net income becomes -2 + (4 / 2) = 0. +- Alice moves on to node 3. Since Bob already opened its gate, Alice's income remains unchanged. + Bob moves on to node 0, and stops moving. +- Alice moves on to node 4 and opens the gate there. Her net income becomes 0 + 6 = 6. +Now, neither Alice nor Bob can make any further moves, and the game ends. +It is not possible for Alice to get a higher net income. +Example 2: + + +Input: edges = [[0,1]], bob = 1, amount = [-7280,2350] +Output: -7280 +Explanation: +Alice follows the path 0->1 whereas Bob follows the path 1->0. +Thus, Alice opens the gate at node 0 only. Hence, her net income is -7280. + + +Constraints: + +2 <= n <= 10^5 +edges.length == n - 1 +edges[i].length == 2 +0 <= ai, bi < n +ai != bi +edges represents a valid tree. +1 <= bob < n +amount.length == n +amount[i] is an even integer in the range [-10^4, 10^4]. +""" +from collections import defaultdict +import sys + + +class Solution: + def mostProfitablePath(self, edges: List[List[int]], bob: int, amount: List[int]) -> int: + """ + Some dp involved? + Alice DFS all leaves + Bob only have one path, towards 0. BFS + BFS, remeber the pi node + DFS is also okay + count step -> then now we know the reward of alice + """ + G = defaultdict(list) + for a, b in edges: + G[a].append(b) + G[b].append(a) + + self.depths = defaultdict(int) + self.pi = defaultdict(int) + self.dfs_bob(G, bob, -1, 0, defaultdict(bool)) + # bob's path + self.path = set() + cur = 0 + while cur != -1: + self.path.add(cur) + cur = self.pi[cur] + + self.maxa = -sys.maxsize-1 + self.amounts = amount + self.dfs_alice(G, 0, 0, 0, defaultdict(bool)) + return self.maxa + + def dfs_alice(self, G, cur, reward, depth, visited): + visited[cur] = True + if cur not in self.path: + reward += self.amounts[cur] + else: + if depth < self.depths[cur]: + reward += self.amounts[cur] + elif depth == self.depths[cur]: + reward += self.amounts[cur] // 2 + else: + # already open + pass + + # leaf node + if len(G[cur]) == 1 and visited[G[cur][0]]: + self.maxa = max(self.maxa, reward) + + for nbr in G[cur]: + if not visited[nbr]: + self.dfs_alice(G, nbr, reward, depth+1, visited) + + def dfs_bob(self, G, cur, prev, depth, visited): + visited[cur] = True + self.depths[cur] = depth + self.pi[cur] = prev + for nbr in G[cur]: + if not visited[nbr]: + self.dfs_bob(G, nbr, cur, depth+1, visited) diff --git a/247 Strobogrammatic Number II.py b/247 Strobogrammatic Number II.py new file mode 100644 index 0000000..4651f11 --- /dev/null +++ b/247 Strobogrammatic Number II.py @@ -0,0 +1,125 @@ +""" +Premium Question +Generation +https://leetcode.com/problems/strobogrammatic-number-ii/ +""" +from collections import deque +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.lst = ["11", "69", "88", "96", "00"] # use list rather than map since no need to look up + self.middle = ["0", "1", "8"] + + def findStrobogrammatic(self, n): + ret = [] + self.build(n, deque(), ret) + return ret + + def build(self, n, cur, ret): + """ + build from inside + """ + if n%2 == 1 and len(cur) == 0: + for elt in self.middle: + cur.append(elt) + self.build(n, cur, ret) + cur.pop() + else: + if len(cur) == n: + ret.append("".join(cur)) + return + for elt in self.lst: + if not (elt == "00" and len(cur) == n-2): + cur.appendleft(elt[0]) + cur.append(elt[1]) + self.build(n, cur, ret) + cur.pop() + cur.popleft() + + +class SolutionArray(object): + def __init__(self): + self.map1 = ["11", "69", "88", "96", "00"] + + def findStrobogrammatic(self, n): + """ + :type n: int + :rtype: List[str] + """ + ret = [] + self.build(n, [], ret) + return ret + + def build(self, n, cur, ret): + """ + Using list as double-entry queue, performance of every operation is O(n) rather than O(1) + """ + if n%2 == 1 and len(cur) == 0: + for i in ["0", "1", "8"]: + cur.append(i) + self.build(n, cur, ret) + cur.pop() + return + + if len(cur)/2 == n/2: + ret.append("".join(cur)) + return + + for elt in self.map1: + if elt != "00" or len(cur) != n-2: + cur.insert(0, elt[0]) + cur.append(elt[1]) + self.build(n, cur, ret) + cur.pop() + cur.pop(0) + + +class SolutionOutputLimitExceeded(object): + def __init__(self): + self.map = { + "1": "1", + "6": "9", + "9": "6", + "8": "8", + "0": "0" + } + self.middle = ["1", "8", "0"] + + def findStrobogrammatic(self, n): + """ + :type n: int + :rtype: List[str] + """ + ret = [] + self.build(0, n, [], ret) + return ret + + def build(self, idx, n, cur, ret): + if idx == n/2: + if n % 2 != 0: + for m in self.middle: + if m != "0" or idx != 0: + temp = list(cur) + temp.append(m) + for i in xrange(idx-1, -1, -1): + temp.append(self.map[temp[i]]) + ret.append("".join(temp)) + else: + temp = list(cur) + for i in xrange(idx-1, -1, -1): + temp.append(self.map[temp[i]]) + ret.append("".join(temp)) + + return + + for k in self.map.keys(): + if k != "0" or idx != 0: + cur.append(k) + self.build(idx+1, n, cur, ret) + cur.pop() + + +if __name__ == "__main__": + assert Solution().findStrobogrammatic(3) == ['101', '609', '808', '906', '111', '619', '818', '916', '181', '689', '888', '986'] \ No newline at end of file diff --git a/2471 Minimum Number of Operations to Sort a Binary Tree by Level.py b/2471 Minimum Number of Operations to Sort a Binary Tree by Level.py new file mode 100644 index 0000000..9934994 --- /dev/null +++ b/2471 Minimum Number of Operations to Sort a Binary Tree by Level.py @@ -0,0 +1,95 @@ +""" +You are given the root of a binary tree with unique values. + +In one operation, you can choose any two nodes at the same level and swap their values. + +Return the minimum number of operations needed to make the values at each level sorted in a strictly increasing order. + +The level of a node is the number of edges along the path between it and the root node. + + + +Example 1: + + +Input: root = [1,4,3,7,6,8,5,null,null,null,null,9,null,10] +Output: 3 +Explanation: +- Swap 4 and 3. The 2nd level becomes [3,4]. +- Swap 7 and 5. The 3rd level becomes [5,6,8,7]. +- Swap 8 and 7. The 3rd level becomes [5,6,7,8]. +We used 3 operations so return 3. +It can be proven that 3 is the minimum number of operations needed. +Example 2: + + +Input: root = [1,3,2,7,6,5,4] +Output: 3 +Explanation: +- Swap 3 and 2. The 2nd level becomes [2,3]. +- Swap 7 and 4. The 3rd level becomes [4,6,5,7]. +- Swap 6 and 5. The 3rd level becomes [4,5,6,7]. +We used 3 operations so return 3. +It can be proven that 3 is the minimum number of operations needed. +Example 3: + + +Input: root = [1,2,3,4,5,6] +Output: 0 +Explanation: Each level is already sorted in increasing order so return 0. + + +Constraints: + +The number of nodes in the tree is in the range [1, 10^5]. +1 <= Node.val <= 10^5 +All the values of the tree are unique. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def minimumOperations(self, root: Optional[TreeNode]) -> int: + """ + BFS + minimum swap + Greedy swap? + """ + q = [root] + ret = 0 + while q: + ret += self.count(q) + new_q = [] + for cur in q: + if cur.left: + new_q.append(cur.left) + if cur.right: + new_q.append(cur.right) + + q = new_q + + return ret + + def count(self, q): + A = [node.val for node in q] + T = list(A) + T.sort() + hm = {} + for i, a in enumerate(A): + hm[a] = i + + # greedy swap? + cnt = 0 + for i in range(len(A)): + if A[i] != T[i]: + idx = hm[T[i]] + A[i], A[idx] = A[idx], A[i] + hm[A[i]] = i + hm[A[idx]] = idx + cnt += 1 + + return cnt \ No newline at end of file diff --git a/2476 Closest Nodes Queries in a Binary Search Tree.py b/2476 Closest Nodes Queries in a Binary Search Tree.py new file mode 100644 index 0000000..be13c41 --- /dev/null +++ b/2476 Closest Nodes Queries in a Binary Search Tree.py @@ -0,0 +1,112 @@ +""" +You are given the root of a binary search tree and an array queries of size n consisting of positive integers. + +Find a 2D array answer of size n where answer[i] = [mini, maxi]: + +mini is the largest value in the tree that is smaller than or equal to queries[i]. If a such value does not exist, add -1 instead. +maxi is the smallest value in the tree that is greater than or equal to queries[i]. If a such value does not exist, add -1 instead. +Return the array answer. + + + +Example 1: + + +Input: root = [6,2,13,1,4,9,15,null,null,null,null,null,null,14], queries = [2,5,16] +Output: [[2,2],[4,6],[15,-1]] +Explanation: We answer the queries in the following way: +- The largest number that is smaller or equal than 2 in the tree is 2, and the smallest number that is greater or equal than 2 is still 2. So the answer for the first query is [2,2]. +- The largest number that is smaller or equal than 5 in the tree is 4, and the smallest number that is greater or equal than 5 is 6. So the answer for the second query is [4,6]. +- The largest number that is smaller or equal than 16 in the tree is 15, and the smallest number that is greater or equal than 16 does not exist. So the answer for the third query is [15,-1]. +Example 2: + + +Input: root = [4,null,9], queries = [3] +Output: [[-1,4]] +Explanation: The largest number that is smaller or equal to 3 in the tree does not exist, and the smallest number that is greater or equal to 3 is 4. So the answer for the query is [-1,4]. + + +Constraints: + +The number of nodes in the tree is in the range [2, 10^5]. +1 <= Node.val <= 10^6 +n == queries.length +1 <= n <= 10^5 +1 <= queries[i] <= 10^6 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class SolutionUnbalancedTLE: + def closestNodes(self, root: Optional[TreeNode], queries: List[int]) -> List[List[int]]: + ret = [] + for t in queries: + ret.append([self.find_lo(root, t), self.find_hi(root, t)]) + + return ret + + def find_lo(self, cur, target): + if not cur: + return -1 + + if target < cur.val: + return self.find_lo(cur.left, target) + elif target > cur.val: + ret = self.find_lo(cur.right, target) + if ret == -1: + return cur.val + return ret + else: + return cur.val + + def find_hi(self, cur, target): + if not cur: + return -1 + if target < cur.val: + ret = self.find_hi(cur.left, target) + if ret == -1: + return cur.val + return ret + elif target > cur.val: + return self.find_hi(cur.right, target) + else: + return cur.val + + +import bisect + + +class Solution: + def closestNodes(self, root: Optional[TreeNode], queries: List[int]) -> List[List[int]]: + A = [] + self.inorder(root, A) + ret = [] + for q in queries: + idx = bisect.bisect_left(A, q) + if idx < len(A) and A[idx] == q: + lo = A[idx] + else: + lo = A[idx-1] if idx > 0 else -1 + + idx = bisect.bisect_right(A, q) + if idx > 0 and A[idx-1] == q: + hi = A[idx-1] + else: + hi = A[idx] if idx < len(A) else -1 + + ret.append([lo, hi]) + + return ret + + def inorder(self, cur, A): + if not cur: + return + + self.inorder(cur.left, A) + A.append(cur.val) + self.inorder(cur.right, A) \ No newline at end of file diff --git a/2477 Minimum Fuel Cost to Report to the Capital.py b/2477 Minimum Fuel Cost to Report to the Capital.py new file mode 100644 index 0000000..cd2c0a1 --- /dev/null +++ b/2477 Minimum Fuel Cost to Report to the Capital.py @@ -0,0 +1,94 @@ +""" +There is a tree (i.e., a connected, undirected graph with no cycles) structure country network consisting of n cities numbered from 0 to n - 1 and exactly n - 1 roads. The capital city is city 0. You are given a 2D integer array roads where roads[i] = [ai, bi] denotes that there exists a bidirectional road connecting cities ai and bi. + +There is a meeting for the representatives of each city. The meeting is in the capital city. + +There is a car in each city. You are given an integer seats that indicates the number of seats in each car. + +A representative can use the car in their city to travel or change the car and ride with another representative. The cost of traveling between two cities is one liter of fuel. + +Return the minimum number of liters of fuel to reach the capital city. + + + +Example 1: + + +Input: roads = [[0,1],[0,2],[0,3]], seats = 5 +Output: 3 +Explanation: +- Representative1 goes directly to the capital with 1 liter of fuel. +- Representative2 goes directly to the capital with 1 liter of fuel. +- Representative3 goes directly to the capital with 1 liter of fuel. +It costs 3 liters of fuel at minimum. +It can be proven that 3 is the minimum number of liters of fuel needed. +Example 2: + + +Input: roads = [[3,1],[3,2],[1,0],[0,4],[0,5],[4,6]], seats = 2 +Output: 7 +Explanation: +- Representative2 goes directly to city 3 with 1 liter of fuel. +- Representative2 and representative3 go together to city 1 with 1 liter of fuel. +- Representative2 and representative3 go together to the capital with 1 liter of fuel. +- Representative1 goes directly to the capital with 1 liter of fuel. +- Representative5 goes directly to the capital with 1 liter of fuel. +- Representative6 goes directly to city 4 with 1 liter of fuel. +- Representative4 and representative6 go together to the capital with 1 liter of fuel. +It costs 7 liters of fuel at minimum. +It can be proven that 7 is the minimum number of liters of fuel needed. +Example 3: + + +Input: roads = [], seats = 1 +Output: 0 +Explanation: No representatives need to travel to the capital city. + + +Constraints: + +1 <= n <= 10^5 +roads.length == n - 1 +roads[i].length == 2 +0 <= ai, bi < n +ai != bi +roads represents a valid tree. +1 <= seats <= 10^5 +""" +import math +from collections import defaultdict + + +class Solution: + def minimumFuelCost(self, roads: List[List[int]], seats: int) -> int: + """ + accumulate weight on the edge + fuel cost = ceil of edge weight / seats + + dfs returns the sum of weight + """ + self.seats = seats + self.ret = 0 + G = defaultdict(list) + for u, v in roads: + G[u].append(v) + G[v].append(u) + + self.dfs(G, 0, defaultdict(bool)) + return self.ret + + def dfs(self, G, cur, visited): + visited[cur] = True + weight = 0 + for nbr in G[cur]: + if not visited[nbr]: + w = self.dfs(G, nbr, visited) + # cost to come to the current node + self.ret += math.ceil(w / self.seats) + weight += w + + return weight + 1 + + + + diff --git a/248 Strobogrammatic Number III.py b/248 Strobogrammatic Number III.py new file mode 100644 index 0000000..d18e1c9 --- /dev/null +++ b/248 Strobogrammatic Number III.py @@ -0,0 +1,53 @@ +""" +Premium Question +Generation +https://leetcode.com/problems/strobogrammatic-number-iii/ +""" +from collections import deque + +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.lst = ["11", "69", "88", "96", "00"] + self.middle = ["0", "1", "8"] + + def strobogrammaticInRange(self, low, high): + """ + :type low: str + :type high: str + :rtype: int + """ + cnt = 0 + for l in xrange(len(low), len(high)+1): + cnt += len(filter(lambda x: int(low) <= int(x) <= int(high), self.strobogrammatic(l))) + + return cnt + + # below methods from strobogrammatic number ii + def strobogrammatic(self, n): + ret = [] + self.build(n, deque(), ret) + return ret + + def build(self, n, cur, ret): + """ + build from inside + """ + if n%2 == 1 and len(cur) == 0: + for elt in self.middle: + cur.append(elt) + self.build(n, cur, ret) + cur.pop() + else: + if len(cur) == n: + ret.append("".join(cur)) + return + for elt in self.lst: + if not (elt == "00" and len(cur) == n-2): + cur.appendleft(elt[0]) + cur.append(elt[1]) + self.build(n, cur, ret) + cur.pop() + cur.popleft() \ No newline at end of file diff --git a/2487 Remove Nodes From Linked List.py b/2487 Remove Nodes From Linked List.py new file mode 100644 index 0000000..c2f3adc --- /dev/null +++ b/2487 Remove Nodes From Linked List.py @@ -0,0 +1,55 @@ +""" +You are given the head of a linked list. + +Remove every node which has a node with a greater value anywhere to the right side of it. + +Return the head of the modified linked list. + +Example 1: + +Input: head = [5,2,13,3,8] +Output: [13,8] +Explanation: The nodes that should be removed are 5, 2 and 3. +- Node 13 is to the right of node 5. +- Node 13 is to the right of node 2. +- Node 8 is to the right of node 3. +Example 2: + +Input: head = [1,1,1,1] +Output: [1,1,1,1] +Explanation: Every node has value 1, so no nodes are removed. + + +Constraints: + +The number of the nodes in the given list is in the range [1, 10^5]. +1 <= Node.val <= 10^5 +""" +# Definition for singly-linked list. +class ListNode: + def __init__(self, val=0, next=None): + self.val = val + self.next = next + + +class Solution: + def removeNodes(self, head: Optional[ListNode]) -> Optional[ListNode]: + """ + monotonically decreasing stack to figure out node to remove + stack keep track of the previous/predecessor of the node to be removed + """ + dummy = ListNode(None, head) + pre = dummy + stk = [] + while pre.next: + cur = pre.next + while stk and stk[-1].next.val < cur.val: + pi = stk.pop() + pi.next = cur + pre = pi + + stk.append(pre) + pre = cur + + return dummy.next + diff --git a/250 Count Univalue Subtrees.py b/250 Count Univalue Subtrees.py index b245926..82f18e9 100644 --- a/250 Count Univalue Subtrees.py +++ b/250 Count Univalue Subtrees.py @@ -18,7 +18,6 @@ def __init__(self): def countUnivalSubtrees(self, root): """ - :type root: TreeNode :rtype: int """ @@ -34,9 +33,7 @@ def is_unival(self, cur): if (not is_left or not is_right or cur.left and cur.left.val != cur.val or cur.right and cur.right.val != cur.val): - is_uni = False + return False else: - is_uni = True - self.cnt += 1 - - return is_uni + self.cnt += 1 # for currently visiting node as the root of subtree. + return True diff --git a/251 Flatten 2D Vector.py b/251 Flatten 2D Vector.py index 31c5a59..410b283 100644 --- a/251 Flatten 2D Vector.py +++ b/251 Flatten 2D Vector.py @@ -7,7 +7,6 @@ class Vector2D: def __init__(self, vec2d): """ - :type vec2d: list[list[int]] :type: None """ @@ -29,7 +28,7 @@ def next(self): def hasNext(self): """ - + This function structures the two pointers. :rtype: bool """ # update @@ -37,4 +36,4 @@ def hasNext(self): self.i += 1 self.j = 0 - return self.i < len(self.vec2d) and self.j < len(self.vec2d[self.i]) \ No newline at end of file + return self.i < len(self.vec2d) and self.j < len(self.vec2d[self.i]) diff --git a/252 Meeting Rooms.py b/252 Meeting Rooms.py index c3aef95..f29d8e8 100644 --- a/252 Meeting Rooms.py +++ b/252 Meeting Rooms.py @@ -1,6 +1,8 @@ """ Premium Question """ +import operator + __author__ = 'Daniel' @@ -10,9 +12,6 @@ def __init__(self, s=0, e=0): self.end = e -import operator - - class Solution: def canAttendMeetings(self, intervals): """ diff --git a/253 Meeting Rooms II.py b/253 Meeting Rooms II.py index 719c534..51724fc 100644 --- a/253 Meeting Rooms II.py +++ b/253 Meeting Rooms II.py @@ -1,6 +1,11 @@ """ Premium Question +Find the maximum number of overlapped intervals """ +import heapq +import operator + + __author__ = 'Daniel' @@ -10,10 +15,7 @@ def __init__(self, s=0, e=0): self.end = e -import heapq - - -class Solution: +class Solution(object): def minMeetingRooms(self, intervals): """ @@ -22,21 +24,13 @@ def minMeetingRooms(self, intervals): """ maxa = 0 - intervals.sort(cmp=Solution.cmp) - end_heap = [] + intervals.sort(key=operator.attrgetter("start")) + h_end = [] for itvl in intervals: - heapq.heappush(end_heap, itvl.end) - while end_heap and end_heap[0] <= itvl.start: - heapq.heappop(end_heap) - - maxa = max(maxa, len(end_heap)) - - return maxa - + heapq.heappush(h_end, itvl.end) + while h_end and h_end[0] <= itvl.start: + heapq.heappop(h_end) - @staticmethod - def cmp(a, b): - if a.start != b.start: - return a.start-b.start + maxa = max(maxa, len(h_end)) - return a.end-b.end + return maxa \ No newline at end of file diff --git a/254 Factor Combinations.py b/254 Factor Combinations.py index 8d466b5..f1e85af 100644 --- a/254 Factor Combinations.py +++ b/254 Factor Combinations.py @@ -21,6 +21,8 @@ def dfs(self, cur, ret): """ 16 + The currently processing factor in stored in cur list as the last element + get factors of cur[-1] [16] [2, 8] @@ -35,7 +37,7 @@ def dfs(self, cur, ret): n = cur.pop() start = cur[-1] if cur else 2 for i in xrange(start, int(sqrt(n))+1): - if n%i == 0: + if n % i == 0: cur.append(i) cur.append(n/i) self.dfs(cur, ret) @@ -69,4 +71,4 @@ def dfs_TLE(self, n, cur, ret): if __name__ == "__main__": - print Solution().getFactors(16) \ No newline at end of file + print Solution().getFactors(16) diff --git a/255 Verify Preorder Sequence in Binary Search Tree.py b/255 Verify Preorder Sequence in Binary Search Tree.py index 13f3f0b..54199ae 100644 --- a/255 Verify Preorder Sequence in Binary Search Tree.py +++ b/255 Verify Preorder Sequence in Binary Search Tree.py @@ -7,8 +7,10 @@ class Solution: def verifyPreorder(self, preorder): """ - - :type preorder:list[int] + * Draw a valid BST, and swap a pair of nodes to get an invalid BST. + * Get the preorder traversal of the 2 BSTs and compare and contrast them. + * For tree traversal, a stack or a queue is normally involved. + :type preorder:List[int] :rtype: bool """ left_finished = None @@ -24,7 +26,7 @@ def verifyPreorder(self, preorder): return True + if __name__ == "__main__": preorder = [3, 5, 2, 1, 4, 7, 6, 9, 8, 10] assert Solution().verifyPreorder(preorder) == False - diff --git a/257 Binary Tree Paths.py b/257 Binary Tree Paths.py index 2804f31..41f47cf 100644 --- a/257 Binary Tree Paths.py +++ b/257 Binary Tree Paths.py @@ -54,3 +54,14 @@ def dfs(self, cur, path, ret): self.dfs(cur.right, path, ret) path.pop() # pop the shared path + def dfs_path(self, cur, path, ret): + if not cur: + return + + path.append(cur) + if not cur.left and not cur.right: + ret.append("->".join(map(lambda x: str(x.val), path))) + + self.dfs_path(cur.left, path, ret) + self.dfs_path(cur.right, path, ret) + path.pop() diff --git a/2583 Kth Largest Sum in a Binary Tree.py b/2583 Kth Largest Sum in a Binary Tree.py new file mode 100644 index 0000000..0f3ac55 --- /dev/null +++ b/2583 Kth Largest Sum in a Binary Tree.py @@ -0,0 +1,63 @@ +""" +You are given the root of a binary tree and a positive integer k. + +The level sum in the tree is the sum of the values of the nodes that are on the same level. + +Return the kth largest level sum in the tree (not necessarily distinct). If there are fewer than k levels in the tree, return -1. + +Note that two nodes are on the same level if they have the same distance from the root. + + + +Example 1: + + +Input: root = [5,8,9,2,1,3,7,4,6], k = 2 +Output: 13 +Explanation: The level sums are the following: +- Level 1: 5. +- Level 2: 8 + 9 = 17. +- Level 3: 2 + 1 + 3 + 7 = 13. +- Level 4: 4 + 6 = 10. +The 2nd largest level sum is 13. +Example 2: + + +Input: root = [1,2,null,3], k = 1 +Output: 3 +Explanation: The largest level sum is 3. + +Constraints: + +The number of nodes in the tree is n. +2 <= n <= 10^5 +1 <= Node.val <= 10^6 +1 <= k <= n +""" +class Solution: + def kthLargestLevelSum(self, root: Optional[TreeNode], k: int) -> int: + """ + BFS + find kth O(lg n) + """ + A = [] + q = [root] + while q: + new_q = [] + cur = 0 + for n in q: + cur += n.val + if n.left: + new_q.append(n.left) + if n.right: + new_q.append(n.right) + + A.append(cur) + q = new_q + + A.sort(reverse=True) + if k > len(A): + return -1 + + return A[k-1] + diff --git a/259 3Sum Smaller.py b/259 3Sum Smaller.py index b238fcf..eb95c8e 100644 --- a/259 3Sum Smaller.py +++ b/259 3Sum Smaller.py @@ -1,10 +1,11 @@ """ Premium Question +Smaller than the target. """ __author__ = 'Daniel' -class Solution: +class Solution(object): def threeSumSmaller(self, nums, target): """ @@ -16,13 +17,13 @@ def threeSumSmaller(self, nums, target): cnt = 0 n = len(nums) for i in xrange(n-2): - j = i+1 - k = n-1 - while j < k: - if nums[i]+nums[j]+nums[k] < target: - cnt += k-j - j += 1 + l = i+1 + h = n-1 + while l < h: + if nums[i]+nums[l]+nums[h] < target: + cnt += h-l # move the high ptr leftward till low. + l += 1 else: - k -= 1 + h -= 1 return cnt \ No newline at end of file diff --git a/261 Graph Valid Tree.py b/261 Graph Valid Tree.py new file mode 100644 index 0000000..4d1f101 --- /dev/null +++ b/261 Graph Valid Tree.py @@ -0,0 +1,46 @@ +""" +Premium Question +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def validTree(self, n, edges): + """ + A graph is a tree: + 1. no cycle + 2. all connected + :type n: int + :type edges: List[List[int] + :rtype: bool + """ + if not edges: + return n in (0, 1) + + V = defaultdict(list) + for e in edges: + V[e[0]].append(e[1]) + V[e[1]].append(e[0]) + + visited = set() + pathset = set() + if not self.dfs(V, edges[0][0], None, pathset, visited): + return False + + return len(visited) == n + + def dfs(self, V, v, pi, pathset, visited): + if v in pathset: + return False + + pathset.add(v) + for nbr in V[v]: + if nbr != pi: # since undirected graph + if not self.dfs(V, nbr, v, pathset, visited): + return False + + pathset.remove(v) + visited.add(v) + return True \ No newline at end of file diff --git a/263 Ugly Number.py b/263 Ugly Number.py new file mode 100644 index 0000000..d117de8 --- /dev/null +++ b/263 Ugly Number.py @@ -0,0 +1,39 @@ +""" +Write a program to check whether a given number is an ugly number. + +Ugly numbers are positive numbers whose prime factors only include 2, 3, 5. For example, 6, 8 are ugly while 14 is not +ugly since it includes another prime factor 7. + +Note that 1 is typically treated as an ugly number. +""" +__author__ = 'Daniel' + + +class Solution(object): + def isUgly(self, num): + """ + Prime factors: 2, 3, 5 + + :type num: int + :rtype: bool + """ + if num < 1: + return False + if num == 1: + return True + + ugly = {2, 3, 5} + + prime = 2 + while prime*prime <= num and num > 1: + if num % prime != 0: + prime += 1 + else: + num /= prime + if prime not in ugly: + return False + + if num not in ugly: + return False + + return True \ No newline at end of file diff --git a/264 Ugly Number II.py b/264 Ugly Number II.py new file mode 100644 index 0000000..ff1c3b0 --- /dev/null +++ b/264 Ugly Number II.py @@ -0,0 +1,61 @@ +""" +Write a program to find the n-th ugly number. + +Ugly numbers are positive numbers whose prime factors only include 2, 3, 5. For example, 1, 2, 3, 4, 5, 6, 8, 9, 10, 12 +is the sequence of the first 10 ugly numbers. + +Note that 1 is typically treated as an ugly number. +""" +import heapq + + +__author__ = 'Daniel' + + +class Node(object): + """ + Data structure is key + """ + def __init__(self, origin, q): + self.origin = origin + self.q = q + + def __cmp__(self, other): + return self.q[0] - other.q[0] + + +class Solution(object): + def nthUglyNumber(self, n): + """ + Prime factor: 2, 3, 5 + Heap + :type n: int + :rtype: int + """ + if n == 1: + return 1 + + n -= 1 # exclude 1 + + ugly = [2, 3, 5] + qs = [Node(i, [i]) for i in ugly] + h = list(qs) # shallow copy + + heapq.heapify(h) + + cnt = 0 + ret = 2 + while cnt < n: + cnt += 1 + popped = heapq.heappop(h) + ret = popped.q.pop(0) + for i in xrange(ugly.index(popped.origin), 3): + qs[i].q.append(ret*ugly[i]) + + heapq.heappush(h, popped) + + return ret + + +if __name__ == "__main__": + assert Solution().nthUglyNumber(10) == 12 diff --git a/2641 Cousins in Binary Tree II.py b/2641 Cousins in Binary Tree II.py new file mode 100644 index 0000000..8ae07f0 --- /dev/null +++ b/2641 Cousins in Binary Tree II.py @@ -0,0 +1,77 @@ +""" +Given the root of a binary tree, replace the value of each node in the tree with the sum of all its cousins' values. + +Two nodes of a binary tree are cousins if they have the same depth with different parents. + +Return the root of the modified tree. + +Note that the depth of a node is the number of edges in the path from the root node to it. + + + +Example 1: + + +Input: root = [5,4,9,1,10,null,7] +Output: [0,0,0,7,7,null,11] +Explanation: The diagram above shows the initial binary tree and the binary tree after changing the value of each node. +- Node with value 5 does not have any cousins so its sum is 0. +- Node with value 4 does not have any cousins so its sum is 0. +- Node with value 9 does not have any cousins so its sum is 0. +- Node with value 1 has a cousin with value 7 so its sum is 7. +- Node with value 10 has a cousin with value 7 so its sum is 7. +- Node with value 7 has cousins with values 1 and 10 so its sum is 11. +Example 2: + + +Input: root = [3,1,2] +Output: [0,0,0] +Explanation: The diagram above shows the initial binary tree and the binary tree after changing the value of each node. +- Node with value 3 does not have any cousins so its sum is 0. +- Node with value 1 does not have any cousins so its sum is 0. +- Node with value 2 does not have any cousins so its sum is 0. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def replaceValueInTree(self, root: Optional[TreeNode]) -> Optional[TreeNode]: + """ + brute force + BFS, keep track of pi + + BFS + sum q + then, through pi, we know left and right + """ + root.val = 0 + q = [root] + while q: + new_q = [] + for cur in q: + if cur.left: + new_q.append(cur.left) + if cur.right: + new_q.append(cur.right) + + s = sum(e.val for e in new_q) + for cur in q: + children_sum = 0 + if cur.left: + children_sum += cur.left.val + if cur.right: + children_sum += cur.right.val + + if cur.left: + cur.left.val = s - children_sum + if cur.right: + cur.right.val = s - children_sum + + q = new_q + + return root \ No newline at end of file diff --git a/265 Paint House II.py b/265 Paint House II.py new file mode 100644 index 0000000..dcbc35f --- /dev/null +++ b/265 Paint House II.py @@ -0,0 +1,38 @@ +""" +Premium Question +""" +import sys + +__author__ = 'Daniel' + + +class Solution(object): + def minCostII(self, costs): + """ + Lef F[i][j] be the total min costs when the houses BEFORE i are painted, with (i-1)-th house pained as color j + F[i][j] = \min(F[i-1][k] + cost[i-1][j] \forall k, k != j + + edge case handling for i + :type costs: List[List[int]] + :rtype: int + """ + if not costs: + return 0 + + n = len(costs) + m = len(costs[0]) + F = [[0 for _ in xrange(m)] for _ in xrange(n+1)] + for i in xrange(1, n+1): + for k1 in xrange(m): + F[i][k1] = min( + F[i-1][k0]+costs[i-1][k1] + # if i == 1 or k1 != k0 else sys.maxint # another syntax + for k0 in xrange(m) + if i == 1 or k1 != k0 + ) + + return min(F[n][i] for i in xrange(m)) + + +if __name__ == "__main__": + assert Solution().minCostII([[8]]) == 8 \ No newline at end of file diff --git a/266 Palindrome Permutation.py b/266 Palindrome Permutation.py new file mode 100644 index 0000000..18f615f --- /dev/null +++ b/266 Palindrome Permutation.py @@ -0,0 +1,27 @@ +""" +Premium Question +https://leetcode.com/problems/palindrome-permutation/ +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def canPermutePalindrome(self, s): + """ + :type s: str + :rtype: bool + """ + m = defaultdict(int) + for c in s: + m[c] += 1 + + once = False + for v in m.values(): + if v % 2 == 1: + if once: + return False + once = True + + return True \ No newline at end of file diff --git a/267 Palindrome Permutation II.py b/267 Palindrome Permutation II.py new file mode 100644 index 0000000..a1eb026 --- /dev/null +++ b/267 Palindrome Permutation II.py @@ -0,0 +1,52 @@ +""" +Premium Question +https://leetcode.com/problems/palindrome-permutation-ii/ +""" +from collections import defaultdict + + +__author__ = 'Daniel' + + +class Solution(object): + def generatePalindromes(self, s): + """ + :type s: str + :rtype: List[str] + """ + m = defaultdict(int) + for c in s: + m[c] += 1 + + odd = None + for k, v in m.items(): + if v % 2 == 1: + if odd is not None: + return [] + odd = k + + cur = "" + if odd: + m[odd] -= 1 + cur = odd + + ret = [] + # actually only need to build half + self.grow(s, m, None, cur, ret) + return ret + + def grow(self, s, count_map, pi, cur, ret): + if len(cur) == len(s): + ret.append(cur) + return + + for k in count_map.keys(): + if k != pi and count_map[k] > 0: + for i in xrange(1, count_map[k]/2+1): # jump the parent + count_map[k] -= i*2 + self.grow(s, count_map, k, k*i+cur+k*i, ret) + count_map[k] += i*2 + + +if __name__ == "__main__": + assert Solution().generatePalindromes("aabb") == ['baab', 'abba'] \ No newline at end of file diff --git a/268 Missing Number.py b/268 Missing Number.py new file mode 100644 index 0000000..63ba511 --- /dev/null +++ b/268 Missing Number.py @@ -0,0 +1,59 @@ +""" +Given an array containing n distinct numbers taken from 0, 1, 2, ..., n, find the one that is missing from the array. + +For example, +Given nums = [0, 1, 3] return 2. + +Note: +Your algorithm should run in linear runtime complexity. Could you implement it using only constant extra space +complexity? +""" +__author__ = 'Daniel' + + +class Solution(object): + def missingNumber(self, nums): + """ + Algorithm: + Hashmap, but to save space, use the array itself as the hashmap + + Notice: + nums[i], nums[nums[i]] = nums[nums[i]], nums[i] + Above is wrong, since evaluate from left to right; thus, when nums[nums[i]] on RHS is None, on LHS, nums[i] is + eval to None and nums[nums[i]] indexes by None, causing errors. + + Alternatively, it is correct that: + nums[nums[i]], nums[i]= nums[i], nums[nums[i]] + + To be safe, just use: + j = nums[i] + nums[i], nums[j] = nums[j], nums[i] + + :type nums: List[int] + :rtype: int + """ + num_n = None + n = len(nums) + + i = 0 + while i < n: + if nums[i] == n: + num_n = nums[i] + nums[i] = None + i += 1 + + elif nums[i] is not None and nums[i] != i: + j = nums[i] + nums[i], nums[j] = nums[j], nums[i] + + else: + i += 1 + + if not num_n: + return n + + return nums.index(None) + + +if __name__ == "__main__": + assert Solution().missingNumber([2, 0]) == 1 diff --git a/269 Alien Dictionary py3.py b/269 Alien Dictionary py3.py new file mode 100644 index 0000000..3d35408 --- /dev/null +++ b/269 Alien Dictionary py3.py @@ -0,0 +1,96 @@ +""" +There is a new alien language which uses the latin alphabet. However, the order +among letters are unknown to you. You receive a list of non-empty words from the +dictionary, where words are sorted lexicographically by the rules of this new +language. Derive the order of letters in this language. + +Example 1: + +Input: +[ + "wrt", + "wrf", + "er", + "ett", + "rftt" +] + +Output: "wertf" +Example 2: + +Input: +[ + "z", + "x" +] + +Output: "zx" +Example 3: + +Input: +[ + "z", + "x", + "z" +] + +Output: "" + +Explanation: The order is invalid, so return "". +""" +from typing import List +from collections import defaultdict, deque + + +class Solution(object): + def alienOrder(self, words: List[str]) -> str: + G = self.construct_graph(words) + visited = defaultdict(int) # 0 not visited, 1 visiting, 2 visted + ret = deque() + for u in G.keys(): + if visited[u] == 0: + if not self.topo_dfs(G, u, visited, ret): + return "" + + return "".join(ret) + + def construct_graph(self, words): + G = defaultdict(list) + # need to initialize, consider test case ["z", "z"] + for w in words: # error + for c in w: + G[c] + + for i in range(len(words) - 1): # compare word_i and word_{i+1} + for c1, c2 in zip(words[i], words[i+1]): + if c1 != c2: # lexical order + G[c1].append(c2) + break # need to break for lexical order + + return G + + def topo_dfs(self, G, u, visited, ret): + """ + Topological sort + G = defaultdict(list) + visited = defaultdict(int) # 0 not visited, 1 visiteding, 2 visted + + pre-condition: u is not visited (0) + """ + visited[u] = 1 + for nbr in G[u]: + if visited[nbr] == 1: + return False + if visited[nbr] == 0: + if not self.topo_dfs(G, nbr, visited, ret): + return False + + visited[u] = 2 + ret.appendleft(u) # visit larger first + return True + + +if __name__ == "__main__": + lst = ["ze", "yf", "xd", "wd", "vd", "ua", "tt", "sz", "rd", "qd", "pz", "op", "nw", "mt", "ln", "ko", "jm", "il", + "ho", "gk", "fa", "ed", "dg", "ct", "bb", "ba"] + assert Solution().alienOrder(lst) == "zyxwvutsrqponmlkjihgfedcba" diff --git a/269 Alien Dictionary.py b/269 Alien Dictionary.py new file mode 100644 index 0000000..3945a78 --- /dev/null +++ b/269 Alien Dictionary.py @@ -0,0 +1,133 @@ +#!/usr/bin/python3 +""" +There is a new alien language which uses the latin alphabet. However, the order +among letters are unknown to you. You receive a list of non-empty words from the +dictionary, where words are sorted lexicographically by the rules of this new +language. Derive the order of letters in this language. + +Example 1: + +Input: +[ + "wrt", + "wrf", + "er", + "ett", + "rftt" +] + +Output: "wertf" +Example 2: + +Input: +[ + "z", + "x" +] + +Output: "zx" +Example 3: + +Input: +[ + "z", + "x", + "z" +] + +Output: "" + +Explanation: The order is invalid, so return "". +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def alienOrder(self, words): + """ + :type words: List[str] + :rtype: str + """ + V = self.construct_graph(words) + visited = set() + pathset = set() + ret = [] + for v in V.keys(): + if v not in visited: + if not self.topo_dfs(V, v, visited, pathset, ret): + return "" + + return "".join(reversed(ret)) + + def construct_graph(self, words): + V = defaultdict(list) + # need to initialize, consider test case ["z", "z"] + for w in words: # pitfall + for c in w: + V[c] + for i in xrange(len(words) - 1): # compare word_i and word_{i+1} + for j in xrange(min(len(words[i]), len(words[i+1]))): + if words[i][j] != words[i+1][j]: + V[words[i][j]].append(words[i+1][j]) + break # need to break for lexical order + + return V + + def topo_dfs(self, V, v, visited, pathset, ret): + """ + Topological sort + :param V: Vertices HashMap + :param v: currently visiting letter + :param visited: visited letters + :param pathset: marked predecessor in the path + :param ret: the path, ordered topologically + :return: whether contains cycles + """ + if v in pathset: + return False + + pathset.add(v) + for nbr in V[v]: + if nbr not in visited: + if not self.topo_dfs(V, nbr, visited, pathset, ret): + return False + + pathset.remove(v) + visited.add(v) # add visited is in the end rather than at the begining + ret.append(v) # append after lower values + return True + + def construct_graph_tedious(self, words, up, down, ptr, V): + """ + :param words: + :param up: upper bound + :param down: lower bound + 1 + :param ptr: starting index for the char in the word + :param V: Vertices + :return: None + """ + i = up + while i < down: + if ptr >= len(words[i]): + i += 1 + else: + if words[i][ptr] not in V: + V[words[i][ptr]] = [] + + j = i+1 + while j < down and ptr < len(words[j]) and words[j][ptr] == words[i][ptr]: + j += 1 + + self.construct_graph_tedious(words, i, j, ptr+1, V) + if j < down and ptr < len(words[j]): + V[words[i][ptr]].append(words[j][ptr]) + + i = j + + +if __name__ == "__main__": + lst = ["ze", "yf", "xd", "wd", "vd", "ua", "tt", "sz", "rd", "qd", "pz", "op", "nw", "mt", "ln", "ko", "jm", "il", + "ho", "gk", "fa", "ed", "dg", "ct", "bb", "ba"] + assert Solution().alienOrder(lst) == "zyxwvutsrqponmlkjihgfedcba" diff --git a/270 Closest Binary Search Tree Value.py b/270 Closest Binary Search Tree Value.py new file mode 100644 index 0000000..11f92f0 --- /dev/null +++ b/270 Closest Binary Search Tree Value.py @@ -0,0 +1,52 @@ +""" +Premium Question +""" +import sys + +__author__ = 'Daniel' + + +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution(object): + def closestValue(self, root, target): + """ + Divide the problem into 2 parts: + 1. find the value just smaller than target + 2. find the value just larger than target + :type root: TreeNode + :type target: float + :rtype: int + """ + lo = [-sys.float_info.max] + self.find(root, target, lo, True) + hi = [sys.float_info.max] + self.find(root, target, hi, False) + if hi[0] - target < target - lo[0]: + return int(hi[0]) + else: + return int(lo[0]) + + def find(self, root, target, ret, lower=True): + if not root: + return + + if root.val == target: + ret[0] = root.val + return + + if root.val < target: + if lower: ret[0] = max(ret[0], root.val) + self.find(root.right, target, ret, lower) + else: + if not lower: ret[0] = min(ret[0], root.val) + self.find(root.left, target, ret, lower) + + +if __name__ == "__main__": + assert Solution().closestValue(TreeNode(2147483647), 0.0) == 2147483647 diff --git a/271 Encode and Decode Strings.py b/271 Encode and Decode Strings.py new file mode 100644 index 0000000..c7069ad --- /dev/null +++ b/271 Encode and Decode Strings.py @@ -0,0 +1,92 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Codec(object): + def encode(self, strs): + """ + Encodes a list of strings to a single string. + + Algorithm: Length info + + :type strs: List[str] + :rtype: str + """ + strs = map(lambda x: str(len(x))+"/"+x, strs) + return reduce(lambda x, y: x+y, strs, "") # i.e. "".join(strs) + + def decode(self, s): + """ + Decodes a single string to a list of strings. + + :type s: str + :rtype: List[str] + """ + strs = [] + i = 0 + while i < len(s): + j = s.index("/", i) + l = int(s[i:j]) + strs.append(s[j+1:j+1+l]) + i = j+1+l + + return strs + + +class CodecMethod2(object): + def encode(self, strs): + """ + Encodes a list of strings to a single string. + + Algorithm: Escape + + :type strs: List[str] + :rtype: str + """ + strs = map(lambda x: x.replace("\n", "\n\n")+"_\n_", strs) + return reduce(lambda x, y: x+y, strs, "") + + def decode(self, s): + """ + Decodes a single string to a list of strings. + + :type s: str + :rtype: List[str] + """ + strs = s.split("_\n_") + strs = strs[:-1] # clear the trailing delimiter + return map(lambda x: x.replace("\n\n", "\n"), strs) + + +class CodecError(object): + def encode(self, strs): + """ + Encodes a list of strings to a single string. + + This algorithm contains bugs if \\x00 exits in the original string + + :type strs: List[str] + :rtype: str + """ + strs = map(lambda x: x.replace("\x00", "\\x00"), strs) + ret = "" + for s in strs: + ret += s+"\x00" + return ret + + def decode(self, s): + """ + Decodes a single string to a list of strings. + + :type s: str + :rtype: List[str] + """ + if "\x00" not in s: + return [] + + s = s[:-1] # traiing \x00 + strs = s.split("\x00") + strs = map(lambda x: x.replace("\\x00", "\x00"), strs) + return strs diff --git a/272 Closest Binary Search Tree Value II.py b/272 Closest Binary Search Tree Value II.py new file mode 100644 index 0000000..060f967 --- /dev/null +++ b/272 Closest Binary Search Tree Value II.py @@ -0,0 +1,63 @@ +""" +Premium Question +https://leetcode.com/problems/closest-binary-search-tree-value-ii/ +""" +__author__ = 'Daniel' + + +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution(object): + def closestKValues(self, root, target, k): + """ + consider the predecessors and successors of the closest node to the target + Like merge in the merge sort, compare and pick the closest one to the target and put it to the result list + + Inorder traversal gives us sorted predecessors, whereas reverse-inorder traversal gives us sorted successors + + :type root: TreeNode + :type target: float + :type k: int + :rtype: List[int] + """ + pre = [] + suc = [] + self.predecessors(root, target, pre) + self.successors(root, target, suc) + return self.merge(target, k, pre, suc) + + def predecessors(self, root, target, stk): + if not root: + return + + self.predecessors(root.left, target, stk) + if root.val <= target: + stk.append(root.val) + self.predecessors(root.right, target, stk) + + def successors(self, root, target, stk): + if not root: + return + + self.successors(root.right, target, stk) + if root.val > target: + stk.append(root.val) + self.successors(root.left, target, stk) + + def merge(self, target, k, pre, suc): + ret = [] + while len(ret) < k: + if not pre: + ret.append(suc.pop()) + elif not suc: + ret.append(pre.pop()) + elif abs(pre[-1] - target) < abs(suc[-1] - target): + ret.append(pre.pop()) + else: + ret.append(suc.pop()) + return ret \ No newline at end of file diff --git a/273 Integer to English Words.py b/273 Integer to English Words.py new file mode 100644 index 0000000..28a8ad4 --- /dev/null +++ b/273 Integer to English Words.py @@ -0,0 +1,92 @@ +""" +Convert a non-negative integer to its english words representation. Given input is guaranteed to be less than 2^31 - 1. + +For example, +123 -> "One Hundred Twenty Three" +12345 -> "Twelve Thousand Three Hundred Forty Five" +1234567 -> "One Million Two Hundred Thirty Four Thousand Five Hundred Sixty Seven" +""" +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.table = { + 0: None, + 1: "One", + 2: "Two", + 3: "Three", + 4: "Four", + 5: "Five", + 6: "Six", + 7: "Seven", + 8: "Eight", + 9: "Nine", + 10: "Ten", + 11: "Eleven", + 12: "Twelve", + 13: "Thirteen", + 14: "Fourteen", + 15: "Fifteen", + 16: "Sixteen", + 17: "Seventeen", + 18: "Eighteen", + 19: "Nineteen", + 20: "Twenty", + 30: "Thirty", + 40: "Forty", + 50: "Fifty", + 60: "Sixty", + 70: "Seventy", + 80: "Eighty", + 90: "Ninety", + 100: "Hundred", + 1000: "Thousand", + 1000000: "Million", + 1000000000: "Billion" + } + + def numberToWords(self, num): + """ + Pay attention to the handling of 0's + :type num: int + :rtype: str + """ + if num == 0: return "Zero" + + ret = [] + self.toWords(num, ret) + ret = filter(lambda x: x, ret) # filter None as zeros + return " ".join(map(str, ret)) + + def toWords(self, num, ret): + """ + will call partial_parse + + significance by significance + """ + SIGS = [1000000000, 1000000, 1000, 100] + for SIG in SIGS: + self.partial_parse(num, SIG, ret) + num %= SIG + + TEN = 10 + if num/TEN > 1: + ret.append(self.table[(num/TEN)*TEN]) + + ret.append(self.table[num%TEN]) + + def partial_parse(self, num, sig, ret): + """ + will call toWords + """ + if num/sig: + prefix = [] + self.toWords(num/sig, prefix) + ret.extend(prefix) + ret.append(self.table[sig]) + + +if __name__ == "__main__": + assert Solution().numberToWords(1234567891) == "One Billion Two Hundred Thirty Four Million Five Hundred Sixty " \ + "Seven Thousand Eight Hundred Ninety One" diff --git a/274 H-Index.py b/274 H-Index.py new file mode 100644 index 0000000..0f9d298 --- /dev/null +++ b/274 H-Index.py @@ -0,0 +1,79 @@ +""" +Given an array of citations (each citation is a non-negative integer) of a researcher, write a function to compute the +researcher's h-index. + +According to the definition of h-index on Wikipedia: "A scientist has index h if h of his/her N papers have at least h +citations each, and the other N - h papers have no more than h citations each." + +For example, given citations = [3, 0, 6, 1, 5], which means the researcher has 5 papers in total and each of them had +received 3, 0, 6, 1, 5 citations respectively. Since the researcher has 3 papers with at least 3 citations each and the +remaining two with no more than 3 citations each, his h-index is 3. + +Note: If there are several possible values for h, the maximum one is taken as the h-index. +""" +__author__ = 'Daniel' + + +class Solution(object): + def hIndex(self, A): + """ + Determine the range of output (i.e. h-index): + Range of output: [0, N] + Chunk by N + Reverse mapping & DP + Let cnt[i] be the #paper with == i citations + Let F[i] be the #paper with >= i citations + F[i] = F[i+1] + cnt[i] + :type A: List[int] + :rtype: int + """ + n = len(A) + cnt = [0 for _ in xrange(n+1)] + for e in A: + if e >= n: # chunk + cnt[n] += 1 + else: + cnt[e] += 1 + + F = [0 for _ in xrange(n+2)] + for i in xrange(n, -1, -1): + F[i] += F[i+1] + cnt[i] + if F[i] >= i: + return i + + return 0 + + def hIndex_sort(self, citations): + """ + Algorithm forward sort + :type citations: List[int] + :rtype: int + """ + n = len(citations) + citations.sort() + for i in xrange(n): + if citations[i] >= n-i: + return n-i + + return 0 + + def hIndex_reverse_sort(self, citations): + """ + Algorithm sort + :type citations: List[int] + :rtype: int + """ + citations.sort(reverse=True) + citations.append(0) + h = 0 + for i in xrange(len(citations)-1): + if citations[i] >= i+1 >= citations[i+1]: + h = i+1 + elif h: + break + + return h + + +if __name__ == "__main__": + assert Solution().hIndex([3, 0, 6, 1, 5]) == 3 \ No newline at end of file diff --git a/275 H-Index II.py b/275 H-Index II.py new file mode 100644 index 0000000..bd890c0 --- /dev/null +++ b/275 H-Index II.py @@ -0,0 +1,29 @@ +""" +Follow up for H-Index: What if the citations array is sorted in ascending order? Could you optimize your algorithm? +""" +__author__ = 'Daniel' + + +class Solution(object): + def hIndex(self, A): + """ + Given sorted -> binary search + From linear search into bin search + :type A: List[int] + :rtype: int + """ + n = len(A) + s = 0 + e = n + while s < e: + m = (s+e)/2 + if A[m] >= n-m: + e = m + else: + s = m+1 + + return n-s + + +if __name__ == "__main__": + assert Solution().hIndex([0, 1, 3, 5, 6]) == 3 \ No newline at end of file diff --git a/276 Paint Fence.py b/276 Paint Fence.py new file mode 100644 index 0000000..e47f94b --- /dev/null +++ b/276 Paint Fence.py @@ -0,0 +1,117 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Solution(object): + def numWays_oneliner(self, n, k): + return 0 if n < 1 else sum(reduce(lambda F, i: [(k-1)*(F[0]+F[1]), F[0]], xrange(1, n), [k, 0])) + + def numWays(self, n, k): + """ + You need to abstract number of colors to binary value (is different color) + + Let F1[i] be the number of ways for A[:i] with last two with different colors + F2[i] be the number of ways for A[:i] with last two with same color + + F1[i] = (k-1)*(F1[i-1]+F2[i-1]) + F2[i] = F1[i-1] + + Optimize the space since only depends on i and i-1 + + :type n: int + :type k: int + :rtype: int + """ + if n < 1: + return 0 + + num_diff = k + num_same = 0 + for _ in xrange(1, n): + num_diff, num_same = (k-1)*(num_diff+num_same), num_diff + + return num_diff+num_same + + def numWays_MLE2(self, n, k): + """ + DP + Let F[i][j][l] be the number of ways of painting for A[:i] with A[i-1] as color j and A[i-2] as color l + :type n: int + :type k: int + :rtype: int + """ + if n < 1: + return 0 + + F = [[[0 for _ in xrange(k)] for _ in xrange(k)] for _ in xrange(2)] + EMPTY = 0 + + for j0 in xrange(k): + F[1][j0][EMPTY] = 1 + + for i in xrange(2, n+1): + for j0 in xrange(k): + for j1 in xrange(k): + F[i%2][j0][j1] = 0 + + for j0 in xrange(k): + for j1 in xrange(k): + for j2 in xrange(k): + if i == 2: + F[i%2][j0][j1] = F[(i-1)%2][j1][EMPTY] + + elif j1 == j2 and j0 != j1: + F[i%2][j0][j1] += F[(i-1)%2][j1][j2] + elif j1 != j2: + F[i%2][j0][j1] += F[(i-1)%2][j1][j2] + + ret = 0 + for j0 in xrange(k): + for j1 in xrange(k): + ret += F[n%2][j0][j1] + + return ret + + def numWays_MLE(self, n, k): + """ + DP + let F[i][j][l] be the number of ways of painting for A[:i] with A[i-1] as color j and A[i-2] as color l + :type n: int + :type k: int + :rtype: int + """ + if n < 1: + return 0 + + F = [[[0 for _ in xrange(k)] for _ in xrange(k)] for _ in xrange(n+1)] + EMPTY = 0 + + for j0 in xrange(k): + F[1][j0][EMPTY] = 1 + + for i in xrange(2, n+1): + for j0 in xrange(k): + for j1 in xrange(k): + for j2 in xrange(k): + if i == 2: + F[i][j0][j1] = F[i-1][j1][EMPTY] + + elif j1 == j2 and j0 != j1: + F[i][j0][j1] += F[i-1][j1][j2] + elif j1 != j2: + F[i][j0][j1] += F[i-1][j1][j2] + + ret = 0 + for j0 in xrange(k): + for j1 in xrange(k): + ret += F[n][j0][j1] + + return ret + + +if __name__ == "__main__": + assert Solution().numWays(3, 2) == 6 + + diff --git a/2762 Continuous Subarrays.py b/2762 Continuous Subarrays.py new file mode 100644 index 0000000..ccd1d39 --- /dev/null +++ b/2762 Continuous Subarrays.py @@ -0,0 +1,109 @@ +""" +You are given a 0-indexed integer array nums. A subarray of nums is called continuous if: + +Let i, i + 1, ..., j be the indices in the subarray. Then, for each pair of indices i <= i1, i2 <= j, 0 <= |nums[i1] - nums[i2]| <= 2. +Return the total number of continuous subarrays. + +A subarray is a contiguous non-empty sequence of elements within an array. + + + +Example 1: + +Input: nums = [5,4,2,4] +Output: 8 +Explanation: +Continuous subarray of size 1: [5], [4], [2], [4]. +Continuous subarray of size 2: [5,4], [4,2], [2,4]. +Continuous subarray of size 3: [4,2,4]. +There are no subarrys of size 4. +Total continuous subarrays = 4 + 3 + 1 = 8. +It can be shown that there are no more continuous subarrays. + + +Example 2: + +Input: nums = [1,2,3] +Output: 6 +Explanation: +Continuous subarray of size 1: [1], [2], [3]. +Continuous subarray of size 2: [1,2], [2,3]. +Continuous subarray of size 3: [1,2,3]. +Total continuous subarrays = 3 + 2 + 1 = 6. + + +Constraints: + +1 <= nums.length <= 10^5 +1 <= nums[i] <= 10^9 +""" +import heapq + + +class SolutionHeap: + def continuousSubarrays(self, A: List[int]) -> int: + """ + Need to maintain max and min in the sliding window + -> heap + + + In sliding window, count of all valid subarrays ending AT j + -> j - i + 1 + """ + ret = 0 + i = 0 # starting index of the window + j = 0 # ending index of the window + h_min = [] # (a, idx) + h_max = [] # (-a, idx) + while j < len(A): + heapq.heappush(h_min, (A[j], j)) + heapq.heappush(h_max, (-A[j], j)) + while -h_max[0][0] - h_min[0][0] > 2: + # shrink + i += 1 + while h_min[0][1] < i: + heapq.heappop(h_min) + while h_max[0][1] < i: + heapq.heappop(h_max) + + ret += j-i+1 + j += 1 + + return ret + + +from collections import deque + + +class Solution: + def continuousSubarrays(self, A: List[int]) -> int: + """ + Track min & max -> Monotonic Queue + """ + q_max = deque() # monotonically decreasing + q_min = deque() # monotonically increasing + i = 0 + j = 0 + ret = 0 + while j < len(A): + # process A[j] + while q_max and A[q_max[~0]] <= A[j]: + q_max.pop() + q_max.append(j) + while q_min and A[q_min[~0]] >= A[j]: + q_min.pop() + q_min.append(j) + while q_max and q_min and A[q_max[0]] - A[q_min[0]] > 2: + # shrink to pass the breaking idx + if q_max[0] < q_min[0]: + prev = q_max.popleft() + i = prev + 1 + else: + prev = q_min.popleft() + i = prev + 1 + + ret += j - i + 1 + j += 1 + + return ret + diff --git a/277 Find the Celebrity.py b/277 Find the Celebrity.py new file mode 100644 index 0000000..b43ce82 --- /dev/null +++ b/277 Find the Celebrity.py @@ -0,0 +1,64 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +def knows(a, b): + """ + :param a: person + :param b: person + :return: whether person a knows person b + """ + + +class Solution(object): + def findCelebrity(self, n): + """ + :type n: int + :rtype: int + """ + i = 0 + j = n-1 + while i < j: + nxt_i, nxt_j = i, j + if knows(i, j) or not knows(j, i): + nxt_i += 1 + if knows(j, i) or not knows(i, j): + nxt_j -= 1 + i, j = nxt_i, nxt_j + + celebrity = i + for i in xrange(n): + if i != celebrity and (not knows(i, celebrity) or knows(celebrity, i)): + return -1 + + return celebrity + + def findCelebrity_set(self, n): + """ + O(n) + set + + :type n: int + :rtype: int + """ + V = set(range(n)) + + while len(V) > 1: + a = V.pop() + b = V.pop() + if knows(a, b) and not knows(b, a): + V.add(b) + elif not knows(a, b) and knows(b, a): + V.add(a) + + if not V: + return -1 + + celebrity = V.pop() + for i in xrange(n): + if i != celebrity and (not knows(i, celebrity) or knows(celebrity, i)): + return -1 + + return celebrity diff --git a/278 First Bad Version.py b/278 First Bad Version.py new file mode 100644 index 0000000..10f1e03 --- /dev/null +++ b/278 First Bad Version.py @@ -0,0 +1,34 @@ +""" +You are a product manager and currently leading a team to develop a new product. Unfortunately, the latest version of +your product fails the quality check. Since each version is developed based on the previous version, all the versions +after a bad version are also bad. + +Suppose you have n versions [1, 2, ..., n] and you want to find out the first bad one, which causes all the following +ones to be bad. + +You are given an API bool isBadVersion(version) which will return whether version is bad. Implement a function to find +the first bad version. You should minimize the number of calls to the API. +""" +__author__ = 'Daniel' + + +def isBadVersion(version): + pass + + +class Solution(object): + def firstBadVersion(self, n): + """ + :param n: An integers. + :return: An integer which is the first bad version. + """ + l = 1 + h = n+1 + while l < h: + m = (l+h)/2 + if not isBadVersion(m): + l = m+1 + else: + h = m + + return l \ No newline at end of file diff --git a/279 Perfect Squares.py b/279 Perfect Squares.py new file mode 100644 index 0000000..bb2b42f --- /dev/null +++ b/279 Perfect Squares.py @@ -0,0 +1,80 @@ +""" +Given a positive integer n, find the least number of perfect square numbers (for example, 1, 4, 9, 16, ...) which sum +to n. + +For example, given n = 12, return 3 because 12 = 4 + 4 + 4; given n = 13, return 2 because 13 = 4 + 9. +""" +import math +import sys + +__author__ = 'Daniel' + + +class Solution(object): + F = [0] # static dp for all test cases + + def numSquares(self, n): + """ + static dp + F_i = min(F_{i - j^2}+1, \forall j) + + O(n), think it as a tree, cache tree O(m+n) = O(2n); rather than O(n sqrt(n)) + backward + """ + while len(Solution.F) <= n: + i = len(Solution.F) + Solution.F.append(sys.maxint) + j = 1 + while i - j*j >= 0: + Solution.F[i] = min(Solution.F[i], Solution.F[i-j*j]+1) + j += 1 + + return Solution.F[n] + + def numSquares_bfs(self, n): + """ + bfs + the q stores the intermediate result of sum of squares + :type n: int + :rtype: int + """ + q = [0] + visited = [False for _ in xrange(n+1)] + + level = 0 + while q: + level += 1 + l = len(q) + for i in xrange(l): + for j in xrange(1, int(math.sqrt(n))+1): + nxt = q[i]+j*j + if nxt <= n and visited[nxt]: + continue + elif nxt < n: + visited[nxt] = True + q.append(nxt) + elif nxt == n: + return level + else: + break + q = q[l:] + + return None + + def numSquares_TLE(self, n): + """ + DP + :type n: int + :rtype: int + """ + F = [i for i in xrange(n+1)] + for i in xrange(1, n+1): + for j in xrange(1, int(math.sqrt(i))+1): + if i-j*j >= 0: + F[i] = min(F[i], F[i-j*j]+1) + + return F[n] + + +if __name__ == "__main__": + assert Solution().numSquares(6) == 3 \ No newline at end of file diff --git a/280 Wiggle Sort.py b/280 Wiggle Sort.py new file mode 100644 index 0000000..5752e51 --- /dev/null +++ b/280 Wiggle Sort.py @@ -0,0 +1,24 @@ +""" +Premium Question +nums[0] <= nums[1] >= nums[2] <= nums[3]... +""" +__author__ = 'Daniel' + + +class Solution(object): + def wiggleSort(self, nums): + """ + Solve by enumerating examples + Sort-based: interleave the small half and large half + + Time: O(n lg n) + Space: O(1) + :type nums: List[int] + :rtype: void Do not return anything, modify nums in-place instead. + """ + i = 0 + for elt in sorted(nums): + if i >= len(nums): + i = 1 + nums[i] = elt + i += 2 diff --git a/281 Zigzag Iterator.py b/281 Zigzag Iterator.py new file mode 100644 index 0000000..4f0fccb --- /dev/null +++ b/281 Zigzag Iterator.py @@ -0,0 +1,56 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class ZigzagIterator(object): + def __init__(self, v1, v2): + """ + Initialize your data structure here. + :type v1: List[int] + :type v2: List[int] + """ + self.mat = [v1, v2] + self.maxa = max((c, r) for r, c in enumerate(map(lambda x: len(x)-1, self.mat))) + self.i = 0 + self.j = 0 + self._reposition() + + def _reposition(self): + while self.i >= len(self.mat) or self.j >= len(self.mat[self.i]): + if not self.hasNext(): + return + + elif self.i >= len(self.mat): + self.i = 0 + self.j += 1 + + elif self.j >= len(self.mat[self.i]): + self.i += 1 + + def next(self): + """ + :rtype: int + """ + if not self.hasNext(): + raise StopIteration + + ret = self.mat[self.i][self.j] + self.i += 1 + self._reposition() + return ret + + def hasNext(self): + """ + :rtype: bool + """ + return self.j <= self.maxa[0] + + +if __name__ == "__main__": + v1 = [1, 2] + v2 = [3, 4, 5, 6] + itr = ZigzagIterator(v1, v2) + while itr.hasNext(): + print itr.next() \ No newline at end of file diff --git a/282 Expression Add Operators.py b/282 Expression Add Operators.py new file mode 100644 index 0000000..391c444 --- /dev/null +++ b/282 Expression Add Operators.py @@ -0,0 +1,51 @@ +""" +Given a string that contains only digits 0-9 and a target value, return all possibilities to add binary operators (not +unary) +, -, or * between the digits so they evaluate to the target value. + +Examples: +"123", 6 -> ["1+2+3", "1*2*3"] +"232", 8 -> ["2*3+2", "2+3*2"] +"105", 5 -> ["1*0+5","10-5"] +"00", 0 -> ["0+0", "0-0", "0*0"] +"3456237490", 9191 -> [] +""" +__author__ = 'Daniel' + + +class Solution(object): + def addOperators(self, num, target): + """ + Adapted from https://leetcode.com/discuss/58614/java-standard-backtrace-ac-solutoin-short-and-clear + + Algorithm: + 1. DFS + 2. Special handling for multiplication + 3. Detect invalid number with leading 0's + :type num: str + :type target: int + :rtype: List[str] + """ + ret = [] + self.dfs(num, target, 0, "", 0, 0, ret) + return ret + + def dfs(self, num, target, pos, cur_str, cur_val, mul, ret): + if pos >= len(num): + if cur_val == target: + ret.append(cur_str) + else: + for i in xrange(pos, len(num)): + if i != pos and num[pos] == "0": + continue + nxt_val = int(num[pos:i+1]) + + if not cur_str: + self.dfs(num, target, i+1, "%d"%nxt_val, nxt_val, nxt_val, ret) + else: + self.dfs(num, target, i+1, cur_str+"+%d"%nxt_val, cur_val+nxt_val, nxt_val, ret) + self.dfs(num, target, i+1, cur_str+"-%d"%nxt_val, cur_val-nxt_val, -nxt_val, ret) + self.dfs(num, target, i+1, cur_str+"*%d"%nxt_val, cur_val-mul+mul*nxt_val, mul*nxt_val, ret) + + +if __name__ == "__main__": + assert Solution().addOperators("232", 8) == ["2+3*2", "2*3+2"] diff --git a/283 Move Zeroes.py b/283 Move Zeroes.py new file mode 100644 index 0000000..5e932c1 --- /dev/null +++ b/283 Move Zeroes.py @@ -0,0 +1,48 @@ +""" +Given an array nums, write a function to move all 0's to the end of it while maintaining the relative order of the non- +zero elements. + +For example, given nums = [0, 1, 0, 3, 12], after calling your function, nums should be [1, 3, 12, 0, 0]. + +Note: +You must do this in-place without making a copy of the array. +Minimize the total number of operations. +""" + +__author__ = 'Daniel' + + +class Solution(object): + def moveZeroes(self, nums): + """ + Two pointers at the left side + Pivot + """ + left = -1 + for i in xrange(len(nums)): + if nums[i] != 0: + left += 1 + nums[left], nums[i] = nums[i], nums[left] + + +class SolutionCount(object): + def moveZeroes(self, nums): + """ + In-place + :type nums: List[int] + :rtype: void Do not return anything, modify nums in-place instead. + """ + cnt = 0 + for elt in nums: + if elt != 0: + nums[cnt] = elt + cnt += 1 + + for j in xrange(cnt, len(nums)): + nums[j] = 0 + + +if __name__ == "__main__": + lst = [0, 1, 0, 3, 12] + Solution().moveZeroes(lst) + assert lst == [1, 3, 12, 0, 0] diff --git a/284 Peeking Iterator.py b/284 Peeking Iterator.py new file mode 100644 index 0000000..94c43b0 --- /dev/null +++ b/284 Peeking Iterator.py @@ -0,0 +1,59 @@ +""" +Given an Iterator class interface with methods: next() and hasNext(), design and implement a PeekingIterator that +support the peek() operation -- it essentially peek() at the element that will be returned by the next call to next(). +""" +__author__ = 'Daniel' + + +class Iterator(object): + def __init__(self, nums): + """ + Initializes an iterator object to the beginning of a list. + :type nums: List[int] + """ + + def hasNext(self): + """ + Returns true if the iteration has more elements. + :rtype: bool + """ + + def next(self): + """ + Returns the next element in the iteration. + :rtype: int + """ + + +class PeekingIterator(object): + def __init__(self, iterator): + """ + Initialize your data structure here. + :type iterator: Iterator + """ + self.nxt = None + self.iterator = iterator + + def peek(self): + """ + Returns the next element in the iteration without advancing the iterator. + :rtype: int + """ + if not self.nxt: + self.nxt = self.iterator.next() + + return self.nxt + + def next(self): + """ + :rtype: int + """ + ret = self.peek() + self.nxt = None + return ret + + def hasNext(self): + """ + :rtype: bool + """ + return self.nxt is not None or self.iterator.hasNext() diff --git a/285 Inorder Successor in BST.py b/285 Inorder Successor in BST.py new file mode 100644 index 0000000..c788eed --- /dev/null +++ b/285 Inorder Successor in BST.py @@ -0,0 +1,36 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution(object): + def inorderSuccessor(self, root, p): + """ + search + + If it is a general binary tree + :type root: TreeNode + :type p: TreeNode + :rtype: TreeNode + """ + find = [None] + self.search(root, p, find) + return find[0] + + def search(self, cur, p, find): + if not cur: + return + + if cur.val > p.val: + find[0] = cur + self.search(cur.left, p, find) + else: + self.search(cur.right, p, find) \ No newline at end of file diff --git a/286 Walls and Gates.py b/286 Walls and Gates.py new file mode 100644 index 0000000..04078df --- /dev/null +++ b/286 Walls and Gates.py @@ -0,0 +1,120 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.dirs = ((-1, 0), (1, 0), (0, -1), (0, 1)) + + def wallsAndGates(self, mat): + """ + bfs + O(mn), abstract level + + reference: https://leetcode.com/discuss/60170/6-lines-o-mn-python-bfs + :type mat: List[List[int]] + :rtype: void Do not return anything, modify rooms in-place instead. + """ + q = [(i, j) for i, row in enumerate(mat) for j, val in enumerate(row) if val == 0] + for i, j in q: # iterator + for d in self.dirs: + i1, j1 = i+d[0], j+d[1] + if 0 <= i1 < len(mat) and 0 <= j1 < len(mat[0]) and mat[i1][j1] > mat[i][j]+1: + mat[i1][j1] = mat[i][j]+1 + q.append((i1, j1)) + + +class Solution_slow(object): + def __init__(self): + self.dirs = ((-1, 0), (1, 0), (0, -1), (0, 1)) + + def wallsAndGates(self, rooms): + """ + bfs + O(kmn) where k is #0s + :type rooms: List[List[int]] + :rtype: void Do not return anything, modify rooms in-place instead. + """ + if not rooms: return + m = len(rooms) + if not m: return + n = len(rooms[0]) + + for i in xrange(m): + for j in xrange(n): + if rooms[i][j] == 0: + self.bfs_deque(rooms, i, j) + + def bfs(self, rooms, x, y): + m = len(rooms) + n = len(rooms[0]) + level = 0 + q = [(x, y)] + while q: + l = len(q) + for idx in xrange(l): + i, j = q[idx] + rooms[i][j] = min(rooms[i][j], level) + for d in self.dirs: + i_t = i+d[0] + j_t = j+d[1] + if 0 <= i_t < m and 0 <= j_t < n and rooms[i_t][j_t] != -1 and rooms[i_t][j_t] >= level+1: + q.append((i_t, j_t)) + + q = q[l:] + level += 1 + + def bfs_deque(self, rooms, x, y): + from collections import deque + + m = len(rooms) + n = len(rooms[0]) + q = deque() + q.append((x, y, 0)) + while q: + i, j, level = q.popleft() + rooms[i][j] = min(rooms[i][j], level) + for d in self.dirs: + i_t, j_t = i+d[0], j+d[1] + if 0 <= i_t < m and 0 <= j_t < n and rooms[i_t][j_t] != -1 and rooms[i_t][j_t] >= level+1: + q.append((i_t, j_t, level+1)) + + +class Solution_error(object): + def __init__(self): + self.dirs = ((-1, 0), (1, 0), (0, -1), (0, 1)) + + def wallsAndGates(self, rooms): + """ + post-order DFS + + :type rooms: List[List[int]] + :rtype: void Do not return anything, modify rooms in-place instead. + """ + if not rooms: return + m = len(rooms) + if not m: return + n = len(rooms[0]) + + visited = [[False for _ in xrange(n)] for _ in xrange(m)] + for i in xrange(m): + for j in xrange(n): + if not visited[i][j]: + self.dfs(rooms, i, j, visited) + + def dfs(self, rooms, i, j, visited): + if not visited[i][j]: + visited[i][j] = True + for d in self.dirs: + nxt_i = i+d[0] + nxt_j = j+d[1] + if rooms[nxt_i][nxt_j] != -1: + rooms[nxt_i][nxt_j] = min(rooms[nxt_i][nxt_j], self.dfs(rooms, nxt_i, nxt_j, visited)+1) + + return rooms[nxt_i][nxt_j] + + + + diff --git a/2865 Beautiful Towers I.py b/2865 Beautiful Towers I.py new file mode 100644 index 0000000..f662cca --- /dev/null +++ b/2865 Beautiful Towers I.py @@ -0,0 +1,119 @@ +""" +You are given an array heights of n integers representing the number of bricks in n consecutive towers. Your task is to remove some bricks to form a mountain-shaped tower arrangement. In this arrangement, the tower heights are non-decreasing, reaching a maximum peak value with one or multiple consecutive towers and then non-increasing. + +Return the maximum possible sum of heights of a mountain-shaped tower arrangement. + + + +Example 1: + +Input: heights = [5,3,4,1,1] + +Output: 13 + +Explanation: + +We remove some bricks to make heights = [5,3,3,1,1], the peak is at index 0. + +Example 2: + +Input: heights = [6,5,3,9,2,7] + +Output: 22 + +Explanation: + +We remove some bricks to make heights = [3,3,3,9,2,2], the peak is at index 3. + +Example 3: + +Input: heights = [3,2,5,5,2,3] + +Output: 18 + +Explanation: + +We remove some bricks to make heights = [2,2,5,5,2,2], the peak is at index 2 or 3. + + + +Constraints: + +1 <= n == heights.length <= 10^3 +1 <= heights[i] <= 10^9 +""" +class Solution: + def maximumSumOfHeights_brute(self, H: List[int]) -> int: + """ + Select a peak + then make mountain-shaped using stack + + Get the heighest + O(N^2) + """ + maxa = 0 + N = len(H) + for p in range(N): # peak + L_stk = [p] + for i in range(p-1, -1, -1): + if H[i] > H[L_stk[-1]]: + L_stk.append(L_stk[-1]) + else: + L_stk.append(i) + R_stk = [p] + for i in range(p+1, N): + if H[i] > H[R_stk[-1]]: + R_stk.append(R_stk[-1]) + else: + R_stk.append(i) + cur = sum(H[i] for i in L_stk +R_stk) - H[p] + maxa = max(maxa, cur) + + return maxa + + def maximumSumOfHeights(self, H: List[int]) -> int: + """ + O(N) + Consider 1 side of the problem, from left to peak + Let L[i] be the max sum of upward-shaped area ended at index i + Maintain a monotonically increasing stack + A[lo] < A[mid] > A[i] + A[mid] is the local min for (lo, mid] + when popping mid: + area -= (mid - lo) * A[mid] + # note: not area -= (i - (lo+1)) * A[mid] + # for mid as local min as (lo, i) + # since mid has not impact on (mid, i) + A[i] is the new local min for (lo, i] + area += (i - lo) * A[i] + + same for R when scanning from right to peak + """ + L = self.dp(H) + R = self.dp(H[::-1]) + maxa = 0 + for i in range(len(H)): + cur = L[i] + R[~i] - H[i] # double count H[i] + maxa = max(maxa, cur) + + return maxa + + def dp(self, H): + N = len(H) + L = [0 for _ in range(N)] + stk = [] # mono asc + H.append(-sys.maxsize-1) + cur = 0 + for i in range(N): + while stk and H[stk[-1]] > H[i]: + mid = stk.pop() + lo = stk[-1] if stk else -1 + cur -= (mid - lo) * H[mid] + + lo = stk[-1] if stk else -1 + cur += (i-lo) * H[i] # (lo, i] + L[i] = cur + stk.append(i) + + H.pop() + return L \ No newline at end of file diff --git a/2866 Beautiful Towers II.py b/2866 Beautiful Towers II.py new file mode 100644 index 0000000..2961e62 --- /dev/null +++ b/2866 Beautiful Towers II.py @@ -0,0 +1,79 @@ +""" +You are given a 0-indexed array maxHeights of n integers. + +You are tasked with building n towers in the coordinate line. The ith tower is built at coordinate i and has a height of heights[i]. + +A configuration of towers is beautiful if the following conditions hold: + +1 <= heights[i] <= maxHeights[i] +heights is a mountain array. +Array heights is a mountain if there exists an index i such that: + +For all 0 < j <= i, heights[j - 1] <= heights[j] +For all i <= k < n - 1, heights[k + 1] <= heights[k] +Return the maximum possible sum of heights of a beautiful configuration of towers. + + +Example 1: + +Input: maxHeights = [5,3,4,1,1] +Output: 13 +Explanation: One beautiful configuration with a maximum sum is heights = [5,3,3,1,1]. This configuration is beautiful since: +- 1 <= heights[i] <= maxHeights[i] +- heights is a mountain of peak i = 0. +It can be shown that there exists no other beautiful configuration with a sum of heights greater than 13. +Example 2: + +Input: maxHeights = [6,5,3,9,2,7] +Output: 22 +Explanation: One beautiful configuration with a maximum sum is heights = [3,3,3,9,2,2]. This configuration is beautiful since: +- 1 <= heights[i] <= maxHeights[i] +- heights is a mountain of peak i = 3. +It can be shown that there exists no other beautiful configuration with a sum of heights greater than 22. +Example 3: + +Input: maxHeights = [3,2,5,5,2,3] +Output: 18 +Explanation: One beautiful configuration with a maximum sum is heights = [2,2,5,5,2,2]. This configuration is beautiful since: +- 1 <= heights[i] <= maxHeights[i] +- heights is a mountain of peak i = 2. +Note that, for this configuration, i = 3 can also be considered a peak. +It can be shown that there exists no other beautiful configuration with a sum of heights greater than 18. + + +Constraints: + +1 <= n == maxHeights.length <= 10^5 +1 <= maxHeights[i] <= 10^9 +""" +class Solution: + def maximumSumOfHeights(self, H: List[int]) -> int: + """ + Let L[i] be the largest asc slide for H[:i] + Let R[i] be the largest desc slide for H[i:] + """ + N = len(H) + L = self.dp(H) + R = self.dp(H[::-1])[::-1] + maxa = 0 + for i in range(N+1): + cur = L[i] + R[i] + maxa = max(maxa, cur) + + return maxa + + def dp(self, H): + N = len(H) + L = [0 for _ in range(N+1)] + stk = [] # mono asc + H.append(-sys.maxsize-1) + for i in range(N): + while stk and H[stk[-1]] > H[i]: + mid = stk.pop() + + lo = stk[-1] if stk else -1 + L[i+1] = L[lo+1] + (i-lo) * H[i] + stk.append(i) + + H.pop() + return L \ No newline at end of file diff --git a/287 Find the Duplicate Number.py b/287 Find the Duplicate Number.py new file mode 100644 index 0000000..28124ac --- /dev/null +++ b/287 Find the Duplicate Number.py @@ -0,0 +1,47 @@ +""" +Given an array nums containing n + 1 integers where each integer is between 1 and n (inclusive), prove that at least one +duplicate number must exist. Assume that there is only one duplicate number, find the duplicate one. + +Note: +You must not modify the array (assume the array is read only). +You must use only constant, O(1) extra space. +Your runtime complexity should be less than O(n^2). +There is only one duplicate number in the array, but it could be repeated more than once. +""" +__author__ = 'Daniel' + + +class Solution(object): + def findDuplicate(self, nums): + """ + Condition for convert the array problem to linked list problem: + CANNOT contains integer with 0; otherwise cycle: A = [1, 0] + + Degenerated case: if there is only one duplicates, just do arithmetic. + + For possibly multiple duplications: Floyd's loop detection + Abstract the array to linked list, current index as value, current value as next + Need to derive the math proof + + Abstract array to linked list + :type nums: List[int] + :rtype: int + """ + f, s = 0, 0 + while True: + f = nums[nums[f]] + s = nums[s] + if f == s: + break + + t = 0 + while t != s: + t = nums[t] + s = nums[s] + + return t + + +if __name__ == "__main__": + assert Solution().findDuplicate([1, 2, 3 ,4, 5, 5]) == 5 + diff --git a/288 Unique Word Abbreviation.py b/288 Unique Word Abbreviation.py new file mode 100644 index 0000000..7742265 --- /dev/null +++ b/288 Unique Word Abbreviation.py @@ -0,0 +1,34 @@ +""" +Premium Question +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class ValidWordAbbr(object): + def __init__(self, dictionary): + """ + initialize your data structure here. + :type dictionary: List[str] + """ + self.abbrev = defaultdict(int) + self.dictionary = set(dictionary) + + for word in dictionary: + self.abbrev[self.process(word)] += 1 + + def process(self, word): + if len(word) <= 2: + return word + + return word[0]+str(len(word)-2)+word[-1] + + def isUnique(self, word): + """ + check if a word is unique. + :type word: str + :rtype: bool + """ + return (word in self.dictionary and self.abbrev[self.process(word)] == 1 or + not self.process(word) in self.abbrev) diff --git a/289 Game of Life.py b/289 Game of Life.py new file mode 100644 index 0000000..d1df353 --- /dev/null +++ b/289 Game of Life.py @@ -0,0 +1,70 @@ +""" +According to the Wikipedia's article: "The Game of Life, also known simply as Life, is a cellular automaton devised by +the British mathematician John Horton Conway in 1970." + +Given a board with m by n cells, each cell has an initial state live (1) or dead (0). Each cell interacts with its eight +neighbors (horizontal, vertical, diagonal) using the following four rules (taken from the above Wikipedia article): + +Any live cell with fewer than two live neighbors dies, as if caused by under-population. +Any live cell with two or three live neighbors lives on to the next generation. +Any live cell with more than three live neighbors dies, as if by over-population.. +Any dead cell with exactly three live neighbors becomes a live cell, as if by reproduction. +Write a function to compute the next state (after one update) of the board given its current state. + +Follow up: +Could you solve it in-place? Remember that the board needs to be updated at the same time: You cannot update some cells +first and then use their updated values to update other cells. +In this question, we represent the board using a 2D array. In principle, the board is infinite, which would cause +problems when the active area encroaches the border of the array. How would you address these problems? +""" + + +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.dirs = [(-1, 0), (-1, -1), (0, -1), (1, -1), (1, 0), (1, 1), (0, 1), (-1, 1)] + + def gameOfLife(self, board): + """ + B3/S23, born 3 stays 2 or 3 + + In-place solution + Similar to dp space optimization. + 1. Line buffer, directional, main the entires for previous state. + 2. higher bit, since you got 32-bit int + + + new new new + new cur pre + pre pre pre + + :type board: List[List[int]] + :rtype: void Do not return anything, modify board in-place instead. + """ + m = len(board) + n = len(board[0]) + lines = [[0 for _ in xrange(n)] for _ in xrange(2)] + for i in xrange(m): + for j in xrange(n): + lines[(i+1)%2][j] = board[i][j] + + cnt = 0 + for d in self.dirs: + I = i+d[0] + J = j+d[1] + if 0 <= I < m and 0 <= J < n: + if I < i: + cnt += lines[i%2][J] + elif I == i and J < j: + cnt += lines[(i+1)%2][J] + else: + cnt += board[I][J] + + if cnt == 3: + board[i][j] = 1 + elif cnt == 2: + board[i][j] &= 1 + else: + board[i][j] = 0 diff --git a/290 Word Pattern.py b/290 Word Pattern.py new file mode 100644 index 0000000..7862c62 --- /dev/null +++ b/290 Word Pattern.py @@ -0,0 +1,81 @@ +""" +Given a pattern and a string str, find if str follows the same pattern. + +Examples: +pattern = "abba", str = "dog cat cat dog" should return true. +pattern = "abba", str = "dog cat cat fish" should return false. +pattern = "aaaa", str = "dog cat cat dog" should return false. +pattern = "abba", str = "dog dog dog dog" should return false. +Notes: +patterncontains only lowercase alphabetical letters, and str contains words separated by a single space. Each word in +str contains only lowercase alphabetical letters. +Both pattern and str do not have leading or trailing spaces. +Each letter in pattern must map to a word with length that is at least 1. +""" +__author__ = 'Daniel' + + +class Solution(object): + def wordPattern(self, pattern, s): + lst = s.split(" ") + if len(pattern) != len(lst): + return False + + char2word = {} + words = set() + for i in xrange(len(pattern)): + if pattern[i] in char2word: + if char2word[pattern[i]] != lst[i]: + return False + else: + assert lst[i] in words + else: + if lst[i] in words: + return False + char2word[pattern[i]] = lst[i] + words.add(lst[i]) + + return True + + +class OneToOneMap(object): + def __init__(self): + self.m = {} # keep a single map + + def set(self, a, b): + self.m[a] = b + self.m[b] = a + + def get(self, a): + return self.m.get(a) + + +class SolutionError(object): + def wordPattern(self, pattern, str): + """ + May not always work due to OneToOneMap implementation in the case that a word is 1-letter. + + :type pattern: str + :type str: str + :rtype: bool + """ + m = OneToOneMap() + lst = str.split(" ") + if len(pattern) != len(lst): + return False + + for i in xrange(len(pattern)): + a = m.get(pattern[i]) + b = m.get(lst[i]) + if a is None and b is None: + m.set(pattern[i], lst[i]) + elif a is None and b is not None: + return False + elif a != lst[i]: + return False + + return True + + +if __name__ == "__main__": + assert Solution().wordPattern("abba", "dog cat cat dog") == True diff --git a/291 Word Pattern II.py b/291 Word Pattern II.py new file mode 100644 index 0000000..f9992e6 --- /dev/null +++ b/291 Word Pattern II.py @@ -0,0 +1,49 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Solution(object): + def wordPatternMatch(self, pattern, s): + """ + Backtracking with prune + :type pattern: str + :type s: str + :rtype: bool + """ + return self.dfs(pattern, s, {}, set()) + + def dfs(self, pattern, s, char2word, words): + """ + Loop & DFS + :return: pattern can match s + """ + if not pattern and s or not s and pattern: + return False + + if not pattern and not s: + return True + + + if pattern[0] in char2word: + word = char2word[pattern[0]] + if s[:len(word)] != word: + return False + else: + assert word in words + return self.dfs(pattern[1:], s[len(word):], char2word, words) + else: + for i in xrange(len(s)): + word = s[:i+1] + if word in words: + continue + + char2word[pattern[0]] = word + words.add(word) + if self.dfs(pattern[1:], s[len(word):], char2word, words): + return True + words.remove(word) + del char2word[pattern[0]] + + return False \ No newline at end of file diff --git a/2915 Length of the Longest Subsequence That Sums to Target.py b/2915 Length of the Longest Subsequence That Sums to Target.py new file mode 100644 index 0000000..36cfc48 --- /dev/null +++ b/2915 Length of the Longest Subsequence That Sums to Target.py @@ -0,0 +1,65 @@ +#!/usr/bin/python3 +""" +You are given a 0-indexed array of integers nums, and an integer target. + +Return the length of the longest subsequence of nums that sums up to target. If no such subsequence exists, return -1. + +A subsequence is an array that can be derived from another array by deleting some or no elements without changing the order of the remaining elements. + + + +Example 1: + +Input: nums = [1,2,3,4,5], target = 9 +Output: 3 +Explanation: There are 3 subsequences with a sum equal to 9: [4,5], [1,3,5], and [2,3,4]. The longest subsequences are [1,3,5], and [2,3,4]. Hence, the answer is 3. +Example 2: + +Input: nums = [4,1,3,2,1,5], target = 7 +Output: 4 +Explanation: There are 5 subsequences with a sum equal to 7: [4,3], [4,1,2], [4,2,1], [1,1,5], and [1,3,2,1]. The longest subsequence is [1,3,2,1]. Hence, the answer is 4. +Example 3: + +Input: nums = [1,1,5,4,5], target = 3 +Output: -1 +Explanation: It can be shown that nums has no subsequence that sums up to 3. + + +Constraints: + +1 <= nums.length <= 1000 +1 <= nums[i] <= 1000 +1 <= target <= 1000 +""" + + +class Solution: + def lengthOfLongestSubsequence(self, nums: List[int], target: int) -> int: + cur = {0: 0, nums[0]: 1} + for i in range(1, len(nums)): + nxt = {} + for sm, l in cur.items(): + # Take + sm_nxt = sm + nums[i] + if sm_nxt > target: + # prune + continue + + l_nxt = l + 1 + if sm_nxt in cur: + l_nxt = max(l_nxt, cur[sm_nxt]) + if sm_nxt in nxt: + l_nxt = max(l_nxt, nxt[sm_nxt]) + nxt[sm_nxt] = l_nxt + + # Not take, merge + for sm, l in cur.items(): + if sm not in nxt: + nxt[sm] = l + + cur = nxt + + if target in cur: + return cur[target] + + return -1 \ No newline at end of file diff --git a/292 Nim Game.py b/292 Nim Game.py new file mode 100644 index 0000000..4444651 --- /dev/null +++ b/292 Nim Game.py @@ -0,0 +1,60 @@ +""" +You are playing the following Nim Game with your friend: There is a heap of stones on the table, each time one of you +take turns to remove 1 to 3 stones. The one who removes the last stone will be the winner. You will take the first turn +to remove the stones. + +Both of you are very clever and have optimal strategies for the game. Write a function to determine whether you can win +the game given the number of stones in the heap. + +For example, if there are 4 stones in the heap, then you will never win the game: no matter 1, 2, or 3 stones you remove +, the last stone will always be removed by your friend. +""" +__author__ = 'Daniel' + + +class Solution(object): + def canWinNim(self, n): + """ + Enumerate example and find the pattern + """ + return n % 4 != 0 + + def canWinNim_TLE(self, n): + """ + dp + + Let F[i] be the whether act & win when there is i stones left + :type n: int + :rtype: bool + """ + if n < 3: + return True + + F = [False for _ in xrange(3)] + F[1] = F[2] = F[0] = True + for i in xrange(4, n+1): + F[i%3] = any(not F[(i-k)%3] for k in xrange(1, 4)) + + return F[n%3] + + def canWinNim_MLE(self, n): + """ + dp + + Let F[i] be the whether act & win when there is i stones left + :type n: int + :rtype: bool + """ + if n < 3: + return True + + F = [False for _ in xrange(n+1)] + F[1] = F[2] = F[3] = True + for i in xrange(4, n+1): + F[i] = any(not F[i-k] for k in xrange(1, 4)) + + return F[n] + + +if __name__ == "__main__": + assert Solution().canWinNim(5) \ No newline at end of file diff --git a/293 Flip Game.py b/293 Flip Game.py new file mode 100644 index 0000000..909b908 --- /dev/null +++ b/293 Flip Game.py @@ -0,0 +1,19 @@ +""" +Premium Question +Straightforward +""" +__author__ = 'Daniel' + + +class Solution(object): + def generatePossibleNextMoves(self, s): + """ + :type s: str + :rtype: List[str] + """ + ret = [] + for i in xrange(len(s)-1): + if s[i:i+2] == "++": + ret.append(s[:i]+"--"+s[i+2:]) + + return ret \ No newline at end of file diff --git a/294 Flip Game II.py b/294 Flip Game II.py new file mode 100644 index 0000000..17c7e11 --- /dev/null +++ b/294 Flip Game II.py @@ -0,0 +1,46 @@ +""" +Premium Question +Game, Winner, Backtracking +""" +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.d = {} + + def canWin(self, s): + """ + memoization + 110ms + """ + if s not in self.d: + flag = False + for i in xrange(len(s)-1): + if s[i:i+2] == "++": + if not self.canWin(s[:i]+"--"+s[i+2:]): + flag = True + break + self.d[s] = flag + + return self.d[s] + + def canWin_oneline(self, s): + return any(not self.canWin_oneline(s[:i]+"--"+s[i+2:]) for i in xrange(len(s)-1) if s[i:i+2] == "++") + + def canWin_trivial(self, s): + """ + 3200 ms + :type s: str + :rtype: bool + """ + for i in xrange(len(s)-1): + if s[i:i+2] == "++": + if not self.canWin_trivial(s[:i]+"--"+s[i+2:]): + return True + + return False + + +if __name__ == "__main__": + assert Solution().canWin("+++++") == False \ No newline at end of file diff --git a/2944 Minimum Number of Coins for Fruits.py b/2944 Minimum Number of Coins for Fruits.py new file mode 100644 index 0000000..451ed48 --- /dev/null +++ b/2944 Minimum Number of Coins for Fruits.py @@ -0,0 +1,117 @@ +""" +You are given an 0-indexed integer array prices where prices[i] denotes the number of coins needed to purchase the (i + 1)th fruit. + +The fruit market has the following reward for each fruit: + +If you purchase the (i + 1)th fruit at prices[i] coins, you can get any number of the next i fruits for free. +Note that even if you can take fruit j for free, you can still purchase it for prices[j - 1] coins to receive its reward. + +Return the minimum number of coins needed to acquire all the fruits. + + + +Example 1: + +Input: prices = [3,1,2] + +Output: 4 + +Explanation: + +Purchase the 1st fruit with prices[0] = 3 coins, you are allowed to take the 2nd fruit for free. +Purchase the 2nd fruit with prices[1] = 1 coin, you are allowed to take the 3rd fruit for free. +Take the 3rd fruit for free. +Note that even though you could take the 2nd fruit for free as a reward of buying 1st fruit, you purchase it to receive its reward, which is more optimal. + +Example 2: + +Input: prices = [1,10,1,1] + +Output: 2 + +Explanation: + +Purchase the 1st fruit with prices[0] = 1 coin, you are allowed to take the 2nd fruit for free. +Take the 2nd fruit for free. +Purchase the 3rd fruit for prices[2] = 1 coin, you are allowed to take the 4th fruit for free. +Take the 4th fruit for free. +Example 3: + +Input: prices = [26,18,6,12,49,7,45,45] + +Output: 39 + +Explanation: + +Purchase the 1st fruit with prices[0] = 26 coin, you are allowed to take the 2nd fruit for free. +Take the 2nd fruit for free. +Purchase the 3rd fruit for prices[2] = 6 coin, you are allowed to take the 4th, 5th and 6th (the next three) fruits for free. +Take the 4th fruit for free. +Take the 5th fruit for free. +Purchase the 6th fruit with prices[5] = 7 coin, you are allowed to take the 8th and 9th fruit for free. +Take the 7th fruit for free. +Take the 8th fruit for free. +Note that even though you could take the 6th fruit for free as a reward of buying 3rd fruit, you purchase it to receive its reward, which is more optimal. + + + +Constraints: + +1 <= prices.length <= 1000 +1 <= prices[i] <= 10&5 +""" +import sys +import math +from collections import deque + + +class Solution: + def minimumCoinsLoop(self, A: List[int]) -> int: + """ + F[i] be the minimum to acuquire all A[:i+1] and BUY A[i] + F[i] = min( + F[i-1] + ... + F[j] + ) + A[i] + where j + (j + 1) >= i - 1 + j >= math.ceil(i / 2) - 1 + + In the end, return min(F[j..N-1]) + j + (j + 1) >= N - 1 + j >= math.ceil(N / 2) - 1 + """ + N = len(A) + F = [sys.maxsize for _ in range(N)] + F[0] = A[0] + for i in range(1, N): + for j in range(math.ceil(i/2) - 1 , i): + F[i] = min(F[i], F[j] + A[i]) + + return min(F[i] for i in range(math.ceil(N/2)-1, N)) + + def minimumCoins(self, A: List[int]) -> int: + """ + DP formulation see above + + Use monotonic queue to calculate min(F[i-1]...F[j]) + """ + N = len(A) + F = [sys.maxsize for _ in range(N)] + F[0] = A[0] + q_min = deque() # keep track 1st, 2nd 3rd... min, monotonically increasing + for i in range(1, N): + # process A[i-1] + while q_min and F[q_min[~0]] >= F[i-1]: + q_min.pop() + q_min.append(i-1) # we need to put i-1 in the queue + + # proess left + while q_min and q_min[0] < math.ceil(i/2) - 1: + q_min.popleft() + + F[i] = F[q_min[0]] + A[i] + + return min(F[i] for i in range(math.ceil(N/2) - 1, N)) + + \ No newline at end of file diff --git a/295 Find Median from Data Stream.py b/295 Find Median from Data Stream.py new file mode 100644 index 0000000..137014d --- /dev/null +++ b/295 Find Median from Data Stream.py @@ -0,0 +1,92 @@ +# -*- coding: utf-8 -*- +""" +Median is the middle value in an ordered integer list. If the size of the list is even, there is no middle value. So the +median is the mean of the two middle value. + +Examples: +[2,3,4] , the median is 3 + +[2,3], the median is (2 + 3) / 2 = 2.5 + +Design a data structure that supports the following two operations: + +void addNum(int num) - Add a integer number from the data stream to the data structure. +double findMedian() - Return the median of all elements so far. +For example: + +add(1) +add(2) +findMedian() -> 1.5 +add(3) +findMedian() -> 2 +""" +import heapq + +__author__ = 'Daniel' + + +class DualHeap(object): + def __init__(self): + """ + Dual Heap is great in the case where there is no removal. + + ----------> number line + Δ Δ + max min + """ + self.min_h = [] + self.max_h = [] + + def insert(self, num): + if not self.min_h or num > self.min_h[0]: + heapq.heappush(self.min_h, num) + else: + heapq.heappush(self.max_h, -num) + self.balance() + + def balance(self): + l1 = len(self.min_h) + l2 = len(self.max_h) + if abs(l1 - l2) <= 1: + return + elif l1 - l2 > 1: + heapq.heappush(self.max_h, -heapq.heappop(self.min_h)) + self.balance() + else: + heapq.heappush(self.min_h, -heapq.heappop(self.max_h)) + self.balance() + + def get_median(self): + l1 = len(self.min_h) + l2 = len(self.max_h) + if (l1 + l2) % 2 == 1: + m = (l1 + l2) / 2 # median index, equivalent to (l1 + l2 - 1) / 2 + if m < l2: + return -self.max_h[0] + else: + return self.min_h[0] + else: + return (-self.max_h[0] + self.min_h[0]) / 2.0 + + +class MedianFinder(object): + def __init__(self): + """ + Initialize your data structure here. + """ + self.dh = DualHeap() + + def addNum(self, num): + """ + Adds a num into the data structure. + :type num: int + :rtype: void + """ + self.dh.insert(num) + + def findMedian(self): + """ + Returns the median of current data stream + :rtype: float + """ + return self.dh.get_median() diff --git a/296 Best Meeting Point.py b/296 Best Meeting Point.py new file mode 100644 index 0000000..b466547 --- /dev/null +++ b/296 Best Meeting Point.py @@ -0,0 +1,45 @@ +""" +Premium Question +Manhattan Distance +""" +__author__ = 'Daniel' + + +class Solution(object): + def minTotalDistance_3lines(self, grid): + x = sorted([i for i, row in enumerate(grid) for v in row if v == 1]) + y = sorted([j for row in grid for j, v in enumerate(row) if v == 1]) + return sum([abs(x[len(x)/2]-i)+abs(y[len(y)/2]-j) for i, row in enumerate(grid) for j, v in enumerate(row) if v == 1]) + + def minTotalDistance(self, grid): + """ + :type grid: List[List[int]] + :rtype: int + """ + x = [] + y = [] + + m = len(grid) + n = len(grid[0]) + for i in xrange(m): + for j in xrange(n): + if grid[i][j] == 1: + x.append(i) + y.append(j) + + x.sort() + y.sort() + cnt = len(x) + point = (x[cnt/2], y[cnt/2]) + ret = 0 + for i in xrange(m): + for j in xrange(n): + if grid[i][j] == 1: + ret += abs(point[0]-i) + ret += abs(point[1]-j) + + return ret + + +if __name__ == "__main__": + assert Solution().minTotalDistance([[1,0,0,0,1],[0,0,0,0,0],[0,0,1,0,0]]) == 6 \ No newline at end of file diff --git a/297 Serialize and Deserialize Binary Tree.py b/297 Serialize and Deserialize Binary Tree.py new file mode 100644 index 0000000..622bb70 --- /dev/null +++ b/297 Serialize and Deserialize Binary Tree.py @@ -0,0 +1,99 @@ +""" +Serialization is the process of converting a data structure or object into a sequence of bits so that it can be stored +in a file or memory buffer, or transmitted across a network connection link to be reconstructed later in the same or +another computer environment. + +Design an algorithm to serialize and deserialize a binary tree. There is no restriction on how your serialization/ +deserialization algorithm should work. You just need to ensure that a binary tree can be serialized to a string and this +string can be deserialized to the original tree structure. + +For example, you may serialize the following tree + + 1 + / \ + 2 3 + / \ + 4 5 +as "[1,2,3,null,null,4,5]", just the same as how LeetCode OJ serializes a binary tree. You do not necessarily need to +follow this format, so please be creative and come up with different approaches yourself. +Note: Do not use class member/global/static variables to store states. Your serialize and deserialize algorithms should +be stateless. +""" +from collections import deque + +__author__ = 'Daniel' + + +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Codec: + def serialize(self, root): + """ + bfs + Encodes a tree to a single string. + + encode to: 1, 2, 3, null, null, 4, 5, null, null, null, null + :type root: TreeNode + :rtype: str + """ + if not root: + return "null" + + ret = [] + q = [] + q.append(root) + ret.append(str(root.val)) # add result when enqueue + while q: + l = len(q) + for i in xrange(l): + cur = q[i] + if cur.left: q.append(cur.left) + ret.append(self.encode(cur.left)) + if cur.right: q.append(cur.right) + ret.append(self.encode(cur.right)) + + q = q[l:] + + return ",".join(ret) + + def deserialize(self, data): + """ + Decodes your encoded data to tree. + decode: 1, 2, 3, null, null, 4, 5, null, null, null, null + :type data: str + :rtype: TreeNode + """ + lst = data.split(",") + root = self.decode(lst[0]) + + q = deque([root]) + i = 1 + while q: + cur = q.popleft() + if i < len(lst): + cur.left = self.decode(lst[i]) + i += 1 + if cur.left: q.append(cur.left) + if i < len(lst): + cur.right = self.decode(lst[i]) + i += 1 + if cur.right: q.append(cur.right) + + return root + + def decode(self, s): + if s == "null": + return None + else: + return TreeNode(int(s)) + + def encode(self, node): + if not node: + return "null" + else: + return str(node.val) diff --git a/298 Binary Tree Longest Consecutive Sequence.py b/298 Binary Tree Longest Consecutive Sequence.py new file mode 100644 index 0000000..3738fab --- /dev/null +++ b/298 Binary Tree Longest Consecutive Sequence.py @@ -0,0 +1,60 @@ +""" +Premium Question +Recursive +Longest Consecutive Subsequence in BT +""" +__author__ = 'Daniel' + + +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution(object): + def __init__(self): + self.gmax = 0 + + def longestConsecutive(self, root): + self.longest(root) + return self.gmax + + def longest(self, cur): + """ + longest ended at root + Only consider increasing order + """ + if not cur: + return 0 + + maxa = 1 + l = self.longest(cur.left) + r = self.longest(cur.right) + if cur.left and cur.val+1 == cur.left.val: + maxa = max(maxa, l+1) + if cur.right and cur.val+1 == cur.right.val: + maxa = max(maxa, r+1) + + self.gmax = max(self.gmax, maxa) + return maxa + + def longestConsecutive_error(self, root): + """ + :type root: TreeNode + :rtype: int + """ + if not root: + return 0 + + maxa = 1 + l = self.longestConsecutive(root.left) + r = self.longestConsecutive(root.right) + maxa = max(maxa, l, r) + if root.left and root.val + 1 == root.left.val: + maxa = max(maxa, l+1) + if root.right and root.val + 1 == root.right.val: + maxa = max(maxa, r+1) + + return maxa \ No newline at end of file diff --git a/299 Bulls and Cows.py b/299 Bulls and Cows.py new file mode 100644 index 0000000..26a05f5 --- /dev/null +++ b/299 Bulls and Cows.py @@ -0,0 +1,41 @@ +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def getHint(self, secret, guess): + """ + Need to revert B + + Example: + 1121 + 2323 + + :type secret: str + :type guess: str + :rtype: str + """ + cnt = defaultdict(int) + A = 0 + B = 0 + for c in secret: + cnt[c] += 1 + + for i, v in enumerate(guess): + if v == secret[i]: + A += 1 + if cnt[v] > 0: + cnt[v] -= 1 + else: + B -= 1 + + elif cnt[v] > 0: + B += 1 + cnt[v] -= 1 + + return "%dA%dB" % (A, B) + + +if __name__ == "__main__": + assert Solution().getHint("0", "1") == "0A0B" diff --git a/300 Longest Increasing Subsequence py3.py b/300 Longest Increasing Subsequence py3.py new file mode 100644 index 0000000..f587209 --- /dev/null +++ b/300 Longest Increasing Subsequence py3.py @@ -0,0 +1,41 @@ +#!/usr/bin/python3 +""" +Given an unsorted array of integers, find the length of longest increasing +subsequence. + +Example: + +Input: [10,9,2,5,3,7,101,18] +Output: 4 +Explanation: The longest increasing subsequence is [2,3,7,101], therefore the +length is 4. +Note: + +There may be more than one LIS combination, it is only necessary for you to +return the length. +Your algorithm should run in O(n2) complexity. +Follow up: Could you improve it to O(n log n) time complexity? +""" +from typing import List +from bisect import bisect_left + + +class Solution: + def lengthOfLIS(self, nums: List[int]) -> int: + """ + LIS dp + binary search + Patience sort + F maintains a increasing array + F[i] stores the position of A[j] in the F + + For easch position i, the F[i]_old > F[i]_new, but A[j_old] < A[j_new] + + """ + F = [float('inf') for _ in nums] + l = 0 + for n in nums: + i = bisect_left(F, n) # consider equal elements [2, 2] + F[i] = n + l = max(l, i + 1) + + return l diff --git a/300 Longest Increasing Subsequence.py b/300 Longest Increasing Subsequence.py new file mode 100644 index 0000000..009abde --- /dev/null +++ b/300 Longest Increasing Subsequence.py @@ -0,0 +1,123 @@ +""" +Given an unsorted array of integers, find the length of longest increasing subsequence. + +For example, +Given [10, 9, 2, 5, 3, 7, 101, 18], +The longest increasing subsequence is [2, 3, 7, 101], therefore the length is 4. Note that there may be more than one +LIS combination, it is only necessary for you to return the length. + +Your algorithm should run in O(n2) complexity. + +Follow up: Could you improve it to O(n log n) time complexity? +""" +import bisect + +__author__ = 'Daniel' + + +class Solution(object): + def lengthOfLIS(self, A): + """ + MIN: min of index last value of LIS of a particular length + :type A: List[int] + :rtype: int + """ + if not A: + return 0 + + n = len(A) + MIN = [-1 for _ in xrange(n+1)] + k = 1 + MIN[k] = A[0] # store value rather than index + for v in A[1:]: + idx = bisect.bisect_left(MIN, v, 1, k+1) + MIN[idx] = v + k += 1 if idx == k+1 else 0 + + return k + + def bin_search(self, M, A, t, lo=0, hi=None): + if not hi: hi = len(M) + while lo < hi: + m = (lo+hi)/2 + if A[M[m]] == t: + return m + elif A[M[m]] < t: + lo = m + 1 + else: + hi = m + + return lo + + def lengthOfLIS_output_all(self, A): + """ + Maintain the result of LIS + MIN: min of index last value of LIS of a particular length + RET: result table, store the predecessor's idx (optional) + :type A: List[int] + :rtype: int + """ + if not A: + return 0 + + n = len(A) + MIN = [-1 for _ in xrange(n+1)] + RET = [-1 for _ in xrange(n)] + l = 1 + MIN[l] = 0 + for i in xrange(1, n): + if A[i] > A[MIN[l]]: + l += 1 + MIN[l] = i + + RET[i] = MIN[l-1] # (optional) + else: + j = self.bin_search(MIN, A, A[i], 1, l+1) + MIN[j] = i + + RET[i] = MIN[j-1] if j-1 >= 1 else -1 # (optional) + + # build the LIS (optional) + cur = MIN[l] + ret = [] + while True: + ret.append(A[cur]) + if RET[cur] == -1: break + cur = RET[cur] + + ret = ret[::-1] + print ret + + return l + + def lengthOfLIS_dp(self, A): + """ + dp + + let F[i] be the LIS length ends at A[i] + F[i] = max(F[j]+1 for all j < i if A[i] > A[j]) + + avoid max() arg is an empty sequence + + O(n^2) + :type nums: List[int] + :rtype: int + """ + if not A: + return 0 + + n = len(A) + F = [1 for _ in xrange(n)] + maxa = 1 + for i in xrange(1, n): + F[i] = max( + F[j] + 1 if A[i] > A[j] else 1 + for j in xrange(i) + ) + maxa = max(maxa, F[i]) + + return maxa + + +if __name__ == "__main__": + assert Solution().lengthOfLIS([10, 9, 2, 5, 3, 7, 101, 18]) == 4 \ No newline at end of file diff --git a/301 Remove Invalid Parentheses.py b/301 Remove Invalid Parentheses.py new file mode 100644 index 0000000..3614acf --- /dev/null +++ b/301 Remove Invalid Parentheses.py @@ -0,0 +1,82 @@ +""" +Remove the minimum number of invalid parentheses in order to make the input string valid. Return all possible results. + +Note: The input string may contain letters other than the parentheses ( and ). + +Examples: +"()())()" -> ["()()()", "(())()"] +"(a)())()" -> ["(a)()()", "(a())()"] +")(" -> [""] + +""" +__author__ = 'Daniel' + + +class Solution(object): + def removeInvalidParentheses(self, s): + """ + Brute force: BFS and then validate + + Algorithm focuses on left parentheses + Backtracking/DFS with prune & jump + + :type s: str + :rtype: List[str] + """ + rmcnt = self.minrm(s) + ret = [] + self.dfs(s, "", 0, None, 0, rmcnt, ret) + return ret + + def minrm(self, s): + """ + Find the minimal removal count to limit the search depth + returns minimal number of removals + """ + rmcnt = 0 + left = 0 + for c in s: + if c == "(": + left += 1 + elif c == ")": + if left > 0: + left -= 1 + else: + rmcnt += 1 + + rmcnt += left + return rmcnt + + def dfs(self, s, cur, left, pi, i, rmcnt, ret): + """ + Remove parenthesis + backtracking, post-check + :param s: original string + :param cur: current string builder + :param left: number of remaining left parentheses in s[0..i] not consumed by ")" + :param pi: last removed char + :param i: current index + :param rmcnt: number of remaining removals needed + :param ret: results + """ + if left < 0 or rmcnt < 0 or i > len(s): + return + if i == len(s): + if rmcnt == 0 and left == 0: + ret.append(cur) + return + + if s[i] not in ("(", ")"): # skip non-parenthesis + self.dfs(s, cur+s[i], left, None, i+1, rmcnt, ret) + else: + if pi == s[i]: # jump, if rm, rm them all to avoid duplication + while i < len(s) and pi and pi == s[i]: i, rmcnt = i+1, rmcnt-1 + self.dfs(s, cur, left, pi, i, rmcnt, ret) + else: + self.dfs(s, cur, left, s[i], i+1, rmcnt-1, ret) + L = left+1 if s[i] == "(" else left-1 # consume "(" + self.dfs(s, cur+s[i], L, None, i+1, rmcnt, ret) # put + + +if __name__ == "__main__": + assert Solution().removeInvalidParentheses("(a)())()") == ['(a())()', '(a)()()'] diff --git a/302 Smallest Rectangle Enclosing Black Pixels.py b/302 Smallest Rectangle Enclosing Black Pixels.py new file mode 100644 index 0000000..a6e8879 --- /dev/null +++ b/302 Smallest Rectangle Enclosing Black Pixels.py @@ -0,0 +1,40 @@ +""" +Premium Question +Projection and bisect +""" +import bisect +__author__ = 'Daniel' + + +class Solution(object): + def minArea(self, image, x, y): + """ + :type image: List[List[str]] + :type x: int + :type y: int + :rtype: int + """ + m, n = len(image), len(image[0]) + yaxis = [ + 1 if any(image[i][j] == "1" for i in xrange(m)) else 0 + for j in xrange(n) + ] + xaxis = [ + 1 if any(image[i][j] == "1" for j in xrange(n)) else 0 + for i in xrange(m) + ] + + y_lo = bisect.bisect_left(yaxis, 1, 0, y) + y_hi = bisect.bisect_left(map(lambda e: 1^e, yaxis), 1, y) # bisect must be sorted + x_lo = bisect.bisect_left(xaxis, 1, 0, x) + x_hi = bisect.bisect_left(map(lambda e: 1^e, xaxis), 1, x) + return (y_hi-y_lo)*(x_hi-x_lo) + + +if __name__ == "__main__": + image = [ + "00", + "10", + ] + + assert Solution().minArea(image, 1, 0) == 1 \ No newline at end of file diff --git a/303 Range Sum Query - Immutable.py b/303 Range Sum Query - Immutable.py new file mode 100644 index 0000000..818fa75 --- /dev/null +++ b/303 Range Sum Query - Immutable.py @@ -0,0 +1,37 @@ +""" +Given an integer array nums, find the sum of the elements between indices i and j (i <= j), inclusive. + +Example: +Given nums = [-2, 0, 3, -5, 2, -1] + +sumRange(0, 2) -> 1 +sumRange(2, 5) -> -1 +sumRange(0, 5) -> -3 +Note: +You may assume that the array does not change. +There are many calls to sumRange function. + +""" +__author__ = 'Daniel' + + +class NumArray(object): + def __init__(self, nums): + """ + initialize your data structure here. + dp + :type nums: List[int] + """ + n = len(nums) + self.F = [0 for _ in xrange(n+1)] + for i in xrange(1, n+1): + self.F[i] = self.F[i-1] + nums[i-1] + + def sumRange(self, i, j): + """ + sum of elements nums[i..j], inclusive. + :type i: int + :type j: int + :rtype: int + """ + return self.F[j+1] - self.F[i] \ No newline at end of file diff --git a/304 Range Sum Query 2D - Immutable.py b/304 Range Sum Query 2D - Immutable.py new file mode 100644 index 0000000..49671b5 --- /dev/null +++ b/304 Range Sum Query 2D - Immutable.py @@ -0,0 +1,55 @@ +# -*- coding: utf-8 -*- +""" +Given a 2D matrix matrix, find the sum of the elements inside the rectangle defined by its upper left corner (row1, +col1) and lower right corner (row2, col2). + +Range Sum Query 2D +The above rectangle (with the red border) is defined by (row1, col1) = (2, 1) and (row2, col2) = (4, 3), which contains +sum = 8. + +Example: +Given matrix = [ + [3, 0, 1, 4, 2], + [5, 6, 3, 2, 1], + [1, 2, 0, 1, 5], + [4, 1, 0, 1, 7], + [1, 0, 3, 0, 5] +] + +sumRegion(2, 1, 4, 3) -> 8 +sumRegion(1, 1, 2, 2) -> 11 +sumRegion(1, 2, 2, 4) -> 12 +Note: +You may assume that the matrix does not change. +There are many calls to sumRegion function. +You may assume that row1 ≤ row2 and col1 ≤ col2. +""" +__author__ = 'Daniel' + + +class NumMatrix(object): + def __init__(self, matrix): + """ + initialize your data structure here. + dp F[i][j] = F[i-1][j]+F[i][j-1]-F[i-1][j-1]+mat[i][j] + :type matrix: List[List[int]] + """ + m = len(matrix) + if m == 0: + self.F = None + return + + n = len(matrix[0]) + self.F = [[0 for _ in xrange(n+1)] for _ in xrange(m+1)] + for i in xrange(1, m+1): + for j in xrange(1, n+1): + self.F[i][j] = self.F[i-1][j]+self.F[i][j-1]-self.F[i-1][j-1]+matrix[i-1][j-1] + + def sumRegion(self, row1, col1, row2, col2): + """ + sum of elements matrix[(row1,col1)..(row2,col2)], inclusive. + """ + if not self.F: + return 0 + + return self.F[row2+1][col2+1] - self.F[row2+1][col1] - self.F[row1][col2+1] + self.F[row1][col1] \ No newline at end of file diff --git a/305 Number of Islands II.py b/305 Number of Islands II.py new file mode 100644 index 0000000..d48a0ef --- /dev/null +++ b/305 Number of Islands II.py @@ -0,0 +1,74 @@ +""" +Premium Question +""" +from collections import namedtuple + +__author__ = 'Daniel' + + +class UnionFind(object): + """ + Weighted Union Find with path compression + """ + def __init__(self, rows, cols): + # hashing will cause TLE; use direct array access instead + self.pi = [-1 for _ in xrange(rows*cols)] # item -> pi + self.sz = [-1 for _ in xrange(rows*cols)] # root -> size + self.count = 0 + + def add(self, item): + if self.pi[item] == -1: + self.pi[item] = item + self.sz[item] = 1 + self.count += 1 + + def union(self, a, b): + pi1 = self._pi(a) + pi2 = self._pi(b) + + if pi1 != pi2: + if self.sz[pi1] > self.sz[pi2]: + pi1, pi2 = pi2, pi1 + + self.pi[pi1] = pi2 + self.sz[pi2] += self.sz[pi1] + self.count -= 1 + + def _pi(self, item): + """ + Get root with path compression + """ + pi = self.pi[item] + if item != pi: + self.pi[item] = self._pi(pi) + + return self.pi[item] + + +Op = namedtuple('Op', 'r c') # row col + + +class Solution: + def __init__(self): + self.dirs = ((-1, 0), (1, 0), (0, -1), (0, 1)) + + def numIslands2(self, n, m, operators): + rows = n + cols = m + unroll = lambda x, y: x*cols + y # hash will be slower + mat = [[0 for _ in xrange(cols)] for _ in xrange(rows)] + uf = UnionFind(rows, cols) + ret = [] + for op in operators: + op = Op(r=op[0], c=op[1]) + uf.add(unroll(op.r, op.c)) + mat[op.r][op.c] = 1 + for dir in self.dirs: + x1 = op.r+dir[0] + y1 = op.c+dir[1] + if 0 <= x1 < rows and 0 <= y1 < cols and mat[x1][y1] == 1: + uf.union(unroll(op.r, op.c), unroll(x1, y1)) + + ret.append(uf.count) + + return ret \ No newline at end of file diff --git a/306 Additive Number.py b/306 Additive Number.py new file mode 100644 index 0000000..9fb1f98 --- /dev/null +++ b/306 Additive Number.py @@ -0,0 +1,53 @@ +""" +Additive number is a positive integer whose digits can form additive sequence. + +A valid additive sequence should contain at least three numbers. Except for the first two numbers, each subsequent +number in the sequence must be the sum of the preceding two. + +For example: +"112358" is an additive number because the digits can form an additive sequence: 1, 1, 2, 3, 5, 8. + +1 + 1 = 2, 1 + 2 = 3, 2 + 3 = 5, 3 + 5 = 8 +"199100199" is also an additive number, the additive sequence is: 1, 99, 100, 199. +1 + 99 = 100, 99 + 100 = 199 +Note: Numbers in the additive sequence cannot have leading zeros, so sequence 1, 2, 03 or 1, 02, 3 is invalid. + +Given a string represents an integer, write a function to determine if it's an additive number. +""" +__author__ = 'Daniel' + + +class Solution(object): + def isAdditiveNumber(self, num): + """ + Backtracking + :type num: str + :rtype: bool + """ + n = len(num) + for i in xrange(1, n): + for j in xrange(i, n): + if self.predicate(num, 0, i, j): + return True + + return False + + def predicate(self, s, b, i, j): + n1 = s[b:i] + n2 = s[i:j] + + if b != 0 and j == len(s): + return True + if not n1 or not n2: + return False + if len(n1) > 1 and n1[0] == '0' or len(n2) > 1 and n2[0] == '0': + return False + + n3 = str(int(n1)+int(n2)) + J = j+len(n3) + if s[j:J] == n3: + return self.predicate(s, i, j, J) + + +if __name__ == "__main__": + assert Solution().isAdditiveNumber("12012122436") \ No newline at end of file diff --git a/307 Range Sum Query - Mutable.py b/307 Range Sum Query - Mutable.py new file mode 100644 index 0000000..473b346 --- /dev/null +++ b/307 Range Sum Query - Mutable.py @@ -0,0 +1,70 @@ +# -*- coding: utf-8 -*- +""" +Given an integer array nums, find the sum of the elements between indices i and j (i ≤ j), inclusive. + +The update(i, val) function modifies nums by updating the element at index i to val. +Example: +Given nums = [1, 3, 5] + +sumRange(0, 2) -> 9 +update(1, 2) +sumRange(0, 2) -> 8 +Note: +The array is only modifiable by the update function. +You may assume the number of calls to update and sumRange function is distributed evenly. +""" +__author__ = 'Daniel' + + +class BinaryIndexTree(object): + def __init__(self, nums): + """BIT 0 is dummy root""" + n = len(nums) + self.nums = [0 for _ in xrange(n+1)] + self.N = [0 for _ in xrange(n+1)] + for i, v in enumerate(nums): + self.set(i+1, v) + + def _lowbit(self, a): + return a & -a + + def set(self, i, val): + diff = val - self.nums[i] + self.nums[i] = val + while i < len(self.N): + self.N[i] += diff + i += self._lowbit(i) + + def get(self, i): + ret = 0 + while i > 0: + ret += self.N[i] + i -= self._lowbit(i) + + return ret + + +class NumArray(object): + def __init__(self, nums): + """ + initialize your data structure here. + :type nums: List[int] + """ + self.bit = BinaryIndexTree(nums) + + def update(self, i, val): + """ + :type i: int + :type val: int + :rtype: int + """ + self.bit.set(i+1, val) + + def sumRange(self, i, j): + """ + sum of elements nums[i..j], inclusive. + :type i: int + :type j: int + :rtype: int + """ + return self.bit.get(j+1)-self.bit.get(i) \ No newline at end of file diff --git a/309 Best Time to Buy and Sell Stock with Cooldown.py b/309 Best Time to Buy and Sell Stock with Cooldown.py new file mode 100644 index 0000000..7cc696d --- /dev/null +++ b/309 Best Time to Buy and Sell Stock with Cooldown.py @@ -0,0 +1,57 @@ +""" +Say you have an array for which the ith element is the price of a given stock on day i. + +Design an algorithm to find the maximum profit. You may complete as many transactions as you like (ie, buy one and sell +one share of the stock multiple times) with the following restrictions: + +You may not engage in multiple transactions at the same time (ie, you must sell the stock before you buy again). +After you sell your stock, you cannot buy stock on next day. (ie, cooldown 1 day) +Example: + +prices = [1, 2, 3, 0, 2] +maxProfit = 3 +transactions = [buy, sell, cooldown, buy, sell] +""" +__author__ = 'Daniel' + + +class Solution(object): + def maxProfit(self, A): + """ + O(n^2) + Let F[i] be max profit from day 0 to day i, selling stock at day i + Let M[i] be max profit from day 0 to day i. + + F[i] = max( + F[i-1]+A[i]-A[i-1], // Sell the stock held for multiple days + // i.e. revert previous transaction, sell at day i instead of day (i-1) + M[i-3]+A[i]-A[i-1] // Sell the stock held for 1 day. + ) + M[i] = max(M[i-1], F[i]) + :type A: List[int] + :rtype: int + """ + n = len(A) + if n == 0 or n == 1: + return 0 + if n == 2: + return max(0, A[1]-A[0]) + + CD = 1 # cool down + F = [0 for _ in xrange(n)] + M = [0 for _ in xrange(n)] + F[1] = A[1]-A[0] + M[1] = max(M[0], F[1]) + F[2] = max(A[2]-A[2-1-i] for i in xrange(2)) + M[2] = max(M[1], F[2]) + + # core + for i in xrange(3, n): + F[i] = max(F[i-1]+A[i]-A[i-1], M[i-2-CD]+A[i]-A[i-1]) + M[i] = max(M[i-1], F[i]) + + return M[-1] + + +if __name__ == "__main__": + assert Solution().maxProfit([1, 2, 3, 0, 2]) == 3 \ No newline at end of file diff --git a/3092 Most Frequent IDs.py b/3092 Most Frequent IDs.py new file mode 100644 index 0000000..a393331 --- /dev/null +++ b/3092 Most Frequent IDs.py @@ -0,0 +1,69 @@ +""" +The problem involves tracking the frequency of IDs in a collection that changes over time. You have two integer arrays, nums and freq, of equal length n. Each element in nums represents an ID, and the corresponding element in freq indicates how many times that ID should be added to or removed from the collection at each step. + +Addition of IDs: If freq[i] is positive, it means freq[i] IDs with the value nums[i] are added to the collection at step i. +Removal of IDs: If freq[i] is negative, it means -freq[i] IDs with the value nums[i] are removed from the collection at step i. +Return an array ans of length n, where ans[i] represents the count of the most frequent ID in the collection after the ith step. If the collection is empty at any step, ans[i] should be 0 for that step. + + + +Example 1: + +Input: nums = [2,3,2,1], freq = [3,2,-3,1] + +Output: [3,3,2,2] + +Explanation: + +After step 0, we have 3 IDs with the value of 2. So ans[0] = 3. +After step 1, we have 3 IDs with the value of 2 and 2 IDs with the value of 3. So ans[1] = 3. +After step 2, we have 2 IDs with the value of 3. So ans[2] = 2. +After step 3, we have 2 IDs with the value of 3 and 1 ID with the value of 1. So ans[3] = 2. + +Example 2: + +Input: nums = [5,5,3], freq = [2,-2,1] + +Output: [2,0,1] + +Explanation: + +After step 0, we have 2 IDs with the value of 5. So ans[0] = 2. +After step 1, there are no IDs. So ans[1] = 0. +After step 2, we have 1 ID with the value of 3. So ans[2] = 1. + + + +Constraints: + +1 <= nums.length == freq.length <= 10^5 +1 <= nums[i] <= 10^5 +-10^5 <= freq[i] <= 10^5 +freq[i] != 0 +The input is generated such that the occurrences of an ID will not be negative in any step. +""" +from collections import defaultdict +import heapq + + +class Solution: + def mostFrequentIDs(self, nums: List[int], freq: List[int]) -> List[int]: + """ + Priority queue. TreeMap. Binary Search Tree with update + --> Python heap with stale check + """ + counter = defaultdict(int) + h = [] + ret = [] + for n, cnt in zip(nums, freq): + counter[n] += cnt + heapq.heappush(h, (-counter[n], n)) + while True: + c, maxa = h[0] + if c != -counter[maxa]: + heapq.heappop(h) + else: + ret.append(-c) + break + + return ret diff --git a/310 Minimum Height Trees.py b/310 Minimum Height Trees.py new file mode 100644 index 0000000..96f8120 --- /dev/null +++ b/310 Minimum Height Trees.py @@ -0,0 +1,196 @@ +""" +For a undirected graph with tree characteristics, we can choose any node as the root. The result graph is then a rooted +tree. Among all possible rooted trees, those with minimum height are called minimum height trees (MHTs). Given such a +graph, write a function to find all the MHTs and return a list of their root labels. + +Format +The graph contains n nodes which are labeled from 0 to n - 1. You will be given the number n and a list of undirected +edges (each edge is a pair of labels). + +You can assume that no duplicate edges will appear in edges. Since all edges are undirected, [0, 1] is the same as [1, +0] and thus will not appear together in edges. + +Example 1: + +Given n = 4, edges = [[1, 0], [1, 2], [1, 3]] + + 0 + | + 1 + / \ + 2 3 +return [1] + +Example 2: + +Given n = 6, edges = [[0, 3], [1, 3], [2, 3], [4, 3], [5, 4]] + + 0 1 2 + \ | / + 3 + | + 4 + | + 5 +return [3, 4] +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def findMinHeightTrees(self, n, edges): + """ + Longest path algorithm + Diameter of a tree + :type n: int + :type edges: List[List[int]] + :rtype: List[int] + """ + if not edges: + return [0] + + V = {i: [] for i in xrange(n)} + for a, b in edges: + V[a].append(b) + V[b].append(a) + + # longest path algorithm + _, _, last = self.bfs(0, V) + level, pi, last = self.bfs(last, V) + + ret = [] + cur = last + for _ in xrange((level-1)/2): + cur = pi[cur] + ret.append(cur) + + if level%2 == 0: + ret.append(pi[cur]) + + return ret + + def bfs(self, s, V): + # bfs + visited = [False for _ in xrange(len(V))] + pi = [-1 for _ in xrange(len(V))] + last = s + level = 0 + q = [] + q.append(s) + while q: + l = len(q) + for i in xrange(l): + cur = q[i] + last = cur + visited[cur] = True + for nbr in V[cur]: + if not visited[nbr]: + pi[nbr] = cur + q.append(nbr) + + q = q[l:] + level += 1 + + return level, pi, last + + +class Solution_TLE(object): + def findMinHeightTrees_TLE(self, n, edges): + """ + :type n: int + :type edges: List[List[int]] + :rtype: List[int] + """ + if not edges: + return 0 + + V = {i: [] for i in xrange(n)} + for a, b in edges: + V[a].append(b) + V[b].append(a) + + ret = [] + mini = n + for k in V.keys(): + l = self.bfs(k, V) + if l < mini: + ret = [k] + mini = l + elif l == mini: + ret.append(k) + + return ret + + def bfs(self, s, V): + # bfs + visisted = [False for _ in xrange(len(V))] + q = [] + level = 0 + q.append(s) + while q: + l = len(q) + for i in xrange(l): + cur = q[i] + visisted[cur] = True + for nbr in V[cur]: + if not visisted[nbr]: + q.append(nbr) + + q = q[l:] + level += 1 + + return level + + +class SolutionError(object): + def findMinHeightTrees(self, n, edges): + """ + One pass + :type n: int + :type edges: List[List[int]] + :rtype: List[int] + """ + if not edges: + return 0 + + V = {i: [] for i in xrange(n)} + for a, b in edges: + V[a].append(b) + V[b].append(a) + + leaf = None + for k, v in V.items(): + if len(v) == 1: + leaf = k + break + + # bfs + visisted = [False for _ in xrange(n)] + h2v = defaultdict(list) + q = [] + level = 0 + q.append(leaf) + while q: + l = len(q) + for i in xrange(l): + cur = q[i] + h2v[level].append(cur) + visisted[cur] = True + for nbr in V[cur]: + if not visisted[nbr]: + q.append(nbr) + + q = q[l:] + level += 1 + + if level%2 == 0: + return h2v[level/2-1]+h2v[level/2] + else: + return h2v[level/2] + + +if __name__ == "__main__": + # print Solution().findMinHeightTrees(6, [[3,0],[3,1],[3,2],[3,4],[5,4]]) + assert Solution().findMinHeightTrees(7, [[0, 1], [1, 2], [1, 3], [2, 4], [3, 5], [4, 6]]) == [1, 2] \ No newline at end of file diff --git a/311 Sparse Matrix Multiplication.py b/311 Sparse Matrix Multiplication.py new file mode 100644 index 0000000..8ce75ea --- /dev/null +++ b/311 Sparse Matrix Multiplication.py @@ -0,0 +1,55 @@ +""" +Premium Question +https://leetcode.com/problems/sparse-matrix-multiplication/ +""" +__author__ = 'Daniel' + + +class Solution(object): + def multiply(self, A, B): + """ + Brute force O(n^3) + O(n^2 k) HashMap + Posting list + :type A: List[List[int]] + :type B: List[List[int]] + :rtype: List[List[int]] + """ + m, n = len(A), len(A[0]) + A1 = [{} for _ in xrange(m)] + for i in xrange(m): + for j in xrange(n): + if A[i][j] != 0: + A1[i][j] = A[i][j] + + m, n = len(B), len(B[0]) + B1 = [{} for _ in xrange(n)] + for i in xrange(m): + for j in xrange(n): + if B[i][j] != 0: + B1[j][i] = B[i][j] + + ret = [[0 for _ in xrange(len(B[0]))] for _ in xrange(len(A))] + for i, row in enumerate(A1): + for j, col in enumerate(B1): + s = 0 + for k in row.keys(): + if k in col: + s += row[k]*col[k] + ret[i][j] = s + + return ret + +if __name__ == "__main__": + A = [ + [1, 0, 0], + [-1, 0, 3] + ] + + B = [ + [7, 0, 0], + [0, 0, 0], + [0, 0, 1] + ] + assert Solution().multiply(A, B) == [[7, 0, 0], [-7, 0, 3]] + diff --git a/312 Burst Balloons.py b/312 Burst Balloons.py new file mode 100644 index 0000000..2005399 --- /dev/null +++ b/312 Burst Balloons.py @@ -0,0 +1,56 @@ +# -*- coding: utf-8 -*- +""" +Given n balloons, indexed from 0 to n-1. Each balloon is painted with a number on it represented by array nums. You are +asked to burst all the balloons. If the you burst balloon i you will get nums[left] * nums[i] * nums[right] coins. Here +left and right are adjacent indices of i. After the burst, the left and right then becomes adjacent. + +Find the maximum coins you can collect by bursting the balloons wisely. + +Note: +(1) You may imagine nums[-1] = nums[n] = 1. They are not real therefore you can not burst them. +(2) 0 ≤ n ≤ 500, 0 ≤ nums[i] ≤ 100 + +Example: + +Given [3, 1, 5, 8] + +Return 167 + + nums = [3,1,5,8] --> [3,5,8] --> [3,8] --> [8] --> [] + coins = 3*1*5 + 3*5*8 + 1*3*8 + 1*8*1 = 167 +""" +__author__ = 'Daniel' + + +class Solution(object): + def maxCoins(self, A): + """ + Divide & Conquer <- Divide Boundary <- Reverse Thinking + + Let F[i][j] be the max scores burst all over A[i:j] + F[i][j] = max(F[i][k] + A[i-1]*A[k]*A[j] + F[k+1][j] \forall k) where k is the last one to burst. + + Reference: https://leetcode.com/discuss/72216/share-some-analysis-and-explanations?show=72358#c72358 + :type A: List[int] + :rtype: int + """ + n = len(A) + + def get(i): + if i < 0 or i >= n: return 1 + return A[i] + + F = [[0 for _ in xrange(n+1)] for _ in xrange(n+1)] + for i in xrange(n+1, -1, -1): + for j in xrange(i+1, n+1): + F[i][j] = max( + F[i][k]+get(i-1)*get(k)*get(j)+F[k+1][j] + for k in xrange(i, j) + ) + + return max(map(max, F)) + + +if __name__ == "__main__": + assert Solution().maxCoins([3, 1, 5, 8]) == 167 + diff --git a/313 Super Ugly Number.py b/313 Super Ugly Number.py new file mode 100644 index 0000000..f993427 --- /dev/null +++ b/313 Super Ugly Number.py @@ -0,0 +1,77 @@ +# -*- coding: utf-8 -*- +""" +Write a program to find the nth super ugly number. + +Super ugly numbers are positive numbers whose all prime factors are in the given prime list primes of size k. For +example, [1, 2, 4, 7, 8, 13, 14, 16, 19, 26, 28, 32] is the sequence of the first 12 super ugly numbers given primes = +[2, 7, 13, 19] of size 4. + +Note: +(1) 1 is a super ugly number for any given primes. +(2) The given numbers in primes are in ascending order. +(3) 0 < k ≤ 100, 0 < n ≤ 106, 0 < primes[i] < 1000. +""" +import heapq +from collections import deque +import sys + +__author__ = 'Daniel' + + +class Solution(object): + def nthSuperUglyNumber(self, n, primes): + """ + DP O(kn) + :type n: int + :type primes: List[int] + :rtype: int + """ + k = len(primes) + ret = [sys.maxint for _ in xrange(n)] + ret[0] = 1 + # for each prime, a pointer pointing to the value of next unused number in the result + idxes = [0 for _ in xrange(k)] + for i in xrange(1, n): + for j in xrange(k): + ret[i] = min(ret[i], primes[j]*ret[idxes[j]]) + + for j in xrange(k): + if ret[i] == primes[j]*ret[idxes[j]]: + idxes[j] += 1 + + return ret[n-1] + + +class QueueWrapper(object): + def __init__(self, idx, q): + self.idx = idx + self.q = q + + def __cmp__(self, other): + return self.q[0] - other.q[0] + + +class SolutionHeap(object): + def nthSuperUglyNumber(self, n, primes): + """ + O(k lg k) + O(nk) + :type n: int + :type primes: List[int] + :rtype: int + """ + ret = 1 + h = [QueueWrapper(i, deque([v])) for i, v in enumerate(primes)] + dic = {e.idx: e for e in h} + + heapq.heapify(h) + for _ in xrange(n-1): + mini = heapq.heappop(h) + ret = mini.q.popleft() + for i in xrange(mini.idx, len(primes)): + dic[i].q.append(ret*primes[i]) + heapq.heappush(h, mini) + + return ret + +if __name__ == "__main__": + assert Solution().nthSuperUglyNumber(12, [2, 7, 13, 19]) == 32 \ No newline at end of file diff --git a/314 Binary Tree Vertical Order Traversal.py b/314 Binary Tree Vertical Order Traversal.py new file mode 100644 index 0000000..146c231 --- /dev/null +++ b/314 Binary Tree Vertical Order Traversal.py @@ -0,0 +1,53 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution(object): + def verticalOrder(self, root): + """ + O(N) + :type root: TreeNode + :rtype: List[List[int]] + """ + l = self.leftmost(root, 0) + r = self.rightmost(root, 0) + + ret = [[] for _ in xrange(r-l-1)] + self.bfs(root, -l-1, ret) + return ret + + def bfs(self, cur, col, ret): + q = [] + if cur: + q.append((cur, col)) + + while q: + l = len(q) + for i in xrange(l): # avoid non-stop access as in `for elt in q` + v, c = q[i] + ret[c].append(v.val) + if v.left: q.append((v.left, c-1)) + if v.right: q.append((v.right, c+1)) + + q = q[l:] + + def leftmost(self, cur, l): + if not cur: return l + return min(self.leftmost(cur.left, l-1), self.leftmost(cur.right, l+1)) + + def rightmost(self, cur, r): + if not cur: return r + return max(self.rightmost(cur.left, r-1), self.rightmost(cur.right, r+1)) + + def sidemost(self, cur, p, f): + if not cur: return p + return f(self.sidemost(cur.left, p-1, f), self.sidemost(cur.right, p+1, f)) \ No newline at end of file diff --git a/315 Count of Smaller Numbers After Self.py b/315 Count of Smaller Numbers After Self.py new file mode 100644 index 0000000..539d4e4 --- /dev/null +++ b/315 Count of Smaller Numbers After Self.py @@ -0,0 +1,91 @@ +""" +You are given an integer array nums and you have to return a new counts array. The counts array has the property where +counts[i] is the number of smaller elements to the right of nums[i]. + +Example: + +Given nums = [5, 2, 6, 1] + +To the right of 5 there are 2 smaller elements (2 and 1). +To the right of 2 there is only 1 smaller element (1). +To the right of 6 there is 1 smaller element (1). +To the right of 1 there is 0 smaller element. +Return the array [2, 1, 1, 0]. +""" +__author__ = 'Daniel' + + +class TreeNode(object): + def __init__(self, start, end, cnt=0): + self.start = start + self.end = end + self.cnt = cnt + self.left = None + self.right = None + + +class SegmentTree(object): + def __init__(self, n): + self.root = self.build(0, n) + + def build(self, start, end): + if start >= end: return + if start == end-1: return TreeNode(start, end) + node = TreeNode(start, end) + node.left = self.build(start, (start+end)/2) + node.right = self.build((start+end)/2, end) + return node + + def inc(self, idx, val): + cur = self.root + while cur: + cur.cnt += val + mid = (cur.start+cur.end)/2 + if cur.start <= idx < mid: + cur = cur.left + elif mid <= idx < cur.end: + cur = cur.right + else: + return + + def query_less(self, cur, idx): + if not cur: + return 0 + + mid = (cur.start+cur.end)/2 + if cur.start <= idx < mid: + return self.query_less(cur.left, idx) + elif mid <= idx < cur.end: + return (cur.left.cnt if cur.left else 0) + self.query_less(cur.right, idx) + else: + return 0 + + +class Solution(object): + def countSmaller(self, nums): + """ + Brute force: O(n^2) + Segment Tree + O(n lg n) + :type nums: List[int] + :rtype: List[int] + """ + # preprocess the array to make it discrete in [0, 1, ..., n-1] + h = {} + for i, v in enumerate(sorted(nums)): + h[v] = i # override duplicates + + A = [h[v] for v in nums] + n = len(A) + st = SegmentTree(n) + ret = [] + for i in xrange(n-1, -1, -1): + ret.append(st.query_less(st.root, A[i])) + st.inc(A[i], 1) + + return ret[::-1] + + +if __name__ == "__main__": + assert Solution().countSmaller([5, 2, 6, 1]) == [2, 1, 1, 0] + assert Solution().countSmaller([-1, -1]) == [0, 0] diff --git a/316 Remove Duplicate Letters.py b/316 Remove Duplicate Letters.py new file mode 100644 index 0000000..e8d6907 --- /dev/null +++ b/316 Remove Duplicate Letters.py @@ -0,0 +1,45 @@ +""" +Given a string which contains only lowercase letters, remove duplicate letters so that every letter appear once and only +once. You must make sure your result is the smallest in lexicographical order among all possible results. + +Example: +Given "bcabc" +Return "abc" + +Given "cbacdcbc" +Return "acdb" +""" +__author__ = 'Daniel' + + +class Solution(object): + def removeDuplicateLetters(self, s): + """ + :type s: str + :rtype: str + """ + last_pos = [-1 for _ in xrange(26)] + n = len(s) + for i in xrange(n-1, -1, -1): + if last_pos[self._idx(s[i])] == -1: + last_pos[self._idx(s[i])] = i + + stk = [] + stk_set = set() + for i in xrange(n): + v = s[i] + if v not in stk_set: + while stk and stk[-1] > v and last_pos[self._idx(stk[-1])] > i: + p = stk.pop() + stk_set.remove(p) + stk.append(v) + stk_set.add(v) + + return "".join(stk) + + def _idx(self, x): + return ord(x) - ord('a') + + +if __name__ == "__main__": + assert Solution().removeDuplicateLetters("cbacdcbc") == "acdb" \ No newline at end of file diff --git a/317 Shortest Distance from All Buildings.py b/317 Shortest Distance from All Buildings.py new file mode 100644 index 0000000..ee50824 --- /dev/null +++ b/317 Shortest Distance from All Buildings.py @@ -0,0 +1,86 @@ +""" +Premium Question +""" +import sys + +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.dirs = [(-1, 0), (1, 0), (0, -1), (0, 1)] + + def shortestDistance(self, grid): + """ + BFS & collect all distance + + ideas: + Pruning: don't use a fresh "visited" for each BFS. Instead, I walk only + onto the cells that were reachable from all previous buildings. From the + first building I only walk onto cells where grid is 0, and make them -1. + From the second building I only walk onto cells where grid is -1, and I + make them -2. + -1 + -2 + -3 + :type grid: List[List[int]] + :rtype: int + """ + m = len(grid) + n = len(grid[0]) + acc = [[0 for _ in xrange(n)] for _ in xrange(m)] + reachable = [[True for _ in xrange(n)] for _ in xrange(m)] + for i in xrange(m): + for j in xrange(n): + if grid[i][j] > 0: + reachable[i][j] = False + acc[i][j] = sys.maxint + + for i in xrange(m): + for j in xrange(n): + if grid[i][j] == 1: + self.bfs(grid, acc, reachable, i, j) + + mini = sys.maxint + for i in xrange(m): + for j in xrange(n): + if acc[i][j] < mini and reachable[i][j]: + mini = acc[i][j] + + return mini if mini != sys.maxint else -1 + + def bfs(self, grid, acc, reachable, x, y): + d = 0 + m, n = len(grid), len(grid[0]) + visited = [[False for _ in xrange(n)] for _ in xrange(m)] + + q = [(x, y)] + visited[x][y] = True # enqueue, then visited + while q: + l = len(q) + for idx in xrange(l): + i, j = q[idx] + acc[i][j] += d + + for dir in self.dirs: + I = i+dir[0] + J = j+dir[1] + if 0 <= I < m and 0 <= J < n and grid[I][J] == 0 and not visited[I][J]: + q.append((I, J)) + visited[I][J] = True + + d += 1 + q = q[l:] + + for i in xrange(m): + for j in xrange(n): + if not visited[i][j]: + reachable[i][j] = False + + +if __name__ == "__main__": + assert Solution().shortestDistance( + [[1, 1, 1, 1, 1, 0], [0, 0, 0, 0, 0, 1], [0, 1, 1, 0, 0, 1], [1, 0, 0, 1, 0, 1], [1, 0, 1, 0, 0, 1], + [1, 0, 0, 0, 0, 1], [0, 1, 1, 1, 1, 0]]) == 88 + assert Solution().shortestDistance([[1, 2, 0]]) == -1 + assert Solution().shortestDistance([[1, 0, 2, 0, 1], [0, 0, 0, 0, 0], [0, 0, 1, 0, 0]]) == 7 diff --git a/318 Maximum Product of Word Lengths.py b/318 Maximum Product of Word Lengths.py new file mode 100644 index 0000000..dda2e88 --- /dev/null +++ b/318 Maximum Product of Word Lengths.py @@ -0,0 +1,50 @@ +""" +Given a string array words, find the maximum value of length(word[i]) * length(word[j]) where the two words do not share +common letters. You may assume that each word will contain only lower case letters. If no such two words exist, return +0. + +Example 1: +Given ["abcw", "baz", "foo", "bar", "xtfn", "abcdef"] +Return 16 +The two words can be "abcw", "xtfn". + +Example 2: +Given ["a", "ab", "abc", "d", "cd", "bcd", "abcd"] +Return 4 +The two words can be "ab", "cd". + +Example 3: +Given ["a", "aa", "aaa", "aaaa"] +Return 0 +No such pair of words. +""" +__author__ = 'Daniel' + + +class Solution(object): + def maxProduct(self, words): + """ + Brute force: O(n*n*k) + Encode string using bit manipulation + :type words: List[str] + :rtype: int + """ + l = map(len, words) + codes = map(self.encode, words) + maxa = 0 + for i in xrange(len(codes)): + for j in xrange(i+1, len(codes)): + if codes[i] & codes[j] == 0: + maxa = max(maxa, l[i]*l[j]) + + return maxa + + def encode(self, x): + ret = 0 + for c in x: + ret |= 1 << (ord(c)-ord('a')) + return ret + + +if __name__ == "__main__": + assert Solution().maxProduct(["abcw", "baz", "foo", "bar", "xtfn", "abcdef"]) == 16 \ No newline at end of file diff --git a/319 Bulb Switcher.py b/319 Bulb Switcher.py new file mode 100644 index 0000000..4e64530 --- /dev/null +++ b/319 Bulb Switcher.py @@ -0,0 +1,33 @@ +""" +There are n bulbs that are initially off. You first turn on all the bulbs. Then, you turn off every second bulb. On the +third round, you toggle every third bulb (turning on if it's off or turning off if it's on). For the nth round, you only +toggle the last bulb. Find how many bulbs are on after n rounds. + +Example: + +Given n = 3. + +At first, the three bulbs are [off, off, off]. +After first round, the three bulbs are [on, on, on]. +After second round, the three bulbs are [on, off, on]. +After third round, the three bulbs are [on, off, off]. + +So you should return 1, because there is only one bulb is on. +""" +import math + +__author__ = 'Daniel' + + +class Solution(object): + def bulbSwitch(self, n): + """ + Only bulbs with index being a perfect square number toggled odd number of times + Brainteaser + :type n: int + :rtype: int + """ + cnt = int(math.sqrt(n)) + return cnt + + diff --git a/3191 Minimum Operations to Make Binary Array Elements Equal to One I.py b/3191 Minimum Operations to Make Binary Array Elements Equal to One I.py new file mode 100644 index 0000000..2ad0eb2 --- /dev/null +++ b/3191 Minimum Operations to Make Binary Array Elements Equal to One I.py @@ -0,0 +1,59 @@ +""" +You are given a +binary array + nums. + +You can do the following operation on the array any number of times (possibly zero): + +Choose any 3 consecutive elements from the array and flip all of them. +Flipping an element means changing its value from 0 to 1, and from 1 to 0. + +Return the minimum number of operations required to make all elements in nums equal to 1. If it is impossible, return -1. + + + +Example 1: + +Input: nums = [0,1,1,1,0,0] + +Output: 3 + +Explanation: +We can do the following operations: + +Choose the elements at indices 0, 1 and 2. The resulting array is nums = [1,0,0,1,0,0]. +Choose the elements at indices 1, 2 and 3. The resulting array is nums = [1,1,1,0,0,0]. +Choose the elements at indices 3, 4 and 5. The resulting array is nums = [1,1,1,1,1,1]. +Example 2: + +Input: nums = [0,1,1,1] + +Output: -1 + +Explanation: +It is impossible to make all elements equal to 1. + + + +Constraints: + +3 <= nums.length <= 10^5 +0 <= nums[i] <= 1 +""" +class Solution: + def minOperations(self, nums: List[int]) -> int: + """ + sliding window? odd/even number of flipping + Greedily flip the leading 0? + """ + ret = 0 + for i in range(len(nums)): + if nums[i] == 0 and i + 3 <= len(nums): + ret += 1 + for j in range(i, i+3): + nums[j] ^= 1 + + if all(n == 1 for n in nums): + return ret + + return -1 diff --git a/3192 Minimum Operations to Make Binary Array Elements Equal to One II.py b/3192 Minimum Operations to Make Binary Array Elements Equal to One II.py new file mode 100644 index 0000000..c8f4222 --- /dev/null +++ b/3192 Minimum Operations to Make Binary Array Elements Equal to One II.py @@ -0,0 +1,57 @@ +""" +You are given a +binary array + nums. + +You can do the following operation on the array any number of times (possibly zero): + +Choose any index i from the array and flip all the elements from index i to the end of the array. +Flipping an element means changing its value from 0 to 1, and from 1 to 0. + +Return the minimum number of operations required to make all elements in nums equal to 1. + + + +Example 1: + +Input: nums = [0,1,1,0,1] + +Output: 4 + +Explanation: +We can do the following operations: + +Choose the index i = 1. The resulting array will be nums = [0,0,0,1,0]. +Choose the index i = 0. The resulting array will be nums = [1,1,1,0,1]. +Choose the index i = 4. The resulting array will be nums = [1,1,1,0,0]. +Choose the index i = 3. The resulting array will be nums = [1,1,1,1,1]. +Example 2: + +Input: nums = [1,0,0,0] + +Output: 1 + +Explanation: +We can do the following operation: + +Choose the index i = 1. The resulting array will be nums = [1,1,1,1]. + + +Constraints: + +1 <= nums.length <= 10^5 +0 <= nums[i] <= 1 +""" +class Solution: + def minOperations(self, nums: List[int]) -> int: + """ + The only way to change nums[0] to 1 is by performing an operation + + Greedily flip the bit, check the counter of flips is even/odd + """ + ret = 0 + for i in range(len(nums)): + if nums[i] == ret % 2: # nums[i] == 0 and ret % 2 == 0 + ret += 1 + + return ret diff --git a/3195 Find the Minimum Area to Cover All Ones I.py b/3195 Find the Minimum Area to Cover All Ones I.py new file mode 100644 index 0000000..3789eea --- /dev/null +++ b/3195 Find the Minimum Area to Cover All Ones I.py @@ -0,0 +1,77 @@ +""" +You are given a 2D binary array grid. Find a rectangle with horizontal and vertical sides with the smallest area, such that all the 1's in grid lie inside this rectangle. + +Return the minimum possible area of the rectangle. + + + +Example 1: + +Input: grid = [[0,1,0],[1,0,1]] + +Output: 6 + +Explanation: + + + +The smallest rectangle has a height of 2 and a width of 3, so it has an area of 2 * 3 = 6. + +Example 2: + +Input: grid = [[1,0],[0,0]] + +Output: 1 + +Explanation: + + + +The smallest rectangle has both height and width 1, so its area is 1 * 1 = 1. + + + +Constraints: + +1 <= grid.length, grid[i].length <= 1000 +grid[i][j] is either 0 or 1. +The input is generated such that there is at least one 1 in grid. +""" +class Solution: + def minimumArea(self, grid: List[List[int]]) -> int: + """ + projection + O(N^2) + """ + m = len(grid) + n = len(grid[0]) + H = [0 for _ in range(n)] + V = [0 for _ in range(m)] + for i in range(m): + for j in range(n): + if grid[i][j] == 1: + V[i] = 1 + H[j] = 1 + + return self.find_l(H) * self.find_l(V) + + def find_l(self, A): + m = len(A) + lo = -1 # index of last 0 + for i in range(m): + if A[i] == 1: + break + else: + lo = i + + hi = m + for i in range(m-1, -1, -1): + if A[i] == 1: + break + else: + hi = i + + if lo < hi: + return (hi-1) - (lo+1) + 1 + + return 0 diff --git a/320 Generalized Abbreviation.py b/320 Generalized Abbreviation.py new file mode 100644 index 0000000..868d72c --- /dev/null +++ b/320 Generalized Abbreviation.py @@ -0,0 +1,66 @@ +""" +Premium Question +Backtracking +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def generateAbbreviations(self, word): + """ + backtracking, pivoting letter + :type word: str + :rtype: List[str] + """ + if not word: + return [""] + + ret = [] + for i in xrange(len(word)+1): + left_num = str(i) if i else "" + for right in self.generateAbbreviations(word[i+1:]): + cur = left_num + word[i:i+1] + right + ret.append(cur) + + return ret + + +class SolutionTLE(object): + def __init__(self): + self.cache = defaultdict(list) + + def generateAbbreviations(self, word): + """ + Cached, brute force + Two-way backtracking, pivoting number + :type word: str + :rtype: List[str] + """ + return list(set(self.dfs(word))) + + def dfs(self, word): + if word not in self.cache: + ret = [] + for l in xrange(1, len(word)+1): + pivot = str(l) + for i in xrange(len(word)-l+1): + lefts = self.dfs(word[:i]) + rights = self.dfs(word[i+l:]) + for left in lefts: + for right in rights: + if left and left[-1].isdigit() or right and right[0].isdigit(): + continue + + ret.append(left+pivot+right) + + ret.append(word) + self.cache[word] = ret + + return self.cache[word] + + +if __name__ == "__main__": + assert Solution().generateAbbreviations("word") == ['word', 'wor1', 'wo1d', 'wo2', 'w1rd', 'w1r1', 'w2d', 'w3', + '1ord', '1or1', '1o1d', '1o2', '2rd', '2r1', '3d', '4'] \ No newline at end of file diff --git a/321 Create Maximum Number.py b/321 Create Maximum Number.py new file mode 100644 index 0000000..459e47e --- /dev/null +++ b/321 Create Maximum Number.py @@ -0,0 +1,86 @@ +""" +Given two arrays of length m and n with digits 0-9 representing two numbers. Create the maximum number of length k <= +m + n from digits of the two. The relative order of the digits from the same array must be preserved. Return an array +of the k digits. You should try to optimize your time and space complexity. + +Example 1: +nums1 = [3, 4, 6, 5] +nums2 = [9, 1, 2, 5, 8, 3] +k = 5 +return [9, 8, 6, 5, 3] + +Example 2: +nums1 = [6, 7] +nums2 = [6, 0, 4] +k = 5 +return [6, 7, 6, 0, 4] + +Example 3: +nums1 = [3, 9] +nums2 = [8, 9] +k = 3 +return [9, 8, 9] +""" +__author__ = 'Daniel' + + +class SolutionTLE(object): + def maxNumber(self, nums1, nums2, k): + """ + http://algobox.org/2015/12/24/create-maximum-number/ + O(kN(N+M)) + :type nums1: List[int] + :type nums2: List[int] + :type k: int + :rtype: List[int] + """ + maxa = [] + n1, n2 = len(nums1), len(nums2) + for l1 in xrange(min(n1, k)+1): + l2 = k - l1 + assert l2 >= 0 + A1, A2 = self.maxNumberSingle(nums1, l1), self.maxNumberSingle(nums2, l2) + cur = self.maxNumberDual(A1, A2) + if not maxa or self.eval(maxa) < self.eval(cur): + maxa = cur + + return maxa + + def eval(self, lst): + return int("".join(map(str, lst))) + + def maxNumberSingle(self, A, k): + """ + maxNumber of k elements from a single list A + """ + stk = [] + n = len(A) + for i in xrange(n): + while stk and len(stk)-1+(n-1-i+1) >= k and stk[-1] < A[i]: stk.pop() + if len(stk) < k: + stk.append(A[i]) + + return stk + + def maxNumberDual(self, A1, A2): + """ + maxNumber of all elements from dual lists A1 and A2. + """ + ret = [] + p1, p2 = 0, 0 + while p1 < len(A1) and p2 < len(A2): + ahead1, ahead2 = p1, p2 + while ahead1 < len(A1) and ahead2 < len(A2) and A1[ahead1] == A2[ahead2]: + ahead1, ahead2 = ahead1+1, ahead2+1 + + if ahead2 >= len(A2) or (ahead1 < len(A1) and A1[ahead1] > A2[ahead2]): + ret.append(A1[p1]) + p1 += 1 + else: + ret.append(A2[p2]) + p2 += 1 + + # dangling + ret.extend(A1[p1:]) + ret.extend(A2[p2:]) + return ret diff --git a/3212 Count Submatrices With Equal Frequency of X and Y.py b/3212 Count Submatrices With Equal Frequency of X and Y.py new file mode 100644 index 0000000..d75713c --- /dev/null +++ b/3212 Count Submatrices With Equal Frequency of X and Y.py @@ -0,0 +1,160 @@ +""" +Given a 2D character matrix grid, where grid[i][j] is either 'X', 'Y', or '.', return the number of submatrices that contain: + +grid[0][0] +an equal frequency of 'X' and 'Y'. +at least one 'X'. + + +Example 1: + +Input: grid = [["X","Y","."],["Y",".","."]] + +Output: 3 + +Explanation: + + + +Example 2: + +Input: grid = [["X","X"],["X","Y"]] + +Output: 0 + +Explanation: + +No submatrix has an equal frequency of 'X' and 'Y'. + +Example 3: + +Input: grid = [[".","."],[".","."]] + +Output: 0 + +Explanation: + +No submatrix has at least one 'X'. + + + +Constraints: + +1 <= grid.length, grid[i].length <= 1000 +grid[i][j] is either 'X', 'Y', or '.'. +""" +class Solution: + def numberOfSubmatrices_error(self, mat: List[List[str]]) -> int: + """ + 1D: initialize as None, +1, -1, the count the total numbers of 0 + [X, Y, .] + + [1, 0, 0] + + 2D: project to 1D, project by column + [X, Y, .] + [Y, X, .] + + [0, 0, .] + + Error: poor handle of . + """ + M = len(mat) + N = len(mat) + ret = 0 + for lo in range(M): + # frequency for mat[lo:hi][j] + freq_cols = [None for _ in range(N)] + for hi in range(lo+1, M+1): + for j in range(N): + freq_cols[j] = self.acc(freq_cols[j], self.val(mat[hi-1][j])) + + F = [0 for _ in range(N+1)] + for j in range(1, N+1): + cur = self.acc(None, self.val(freq_cols[j-1])) + F[j] = F[j-1] + 1 if cur == 0 else 0 + + ret += F[j] + + return ret + + def val(self, a): + if a == "X": + return 1 + elif a == "Y": + return -1 + else: + None + + def acc(self, a, b): + if a == None: + return self.val(b) + else: + a += self.val(b) if self.val(b) is not None else 0 + + def numberOfSubmatrices_error_2(self, mat: List[List[str]]) -> int: + """ + To handle ., cout the submatrix with only "." + + Error: must contain grid[0][0]. This solution counts all submatrices + """ + vals = { + "X": 1, + "Y": -1, + ".": 0, + } + + M = len(mat) + N = len(mat) + ret = 0 + for lo in range(M): + # frequency for mat[lo:hi][j] + freq_cols = [0 for _ in range(N)] + is_dots_cols = [True for _ in range(N)] + for hi in range(lo+1, M+1): + for j in range(N): + freq_cols[j] += vals[mat[hi-1][j]] + is_dots_cols[j] &= mat[hi-1][j] == "." + + F = [0 for _ in range(N+1)] + D = [0 for _ in range(N+1)] + for j in range(1, N+1): + F[j] = F[j-1] + 1 if freq_cols[j-1] == 0 else 0 + D[j] = D[j-1] + 1 if is_dots_cols[j-1] else 0 + ret += max(0, F[j] - D[j]) + + return ret + + def numberOfSubmatrices(self, mat: List[List[str]]) -> int: + """ + Project 2D to 1D, project by column + + To handle ., cout the submatrix with only "." + To contain grid[0][0], just count number of 0s + """ + vals = { + "X": 1, + "Y": -1, + ".": 0, + } + + M = len(mat) + N = len(mat[0]) + ret = 0 + + freq_cols = [0 for _ in range(N)] + is_dots_cols = [True for _ in range(N)] + for i in range(M): + for j in range(N): + freq_cols[j] += vals[mat[i][j]] + is_dots_cols[j] &= mat[i][j] == "." + + all_dots = True + acc = 0 + for j in range(N): + all_dots &= is_dots_cols[j] + acc += freq_cols[j] + if acc == 0 and not all_dots: + ret += 1 + + return ret diff --git a/322 Coin Change.py b/322 Coin Change.py new file mode 100644 index 0000000..4be7d85 --- /dev/null +++ b/322 Coin Change.py @@ -0,0 +1,74 @@ +""" +You are given coins of different denominations and a total amount of money amount. Write a function to compute the +fewest number of coins that you need to make up that amount. If that amount of money cannot be made up by any +combination of the coins, return -1. + +Example 1: +coins = [1, 2, 5], amount = 11 +return 3 (11 = 5 + 5 + 1) + +Example 2: +coins = [2], amount = 3 +return -1. + +Note: +You may assume that you have an infinite number of each kind of coin. +""" +import sys + +__author__ = 'Daniel' + + +class Solution(object): + def coinChange(self, coins, amount): + """ + DP with early prune + Let F[i] be the fewest number of coins make to i + F[i+k] = min(F[i]+1, \forall k if F[i]) + O(NM) + :type coins: List[int] + :type amount: int + :rtype: int + """ + if amount == 0: + return 0 + + F = [sys.maxint for _ in xrange(amount+1)] + for k in coins: + if k < amount+1: + F[k] = 1 + + for i in xrange(1, amount+1): + if F[i] != sys.maxint: + for k in coins: + if i+k <= amount: + F[i+k] = min(F[i+k], F[i]+1) + + return F[amount] if F[amount] != sys.maxint else -1 + + +class SolutionTLE(object): + def coinChange(self, coins, amount): + """ + Let F[i] be the fewest number of coins make to i + F[i] = min(F[i-k]+1, \forall k) + O(NM) + :type coins: List[int] + :type amount: int + :rtype: int + """ + F = [sys.maxint for _ in xrange(amount+1)] + for k in coins: + if k < amount + 1: + F[k] = 1 + + for i in xrange(1, amount+1): + for k in coins: + if i-k > 0 and F[i-k] != sys.maxint: + F[i] = min(F[i], F[i-k]+1) + + return F[amount] if F[amount] != sys.maxint else -1 + + +if __name__ == "__main__": + assert Solution().coinChange([243, 291, 335, 209, 177, 345, 114, 91, 313, 331], 7367) == 23 \ No newline at end of file diff --git a/323 Number of Connected Components in an Undirected Graph.py b/323 Number of Connected Components in an Undirected Graph.py new file mode 100644 index 0000000..ba542af --- /dev/null +++ b/323 Number of Connected Components in an Undirected Graph.py @@ -0,0 +1,33 @@ +""" +Premium Question +simple DFS +""" +__author__ = 'Daniel' + + +class Solution(object): + def countComponents(self, n, edges): + """ + :type n: int + :type edges: List[List[int]] + :rtype: int + """ + V = [[] for _ in xrange(n)] + for e in edges: + V[e[0]].append(e[1]) + V[e[1]].append(e[0]) + + visited = [False for _ in xrange(n)] + cnt = 0 + for v in xrange(n): + if not visited[v]: + cnt += 1 + self.dfs(V, v, visited) + + return cnt + + def dfs(self, V, v, visited): + visited[v] = True + for nbr in V[v]: + if not visited[nbr]: + self.dfs(V, nbr, visited) diff --git a/324 Wiggle Sort II py3.py b/324 Wiggle Sort II py3.py new file mode 100644 index 0000000..f7c4798 --- /dev/null +++ b/324 Wiggle Sort II py3.py @@ -0,0 +1,79 @@ +#!/usr/bin/python3 +""" +Given an unsorted array nums, reorder it such that nums[0] < nums[1] > nums[2] +< nums[3].... + +Example 1: + +Input: nums = [1, 5, 1, 1, 6, 4] +Output: One possible answer is [1, 4, 1, 5, 1, 6]. +Example 2: + +Input: nums = [1, 3, 2, 2, 3, 1] +Output: One possible answer is [2, 3, 1, 3, 1, 2]. +Note: +You may assume all input has valid answer. + +Follow Up: +Can you do it in O(n) time and/or in-place with O(1) extra space? +""" +from typing import List + + +class Solution: + def wiggleSort(self, nums: List[int]) -> None: + """ + Do not return anything, modify nums in-place instead. + + Median + 3-way partitioning + """ + n = len(nums) + # mid = self.find_kth(nums, 0, n, (n - 1) // 2) + # median = nums[mid] + median = list(sorted(nums))[n//2] + + # three way pivot + odd = 1 + even = n - 1 if (n - 1) % 2 == 0 else n - 2 + i = 0 + while i < n: + if nums[i] < median: + if i >= even and i % 2 == 0: + i += 1 + continue + nums[i], nums[even] = nums[even], nums[i] + even -= 2 + + elif nums[i] > median: + if i <= odd and i % 2 == 1: + i += 1 + continue + nums[i], nums[odd] = nums[odd], nums[i] + odd += 2 + else: + i += 1 + + def find_kth(self, A, lo, hi, k): + p = self.pivot(A, lo, hi) + if k == p: + return p + elif k > p: + return self.find_kth(A, p + 1, hi, k) + else: + return self.find_kth(A, lo, p, k) + + def pivot(self, A, lo, hi): + # need 3-way pivot, otherwise TLE + p = lo + closed = lo + for i in range(lo + 1, hi): + if A[i] < A[p]: + closed += 1 + A[closed], A[i] = A[i], A[closed] + + A[closed], A[p] = A[p], A[closed] + return closed + + +if __name__ == "__main__": + Solution().wiggleSort([1, 5, 1, 1, 6, 4]) diff --git a/324 Wiggle Sort II.py b/324 Wiggle Sort II.py new file mode 100644 index 0000000..bb2bf19 --- /dev/null +++ b/324 Wiggle Sort II.py @@ -0,0 +1,109 @@ +""" +Given an unsorted array nums, reorder it such that nums[0] < nums[1] > nums[2] < nums[3].... + +Example: +(1) Given nums = [1, 5, 1, 1, 6, 4], one possible answer is [1, 4, 1, 5, 1, 6]. +(2) Given nums = [1, 3, 2, 2, 3, 1], one possible answer is [2, 3, 1, 3, 1, 2]. + +Note: +You may assume all input has valid answer. + +Follow Up: +Can you do it in O(n) time and/or in-place with O(1) extra space? +""" +__author__ = 'Daniel' + + +class Solution(object): + def wiggleSort(self, A): + """ + 1. Quick selection for finding median (Average O(n)) + 2. Three-way partitioning to split the data + 3. Re-mapping the index to do in-place partitioning + Average time O(n) + Space O(1) + :type A: List[int] + :rtype: in-place + """ + n = len(A) + median_idx = self.find_kth(A, 0, n, n/2) + v = A[median_idx] + + idx = lambda i: (2*i+1) % (n|1) + lt = -1 + hi = n + i = 0 + while i < hi: + if A[idx(i)] > v: + lt += 1 + A[idx(lt)], A[idx(i)] = A[idx(i)], A[idx(lt)] + i += 1 + elif A[idx(i)] == v: + i += 1 + else: + hi -= 1 + A[idx(hi)], A[idx(i)] = A[idx(i)], A[idx(hi)] + + def pivot(self, A, lo, hi, pidx=None): + lt = lo-1 + gt = hi + if not pidx: pidx = lo + + v = A[pidx] + i = lo + while i < gt: + if A[i] < v: + lt += 1 + A[lt], A[i] = A[i], A[lt] + i += 1 + elif A[i] == v: + i += 1 + else: + gt -= 1 + A[gt], A[i] = A[i], A[gt] + + return lt, gt + + def find_kth(self, A, lo, hi, k): + if lo >= hi: return + + lt, gt = self.pivot(A, lo, hi) + + if lt < k < gt: + return k + if k <= lt: + return self.find_kth(A, lo, lt+1, k) + else: + return self.find_kth(A, gt, hi, k) + + +class SolutionSort(object): + def wiggleSort(self, nums): + """ + Sort-based: interleave the small half and large half + + Could they be "equal to"? That would require some number M to appear both in the smaller and the larger half. + It shall be the largest in the smaller half and the smallest in the larger half. + + To deal with duplicate median element cases (e.g. [4 5 5 6]), interleave in a reverse order + :type nums: List[int] + :rtype: void Do not return anything, modify nums in-place instead. + """ + n = len(nums) + A = sorted(nums) + + j, k = (n-1) / 2, n-1 + for i in xrange(len(nums)): + if i % 2 == 0: + nums[i] = A[j] + j -= 1 + else: + nums[i] = A[k] + k -= 1 + + +if __name__ == "__main__": + # A = [1, 5, 1, 1, 6, 4] + A = [3, 2, 1, 1, 3, 2] + Solution().wiggleSort(A) + print A diff --git a/3243 Shortest Distance After Road Addition Queries I.py b/3243 Shortest Distance After Road Addition Queries I.py new file mode 100644 index 0000000..042fc03 --- /dev/null +++ b/3243 Shortest Distance After Road Addition Queries I.py @@ -0,0 +1,130 @@ +#!/usr/bin/python3 +""" +You are given an integer n and a 2D integer array queries. + +There are n cities numbered from 0 to n - 1. Initially, there is a unidirectional road from city i to city i + 1 for all 0 <= i < n - 1. + +queries[i] = [ui, vi] represents the addition of a new unidirectional road from city ui to city vi. After each query, you need to find the length of the shortest path from city 0 to city n - 1. + +Return an array answer where for each i in the range [0, queries.length - 1], answer[i] is the length of the shortest path from city 0 to city n - 1 after processing the first i + 1 queries. + + + +Example 1: + +Input: n = 5, queries = [[2,4],[0,2],[0,4]] + +Output: [3,2,1] + +Explanation: + + + +After the addition of the road from 2 to 4, the length of the shortest path from 0 to 4 is 3. + + + +After the addition of the road from 0 to 2, the length of the shortest path from 0 to 4 is 2. + + + +After the addition of the road from 0 to 4, the length of the shortest path from 0 to 4 is 1. + +Example 2: + +Input: n = 4, queries = [[0,3],[0,2]] + +Output: [1,1] + +Explanation: + + + +After the addition of the road from 0 to 3, the length of the shortest path from 0 to 3 is 1. + + + +After the addition of the road from 0 to 2, the length of the shortest path remains 1. + + + +Constraints: + +3 <= n <= 500 +1 <= queries.length <= 500 +queries[i].length == 2 +0 <= queries[i][0] < queries[i][1] < n +1 < queries[i][1] - queries[i][0] +There are no repeated roads among the queries. +""" +from collections import defaultdict, deque + + +class Solution: + def shortestDistanceAfterQueries(self, n: int, queries: List[List[int]]) -> List[int]: + G = defaultdict(list) + dist = [] + for i in range(n-1): + G[i].append(i+1) + + for i in range(n): + dist.append(i) + + ret = [] + for u, v in queries: + G[u].append(v) + self.bfs(G, dist, u) + ret.append(dist[~0]) + + return ret + + def bfs(self, G, dist, s): + """ + * Known origin and end destination + * dist is the distance from origin, not to destination + * BFS update the distance from the source, where the source is the + start of the new edge, not the origin of the graph + """ + q = deque() + q.append(s) + while q: + v = q.popleft() + for nbr in G[v]: + if dist[nbr] > dist[v] + 1: + # It and its descendants require distance update + dist[nbr] = dist[v] + 1 + q.append(nbr) + + +class SolutionTLE: + def shortestDistanceAfterQueries(self, n: int, queries: List[List[int]]) -> List[int]: + """ + Naive solution: + 1. maintain a graph + 2. BFS + """ + G = defaultdict(list) + for i in range(n-1): + G[i].append(i+1) + + ret = [] + for q in queries: + s, t = q + G[s].append(t) + ret.append(self.bfs(G, 0, n - 1)) + + return ret + + def bfs(self, G, s, t): + q = [s] + ret = 0 + while q: + nxt_q = [] + ret += 1 + for v in q: + for nbr in G[v]: + if nbr == t: + return ret + nxt_q.append(nbr) + + q = nxt_q diff --git a/325 Maximum Size Subarray Sum Equals k.py b/325 Maximum Size Subarray Sum Equals k.py new file mode 100644 index 0000000..08895ab --- /dev/null +++ b/325 Maximum Size Subarray Sum Equals k.py @@ -0,0 +1,27 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Solution(object): + def maxSubArrayLen(self, A, k): + """ + Search problem + :type A: List[int] + :type k: int + :rtype: int + """ + m = {0: -1} # initial condition, sum -> idx + maxa = 0 + s = 0 + for i in xrange(len(A)): + s += A[i] + t = s - k # s - t = k + if t in m: + maxa = max(maxa, i - m[t]) + + if s not in m: + m[s] = i + + return maxa diff --git a/327 Count of Range Sum.py b/327 Count of Range Sum.py new file mode 100644 index 0000000..270f50a --- /dev/null +++ b/327 Count of Range Sum.py @@ -0,0 +1,63 @@ +""" +Given an integer array nums, return the number of range sums that lie in [lower, upper] inclusive. +Range sum S(i, j) is defined as the sum of the elements in nums between indices i and j (i <= j), inclusive. + +Note: +A naive algorithm of O(n2) is trivial. You MUST do better than that. + +Example: +Given nums = [-2, 5, -1], lower = -2, upper = 2, +Return 3. +The three ranges are : [0, 0], [2, 2], [0, 2] and their respective sums are: -2, -1, 2. +""" +__author__ = 'Daniel' + + +class Solution(object): + def countRangeSum(self, nums, lower, upper): + """ + MergeSort while counting required range sum + :type nums: List[int] + :type lower: int + :type upper: int + :rtype: int + """ + if not nums: return 0 + + def msort(A, lo, hi): + if hi - lo <= 1: return 0 + + mid = (lo + hi)/2 + cnt = msort(A, lo, mid) + msort(A, mid, hi) + + temp = [] + i = j = r = mid + for l in xrange(lo, mid): + while i < hi and A[i] - A[l] < lower: i += 1 + while j < hi and A[j] - A[l] <= upper: j += 1 + cnt += j - i + + while r < hi and A[r] < A[l]: + temp.append(A[r]) + r += 1 + + temp.append(A[l]) + + while r < hi: # dangling right + temp.append(A[r]) + r += 1 + + A[lo:hi] = temp # A[lo:hi] = sorted(A[lo:hi] # Timsort, linear time + return cnt + + n = len(nums) + F = [0 for _ in xrange(n+1)] + for i in xrange(1, n+1): + F[i] = F[i-1] + nums[i-1] + + return msort(F, 0, n+1) + + +if __name__ == "__main__": + assert Solution().countRangeSum([0, 0], 0, 0) == 3 + assert Solution().countRangeSum([-2, 5, -1], -2, 2) == 3 diff --git a/3271 Hash Divided String.py b/3271 Hash Divided String.py new file mode 100644 index 0000000..bb48838 --- /dev/null +++ b/3271 Hash Divided String.py @@ -0,0 +1,64 @@ +""" +You are given a string s of length n and an integer k, where n is a multiple of k. Your task is to hash the string s into a new string called result, which has a length of n / k. + +First, divide s into n / k +substrings +, each with a length of k. Then, initialize result as an empty string. + +For each substring in order from the beginning: + +The hash value of a character is the index of that character in the English alphabet (e.g., 'a' → 0, 'b' → 1, ..., 'z' → 25). +Calculate the sum of all the hash values of the characters in the substring. +Find the remainder of this sum when divided by 26, which is called hashedChar. +Identify the character in the English lowercase alphabet that corresponds to hashedChar. +Append that character to the end of result. +Return result. + + + +Example 1: + +Input: s = "abcd", k = 2 + +Output: "bf" + +Explanation: + +First substring: "ab", 0 + 1 = 1, 1 % 26 = 1, result[0] = 'b'. + +Second substring: "cd", 2 + 3 = 5, 5 % 26 = 5, result[1] = 'f'. + +Example 2: + +Input: s = "mxz", k = 3 + +Output: "i" + +Explanation: + +The only substring: "mxz", 12 + 23 + 25 = 60, 60 % 26 = 8, result[0] = 'i'. + + + +Constraints: + +1 <= k <= 100 +k <= s.length <= 1000 +s.length is divisible by k. +s consists only of lowercase English letters. +""" +class Solution: + def stringHash(self, s: str, k: int) -> str: + """ + just do the operation + """ + ret = [] + cur = 0 + for i in range(len(s)): + cur += ord(s[i]) - ord('a') + if (i+1) % k == 0: + ret.append(chr(cur % 26 + ord('a'))) + cur = 0 + + return "".join(ret) + \ No newline at end of file diff --git a/328 Odd Even Linked List.py b/328 Odd Even Linked List.py new file mode 100644 index 0000000..91c6986 --- /dev/null +++ b/328 Odd Even Linked List.py @@ -0,0 +1,81 @@ +""" +Given a singly linked list, group all odd nodes together followed by the even nodes. Please note here we are talking +about the node number and not the value in the nodes. + +You should try to do it in place. The program should run in O(1) space complexity and O(nodes) time complexity. + +Example: +Given 1->2->3->4->5->NULL, +return 1->3->5->2->4->NULL. + +Note: +The relative order inside both the even and odd groups should remain as it was in the input. +The first node is considered odd, the second node even and so on ... +""" +__author__ = 'Daniel' + + +# Definition for singly-linked list. +class ListNode(object): + def __init__(self, x): + self.val = x + self.next = None + + +class Solution(object): + def oddEvenList(self, head): + """ + :type head: ListNode + :rtype: ListNode + """ + if not head: + return + + ptr = head # end of odd position + pre = head # don't move the first + cnt = 1 + while pre and pre.next: + cur = pre.next + cnt += 1 + if cnt % 2 == 0: + pre = pre.next + else: + start = ptr.next + nxt = cur.next + + ptr.next = cur + cur.next = start + pre.next = nxt + + ptr = ptr.next + + return head + + def oddEvenListError(self, head): + """ + Wrongly move by node value + :type head: ListNode + :rtype: ListNode + """ + if not head: + return + + ptr = head # end of first parity + parity = ptr.val % 2 + + pre = head + while pre and pre.next: + cur = pre.next + if cur.val % 2 != parity: + pre = pre.next + else: + start = ptr.next + nxt = cur.next + + ptr.next = cur + cur.next = start + pre.next = nxt + + ptr = ptr.next + + return head diff --git a/3282 Reach End of Array With Max Score.py b/3282 Reach End of Array With Max Score.py new file mode 100644 index 0000000..4ed6e65 --- /dev/null +++ b/3282 Reach End of Array With Max Score.py @@ -0,0 +1,68 @@ +""" +You are given an integer array nums of length n. + +Your goal is to start at index 0 and reach index n - 1. You can only jump to indices greater than your current index. + +The score for a jump from index i to index j is calculated as (j - i) * nums[i]. + +Return the maximum possible total score by the time you reach the last index. + + + +Example 1: + +Input: nums = [1,3,1,5] + +Output: 7 + +Explanation: + +First, jump to index 1 and then jump to the last index. The final score is 1 * 1 + 2 * 3 = 7. + +Example 2: + +Input: nums = [4,3,1,3,2] + +Output: 16 + +Explanation: + +Jump directly to the last index. The final score is 4 * 4 = 16. + + + +Constraints: + +1 <= nums.length <= 10^5 +1 <= nums[i] <= 10^5 +""" +class Solution: + def findMaximumScore(self, A: List[int]) -> int: + """ + F[i] max score at A[i] + + F[i] = max(F[j] + (i - j)*A[j] for all j) + O(N^2) + + Score: (i-j) * A[i] + sum(i-j for all i, j) = len(A) - 1 + Sum of jump gap sizes is constant + + It can be proven that from each index i, the optimal solution is to jump to the nearest index j > i + such that nums[j] > nums[i]. + + Greedy: + * Solo jump vs. double jump + * maximize gap value, gap value defined by the original A[i] -> find the next larger A[j] + * as long as the next A[j] > A[i], then there is a net gain + """ + i = 0 + ret = 0 + for j in range(1, len(A)): + if A[j] > A[i] or j == len(A)-1: + ret += (j - i) * A[i] + i = j + # handle end of iteration + + return ret + diff --git a/3286 Find a Safe Walk Through a Grid.py b/3286 Find a Safe Walk Through a Grid.py new file mode 100644 index 0000000..db9a518 --- /dev/null +++ b/3286 Find a Safe Walk Through a Grid.py @@ -0,0 +1,96 @@ +""" +You are given an m x n binary matrix grid and an integer health. + +You start on the upper-left corner (0, 0) and would like to get to the lower-right corner (m - 1, n - 1). + +You can move up, down, left, or right from one cell to another adjacent cell as long as your health remains positive. + +Cells (i, j) with grid[i][j] = 1 are considered unsafe and reduce your health by 1. + +Return true if you can reach the final cell with a health value of 1 or more, and false otherwise. + + + +Example 1: + +Input: grid = [[0,1,0,0,0],[0,1,0,1,0],[0,0,0,1,0]], health = 1 + +Output: true + +Explanation: + +The final cell can be reached safely by walking along the gray cells below. + + +Example 2: + +Input: grid = [[0,1,1,0,0,0],[1,0,1,0,0,0],[0,1,1,1,0,1],[0,0,1,0,1,0]], health = 3 + +Output: false + +Explanation: + +A minimum of 4 health points is needed to reach the final cell safely. + + +Example 3: + +Input: grid = [[1,1,1],[1,0,1],[1,1,1]], health = 5 + +Output: true + +Explanation: + +The final cell can be reached safely by walking along the gray cells below. + + + +Any path that does not go through the cell (1, 1) is unsafe since your health will drop to 0 when reaching the final cell. + + + +Constraints: + +m == grid.length +n == grid[i].length +1 <= m, n <= 50 +2 <= m * n +1 <= health <= m + n +grid[i][j] is either 0 or 1. +""" +import heapq +import sys + + +class Solution: + def findSafeWalk(self, grid: List[List[int]], health: int) -> bool: + """ + F[i][j] maximum health at i, j + But four directions, not monotonic, DP may not work + visited to avoid loop + + Greedy visited 0 with heap. + N = m*n + O(N log N) + """ + m = len(grid) + n = len(grid[0]) + F = [ + [sys.maxsize for _ in range(n)] + for _ in range(m) + ] + dirs = [(0, -1), (0, 1), (-1, 0), (1, 0)] + h = [(grid[0][0], 0, 0)] # heap queue of (acc, i, j) + while h: + acc, i, j = heapq.heappop(h) + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n: + nxt = acc + grid[I][J] + if F[I][J] > nxt: + F[I][J] = nxt + heapq.heappush(h, (nxt, I, J)) + + return F[~0][~0] < health + \ No newline at end of file diff --git a/329 Longest Increasing Path in a Matrix.py b/329 Longest Increasing Path in a Matrix.py new file mode 100644 index 0000000..f0497f6 --- /dev/null +++ b/329 Longest Increasing Path in a Matrix.py @@ -0,0 +1,74 @@ +""" +Given an integer matrix, find the length of the longest increasing path. + +From each cell, you can either move to four directions: left, right, up or down. You may NOT move diagonally or move +outside of the boundary (i.e. wrap-around is not allowed). + +Example 1: + +nums = [ + [9,9,4], + [6,6,8], + [2,1,1] +] +Return 4 +The longest increasing path is [1, 2, 6, 9]. + +Example 2: + +nums = [ + [3,4,5], + [3,2,6], + [2,2,1] +] +Return 4 +The longest increasing path is [3, 4, 5, 6]. Moving diagonally is not allowed. +""" +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.cache = None + self.dirs = ((-1, 0), (1, 0), (0, -1), (0, 1),) + + def longestIncreasingPath(self, matrix): + """ + dfs + cache + :type matrix: List[List[int]] + :rtype: int + """ + if not matrix: return 0 + + m, n = len(matrix), len(matrix[0]) + self.cache = [[None for _ in xrange(n)] for _ in xrange(m)] + gmax = 1 + for i in xrange(m): + for j in xrange(n): + gmax = max(gmax, self.longest(matrix, i, j)) + + return gmax + + def longest(self, matrix, i, j): + """ + Strictly increasing, thus no need to have a visited matrix + """ + if not self.cache[i][j]: + m, n = len(matrix), len(matrix[0]) + maxa = 1 + for d in self.dirs: + I, J = i + d[0], j + d[1] + if 0 <= I < m and 0 <= J < n and matrix[I][J] > matrix[i][j]: + maxa = max(maxa, 1 + self.longest(matrix, I, J)) + + self.cache[i][j] = maxa + + return self.cache[i][j] + + +if __name__ == "__main__": + assert Solution().longestIncreasingPath([ + [9, 9, 4], + [6, 6, 8], + [2, 1, 1] + ]) == 4 diff --git a/3290 Maximum Multiplication Score.py b/3290 Maximum Multiplication Score.py new file mode 100644 index 0000000..60a415d --- /dev/null +++ b/3290 Maximum Multiplication Score.py @@ -0,0 +1,136 @@ +""" +You are given an integer array a of size 4 and another integer array b of size at least 4. + +You need to choose 4 indices i0, i1, i2, and i3 from the array b such that i0 < i1 < i2 < i3. Your score will be equal to the value a[0] * b[i0] + a[1] * b[i1] + a[2] * b[i2] + a[3] * b[i3]. + +Return the maximum score you can achieve. + + + +Example 1: + +Input: a = [3,2,5,6], b = [2,-6,4,-5,-3,2,-7] + +Output: 26 + +Explanation: +We can choose the indices 0, 1, 2, and 5. The score will be 3 * 2 + 2 * (-6) + 5 * 4 + 6 * 2 = 26. + +Example 2: + +Input: a = [-1,4,5,-2], b = [-5,-1,-3,-2,-4] + +Output: -1 + +Explanation: +We can choose the indices 0, 1, 3, and 4. The score will be (-1) * (-5) + 4 * (-1) + 5 * (-2) + (-2) * (-4) = -1. + + + +Constraints: + +a.length == 4 +4 <= b.length <= 10^5 +-10^5 <= a[i], b[i] <= 10^5 +""" +import sys + + +class Solution: + def maxScore_error(self, a: List[int], b: List[int]) -> int: + """ + Greedy: max times max + """ + a.sort(reverse=True) + b.sort(reverse=True) + ret = 0 + for i in range(4): + ret += a[i] *b[i] + + return ret + + def maxScore_TLE(self, a: List[int], b: List[int]) -> int: + """ + backtracking + permutation to the depth of 4 + """ + maxa = [-sys.maxsize-1] + self.backtrack(a, b, 0, [], maxa) + return maxa[0] + + def backtrack(self, a, b, cur, ret, maxa): + if len(ret) == 4: + cur_maxa = 0 + for i in range(4): + cur_maxa += a[i] * ret[i] + maxa[0] = max(maxa[0], cur_maxa) + return + + for i in range(cur, len(b)): + # not choose i + self.backtrack(a, b, i+1, ret, maxa) + # choose i + ret.append(b[i]) + self.backtrack(a, b, i+1, ret, maxa) + ret.pop() + + def maxScore_error(self, a: List[int], b: List[int]) -> int: + """ + Let F[i][j] be the max score for a[:i] and b[:j] and choosing a[i-1] but may not b[j-1] + F[i][j] = a[i-1] * b[j-1] + F[i-1][j-1] + """ + F = [ + [0 for _ in range(len(b)+1)] # cannot initialize with 0 + for _ in range(len(a)+1) + ] + + for i in range(1, len(a)+1): + for j in range(1, len(b)+1): + F[i][j] = max(a[i-1] * b[j-1] + F[i-1][j-1], F[i][j-1]) + + return max(F[4][j] for j in range(4, len(b) + 1)) + + def maxScore2(self, a: List[int], b: List[int]) -> int: + """ + Let F[i][j] be the max score for a[:i] and b[:j] and choosing a[i] but may or may not b[j] + F[i][j] = max(a[i] * b[j] + F[i-1][j-1], F[i][j-1]) + + Because of complication of negative number and calculation, we cannot augment a dummy row and a column for F + """ + MIN = -sys.maxsize-1 + F = [ + [MIN for _ in range(len(b))] + for _ in range(len(a)) + ] + + for i in range(len(a)): + for j in range(i, len(b)): # cannot start with 0 + F[i][j] = max(a[i] * b[j] + (F[i-1][j-1] if i > 0 and j > 0 else 0), F[i][j-1] if j > 0 else MIN) + + return F[3][~0] + + def maxScore(self, a: List[int], b: List[int]) -> int: + """ + Let F[i][j] be the max score for a[:i] and b[:j] and choosing a[i-1] but may or may not b[j-1] + F[i][j] = max(a[i] * b[j] + F[i-1][j-1], F[i][j-1]) + """ + MIN = -sys.maxsize-1 + F = [ + [MIN for _ in range(len(b)+1)] + for _ in range(len(a)+1) + ] + for j in range(len(b)+1): + F[0][j] = 0 + + for i in range(1, len(a)+1): + for j in range(i, len(b)+1): # cannot start with 1 + F[i][j] = max( + a[i-1] * b[j-1] + F[i-1][j-1], + F[i][j-1]) + + return F[4][~0] + + + + + \ No newline at end of file diff --git a/330 Patching Array.py b/330 Patching Array.py new file mode 100644 index 0000000..271813b --- /dev/null +++ b/330 Patching Array.py @@ -0,0 +1,93 @@ +""" +Given a sorted positive integer array nums and an integer n, add/patch elements to the array such that any number in +range [1, n] inclusive can be formed by the sum of some elements in the array. Return the minimum number of patches +required. + +Example 1: +nums = [1, 3], n = 6 +Return 1. + +Combinations of nums are [1], [3], [1,3], which form possible sums of: 1, 3, 4. +Now if we add/patch 2 to nums, the combinations are: [1], [2], [3], [1,3], [2,3], [1,2,3]. +Possible sums are 1, 2, 3, 4, 5, 6, which now covers the range [1, 6]. +So we only need 1 patch. + +Example 2: +nums = [1, 5, 10], n = 20 +Return 2. +The two patches can be [2, 4]. + +Example 3: +nums = [1, 2, 2], n = 5 +Return 0. +""" +__author__ = 'Daniel' + + +class Solution(object): + def minPatches(self, nums, n): + """ + https://discuss.leetcode.com/topic/35494/solution-explanation + + Greedy + Let cur_max be the current max sum can be formed by [0, i) when iterating at i-th index + if cur_max < Ai: + we have a void gap at [cur_max + 1, Ai] + we need to patch a cur_max in the array to maximize the all-cover reach + else: + cur_max += Ai + + :type nums: List[int] + :type n: int + :rtype: int + """ + cnt = 0 + cur_max = 0 + i = 0 + while cur_max < n: + if i >= len(nums) or cur_max + 1 < nums[i]: + cur_max += cur_max + 1 + cnt += 1 + else: + cur_max += nums[i] + i += 1 + + return cnt + + def minPatches2(self, nums, n): + """ + https://discuss.leetcode.com/topic/35494/solution-explanation + + Greedy + Let cur_max be the current max sum can be formed by [0, i) when iterating at i-th index + if cur_max < Ai: + we have a void gap at [cur_max + 1, Ai] + we need to patch a cur_max in the array to maximize the all-cover reach + else: + cur_max += Ai + + :type nums: List[int] + :type n: int + :rtype: int + """ + nums = filter(lambda x: x <= n, nums) + + cnt = 0 + cur_max = 0 + for elt in nums: + while cur_max + 1 < elt: + cur_max += cur_max + 1 + cnt += 1 + + cur_max += elt + + # after iterating all array element + while cur_max < n: + cur_max += cur_max + 1 + cnt += 1 + + return cnt + + +if __name__ == "__main__": + assert Solution().minPatches([1, 2, 2, 6, 34], 20) == 1 \ No newline at end of file diff --git a/3305 Count of Substrings Containing Every Vowel and K Consonants I.py b/3305 Count of Substrings Containing Every Vowel and K Consonants I.py new file mode 100644 index 0000000..4e18d75 --- /dev/null +++ b/3305 Count of Substrings Containing Every Vowel and K Consonants I.py @@ -0,0 +1,146 @@ +""" +You are given a string word and a non-negative integer k. + +Return the total number of +substrings + of word that contain every vowel ('a', 'e', 'i', 'o', and 'u') at least once and exactly k consonants. + + + +Example 1: + +Input: word = "aeioqq", k = 1 + +Output: 0 + +Explanation: + +There is no substring with every vowel. + +Example 2: + +Input: word = "aeiou", k = 0 + +Output: 1 + +Explanation: + +The only substring with every vowel and zero consonants is word[0..4], which is "aeiou". + +Example 3: + +Input: word = "ieaouqqieaouqq", k = 1 + +Output: 3 + +Explanation: + +The substrings with every vowel and one consonant are: + +word[0..5], which is "ieaouq". +word[6..11], which is "qieaou". +word[7..12], which is "ieaouq". + + +Constraints: + +5 <= word.length <= 250 +word consists only of lowercase English letters. +0 <= k <= word.length - 5 +""" + +from collections import defaultdict + + +class Solution: + def countOfSubstrings_error(self, word: str, k: int) -> int: + """ + sliding window of i, j + counter of aeiou and consonants counter + O(N) + + Edge case: "iqeaouqi" + """ + cons_cnt = 0 + vowel_cnt = defaultdict(int) + vowels = set([c for c in "aeiou"]) + + ret = 0 + i = -1 # A[:i] + j = 0 + for j in range(len(word)): + char = word[j] + if char in vowels: + vowel_cnt[char] += 1 + else: + cons_cnt += 1 + + while i < j and cons_cnt > k: + i += 1 + remove = word[i] + if remove in vowels: + vowel_cnt[remove] -= 1 + if vowel_cnt[remove] == 0: + del vowel_cnt[remove] + else: + cons_cnt -= 1 + + if cons_cnt == k and len(vowel_cnt) == 5: + ret += 1 + + while i < j and cons_cnt == k: + i += 1 + remove = word[i] + if remove in vowels and vowel_cnt[remove] > 1 and len(vowel_cnt) == 5: + vowel_cnt[remove] -= 1 + ret += 1 + else: + i -= 1 + break + + return ret + + def countOfSubstrings(self, word: str, k: int) -> int: + """ + count by number of substrings + ret += (i - original_i + 1) + """ + cons_cnt = 0 + vowel_cnt = defaultdict(int) + vowels = set([c for c in "aeiou"]) + + ret = 0 + i = -1 # A[:i] + original_i = -1 + for j in range(len(word)): + char = word[j] + if char in vowels: + vowel_cnt[char] += 1 + else: + cons_cnt += 1 + + while i < j and cons_cnt > k: + i += 1 + remove = word[i] + if remove in vowels: + vowel_cnt[remove] -= 1 + if vowel_cnt[remove] == 0: + del vowel_cnt[remove] + else: + cons_cnt -= 1 + original_i = i + + while i < j and cons_cnt == k: + i += 1 + remove = word[i] + if remove in vowels and vowel_cnt[remove] > 1: + vowel_cnt[remove] -= 1 + else: + i -= 1 # restore + break + + if cons_cnt == k and len(vowel_cnt) == 5: + ret += (i - original_i + 1) + + return ret + \ No newline at end of file diff --git a/3306 Count of Substrings Containing Every Vowel and K Consonants II.py b/3306 Count of Substrings Containing Every Vowel and K Consonants II.py new file mode 100644 index 0000000..a30b99c --- /dev/null +++ b/3306 Count of Substrings Containing Every Vowel and K Consonants II.py @@ -0,0 +1,93 @@ +""" +You are given a string word and a non-negative integer k. + +Return the total number of +substrings + of word that contain every vowel ('a', 'e', 'i', 'o', and 'u') at least once and exactly k consonants. + + + +Example 1: + +Input: word = "aeioqq", k = 1 + +Output: 0 + +Explanation: + +There is no substring with every vowel. + +Example 2: + +Input: word = "aeiou", k = 0 + +Output: 1 + +Explanation: + +The only substring with every vowel and zero consonants is word[0..4], which is "aeiou". + +Example 3: + +Input: word = "ieaouqqieaouqq", k = 1 + +Output: 3 + +Explanation: + +The substrings with every vowel and one consonant are: + +word[0..5], which is "ieaouq". +word[6..11], which is "qieaou". +word[7..12], which is "ieaouq". + + +Constraints: + +5 <= word.length <= 2 * 10^5 +word consists only of lowercase English letters. +0 <= k <= word.length - 5 +""" +from collections import defaultdict + + +class Solution: + def countOfSubstrings(self, word: str, k: int) -> int: + cons_cnt = 0 + vowel_cnt = defaultdict(int) + vowels = set([c for c in "aeiou"]) + + ret = 0 + i = -1 # A[:i] + original_i = -1 + for j in range(len(word)): + char = word[j] + if char in vowels: + vowel_cnt[char] += 1 + else: + cons_cnt += 1 + + while i < j and cons_cnt > k: + i += 1 + remove = word[i] + if remove in vowels: + vowel_cnt[remove] -= 1 + if vowel_cnt[remove] == 0: + del vowel_cnt[remove] + else: + cons_cnt -= 1 + original_i = i + + while i < j and cons_cnt == k: + i += 1 + remove = word[i] + if remove in vowels and vowel_cnt[remove] > 1: + vowel_cnt[remove] -= 1 + else: + i -= 1 # restore + break + + if cons_cnt == k and len(vowel_cnt) == 5: + ret += (i - original_i + 1) + + return ret \ No newline at end of file diff --git a/3309 Maximum Possible Number by Binary Concatenation.py b/3309 Maximum Possible Number by Binary Concatenation.py new file mode 100644 index 0000000..401a5ab --- /dev/null +++ b/3309 Maximum Possible Number by Binary Concatenation.py @@ -0,0 +1,76 @@ +""" +You are given an array of integers nums of size 3. + +Return the maximum possible number whose binary representation can be formed by concatenating the binary representation of all elements in nums in some order. + +Note that the binary representation of any number does not contain leading zeros. + + + +Example 1: + +Input: nums = [1,2,3] + +Output: 30 + +Explanation: + +Concatenate the numbers in the order [3, 1, 2] to get the result "11110", which is the binary representation of 30. + +Example 2: + +Input: nums = [2,8,16] + +Output: 1296 + +Explanation: + +Concatenate the numbers in the order [2, 8, 16] to get the result "10100010000", which is the binary representation of 1296. + + + +Constraints: + +nums.length == 3 +1 <= nums[i] <= 127 +""" +class Solution: + def maxGoodNumber_error(self, nums: List[int]) -> int: + """ + 11 + 101 + 10001 + 1010101 + + just sort by lexical order + + but 1 should be in front of 10 + """ + nums_bin_str = [str(bin(n))[2:] for n in nums] + nums_bin_str.sort(reverse=True) + return int("".join(nums_bin_str), 2) + + def maxGoodNumber(self, nums: List[int]) -> int: + """ + generate all permutation + """ + # '0b101' + nums_bin_str = [str(bin(n))[2:] for n in nums] + ret = [] + self.permutations(nums_bin_str, 0, ret) + return max( + [int("".join(n), 2) for n in ret] + ) + + def permutations(self, A, cur, ret): + # in-place itertools.permutations + if cur == len(A): + ret.append(list(A)) # clone + return + + for i in range(cur, len(A)): + # swap + A[cur], A[i] = A[i], A[cur] + self.permutations(A, cur+1, ret) + # restore + A[i], A[cur] = A[cur], A[i] diff --git a/331 Verify Preorder Serialization of a Binary Tree.py b/331 Verify Preorder Serialization of a Binary Tree.py new file mode 100644 index 0000000..f2fae51 --- /dev/null +++ b/331 Verify Preorder Serialization of a Binary Tree.py @@ -0,0 +1,89 @@ +""" +One way to serialize a binary tree is to use pre-order traversal. When we encounter a non-null node, we record the +node's value. If it is a null node, we record using a sentinel value such as #. + + _9_ + / \ + 3 2 + / \ / \ + 4 1 # 6 +/ \ / \ / \ +# # # # # # +For example, the above binary tree can be serialized to the string "9,3,4,#,#,1,#,#,2,#,6,#,#", where # represents a +null node. + +Given a string of comma separated values, verify whether it is a correct preorder traversal serialization of a binary +tree. Find an algorithm without reconstructing the tree. + +Each comma separated value in the string must be either an integer or a character '#' representing null pointer. + +You may assume that the input format is always valid, for example it could never contain two consecutive commas such as +"1,,3". + +Example 1: +"9,3,4,#,#,1,#,#,2,#,6,#,#" +Return true + +Example 2: +"1,#" +Return false + +Example 3: +"9,#,#,1" +Return false +""" +__author__ = 'Daniel' + + +class Solution(object): + def isValidSerialization(self, preorder): + """ + :type preorder: str + :rtype: bool + """ + stk = preorder.split(',') + child_cnt = 0 + while stk: + if stk[-1] == '#': + stk.pop() + child_cnt += 1 + else: + child_cnt -= 2 + if child_cnt < 0: + return False + + stk.pop() + child_cnt += 1 + + return not stk and child_cnt == 1 + + def isValidSerializationSpace(self, preorder): + """ + :type preorder: str + :rtype: bool + """ + stk = preorder.split(',') + child_stk = [] + while stk: + if stk[-1] == '#': + child_stk.append(stk.pop()) # a counter is enough + else: + try: + child_stk.pop() + child_stk.pop() + stk.pop() + child_stk.append('#') + except IndexError: + return False + + return not stk and len(child_stk) == 1 + + +if __name__ == "__main__": + Solution().isValidSerialization("9,3,4,#,#,1,#,#,2,#,6,#,#") + + + + + + diff --git a/3310 Remove Methods From Project.py b/3310 Remove Methods From Project.py new file mode 100644 index 0000000..6b0c491 --- /dev/null +++ b/3310 Remove Methods From Project.py @@ -0,0 +1,93 @@ +""" +You are maintaining a project that has n methods numbered from 0 to n - 1. + +You are given two integers n and k, and a 2D integer array invocations, where invocations[i] = [ai, bi] indicates that method ai invokes method bi. + +There is a known bug in method k. Method k, along with any method invoked by it, either directly or indirectly, are considered suspicious and we aim to remove them. + +A group of methods can only be removed if no method outside the group invokes any methods within it. + +Return an array containing all the remaining methods after removing all the suspicious methods. You may return the answer in any order. If it is not possible to remove all the suspicious methods, none should be removed. + + + +Example 1: + +Input: n = 4, k = 1, invocations = [[1,2],[0,1],[3,2]] + +Output: [0,1,2,3] + +Explanation: + + + +Method 2 and method 1 are suspicious, but they are directly invoked by methods 3 and 0, which are not suspicious. We return all elements without removing anything. + +Example 2: + +Input: n = 5, k = 0, invocations = [[1,2],[0,2],[0,1],[3,4]] + +Output: [3,4] + +Explanation: + + + +Methods 0, 1, and 2 are suspicious and they are not directly invoked by any other method. We can remove them. + +Example 3: + +Input: n = 3, k = 2, invocations = [[1,2],[0,1],[2,0]] + +Output: [] + +Explanation: + + + +All methods are suspicious. We can remove them. + + + +Constraints: + +1 <= n <= 105 +0 <= k <= n - 1 +0 <= invocations.length <= 2 * 105 +invocations[i] == [ai, bi] +0 <= ai, bi <= n - 1 +ai != bi +invocations[i] != invocations[j] +""" +from collections import defaultdict + + +class Solution: + def remainingMethods(self, n: int, k: int, invocations: List[List[int]]) -> List[int]: + """ + Identify all suspicious methods -> DSP + Identify any non-suspicious methods invoke the suspicious -> reverse edge to check + """ + G = defaultdict(list) + H = defaultdict(list) # reverse + for a, b in invocations: + G[a].append(b) + H[b].append(a) + + suspicious = set() + self.dfs(G, k, suspicious) + for v in suspicious: + for nbr in H[v]: + if nbr not in suspicious: + return [i for i in range(n)] + + return [i for i in range(n) if i not in suspicious] + + def dfs(self, G, cur, visited): + visited.add(cur) + for nbr in G[cur]: + if nbr not in visited: + self.dfs(G, nbr, visited) + + + \ No newline at end of file diff --git a/3316 Find Maximum Removals From Source String.py b/3316 Find Maximum Removals From Source String.py new file mode 100644 index 0000000..2d5e025 --- /dev/null +++ b/3316 Find Maximum Removals From Source String.py @@ -0,0 +1,138 @@ +""" +You are given a string source of size n, a string pattern that is a +subsequence + of source, and a sorted integer array targetIndices that contains distinct numbers in the range [0, n - 1]. + +We define an operation as removing a character at an index idx from source such that: + +idx is an element of targetIndices. +pattern remains a +subsequence + of source after removing the character. +Performing an operation does not change the indices of the other characters in source. For example, if you remove 'c' from "acb", the character at index 2 would still be 'b'. + +Return the maximum number of operations that can be performed. + + + +Example 1: + +Input: source = "abbaa", pattern = "aba", targetIndices = [0,1,2] + +Output: 1 + +Explanation: + +We can't remove source[0] but we can do either of these two operations: + +Remove source[1], so that source becomes "a_baa". +Remove source[2], so that source becomes "ab_aa". +Example 2: + +Input: source = "bcda", pattern = "d", targetIndices = [0,3] + +Output: 2 + +Explanation: + +We can remove source[0] and source[3] in two operations. + +Example 3: + +Input: source = "dda", pattern = "dda", targetIndices = [0,1,2] + +Output: 0 + +Explanation: + +We can't remove any character from source. + +Example 4: + +Input: source = "yeyeykyded", pattern = "yeyyd", targetIndices = [0,2,3,4] + +Output: 2 + +Explanation: + +We can remove source[2] and source[3] in two operations. + + + +Constraints: + +1 <= n == source.length <= 3 * 10^3 +1 <= pattern.length <= n +1 <= targetIndices.length <= n +targetIndices is sorted in ascending order. +The input is generated such that targetIndices contains distinct elements in the range [0, n - 1]. +source and pattern consist only of lowercase English letters. +The input is generated such that pattern appears as a subsequence in source. +""" +import sys + + +class Solution: + def maxRemovals_backward(self, A: str, B: str, targetIndices: List[int]) -> int: + """ + Max possiblee: Remove all targetIndices, check pattern + + Sorted array of targetIndices + From pattern, map from pattern idx -> list of source idx + + Check subsequence - two pointers + + Backward (bottom right) DP + Define source as A and pattern as B + Let F[i][j] be the max operation for A[i:] and B[j:] while satisfy the condition + F[i][j] = + * F[i+1][j] + 1 # remove A[i] + * F[i+1][j+1] # A[i] == B[j] matching, no removal + """ + target = set(targetIndices) + m = len(A) + n = len(B) + F = [ + [-sys.maxsize-1 for _ in range(n+1)] + for _ in range(m+1) + ] + F[m][n] = 0 + for i in range(m-1, -1, -1): + F[i][n] = F[i+1][n] + (1 if i in target else 0) + + for i in range(m-1, -1, -1): + for j in range(n-1, -1, -1): + F[i][j] = F[i+1][j] + (1 if i in target else 0) # remove A[i] + if A[i] == B[j]: + F[i][j] = max(F[i][j], F[i+1][j+1]) # match A[i] B[j] + + return F[0][0] + + def maxRemovals(self, A: str, B: str, targetIndices: List[int]) -> int: + """ + Forward (top left) DP + Define source as A and pattern as B + Let F[i][j] be the max operation for A[:i] and B[:j] while satisfy the condition + F[i][j] = + * F[i-1][j] + 1 # remove A[i-1] + * F[i-1][j-1] # A[i] == B[j] matching, no removal + """ + target = set(targetIndices) + m = len(A) + n = len(B) + F = [ + [-sys.maxsize-1 for _ in range(n+1)] + for _ in range(m+1) + ] + F[0][0] = 0 + for i in range(1, m+1): + F[i][0] = F[i-1][0] + (1 if i-1 in target else 0) + + for i in range(1, m+1): + for j in range(1, n+1): + F[i][j] = F[i-1][j] + (1 if i-1 in target else 0) # remove A[i] + if A[i-1] == B[j-1]: + F[i][j] = max(F[i][j], F[i-1][j-1]) # match A[i] B[j] + + return F[m][n] + diff --git a/332 Reconstruct Itinerary.py b/332 Reconstruct Itinerary.py new file mode 100644 index 0000000..957ad27 --- /dev/null +++ b/332 Reconstruct Itinerary.py @@ -0,0 +1,55 @@ +""" +Given a list of airline tickets represented by pairs of departure and arrival airports [from, to], reconstruct the +itinerary in order. All of the tickets belong to a man who departs from JFK. Thus, the itinerary must begin with JFK. + +Note: +If there are multiple valid itineraries, you should return the itinerary that has the smallest lexical order when read +as a single string. For example, the itinerary ["JFK", "LGA"] has a smaller lexical order than ["JFK", "LGB"]. +All airports are represented by three capital letters (IATA code). +You may assume all tickets form at least one valid itinerary. +Example 1: +tickets = [["MUC", "LHR"], ["JFK", "MUC"], ["SFO", "SJC"], ["LHR", "SFO"]] +Return ["JFK", "MUC", "LHR", "SFO", "SJC"]. +Example 2: +tickets = [["JFK","SFO"],["JFK","ATL"],["SFO","ATL"],["ATL","JFK"],["ATL","SFO"]] +Return ["JFK","ATL","JFK","SFO","ATL","SFO"]. +Another possible reconstruction is ["JFK","SFO","ATL","JFK","ATL","SFO"]. But it is larger in lexical order. +""" +import heapq +from collections import defaultdict, deque + +__author__ = 'Daniel' + + +class Solution(object): + def findItinerary(self, tickets): + """ + Euler path: + An Euler path is a path that uses every edge of a graph exactly once. + + Hierholzer's algorithm a Euler path, must be directed graph + The graph must be directed graph + + Heap can be replaced by stack/queue and sort the original list + + The ret is build as from right to left: JFK <- NRT <- JFK <- KUL + :type tickets: List[List[str]] + :rtype: List[str] + """ + G = defaultdict(list) # every list is a heap + for s, e in tickets: + heapq.heappush(G[s], e) # heap lexical order + + ret = deque() + self.dfs(G, 'JFK', ret) + return list(ret) + + def dfs(self, G, cur, ret): + while G[cur]: + self.dfs(G, heapq.heappop(G[cur]), ret) + + ret.appendleft(cur) + + +if __name__ == "__main__": + assert Solution().findItinerary([["JFK","KUL"],["JFK","NRT"],["NRT","JFK"]]) == ['JFK', 'NRT', 'JFK', 'KUL'] diff --git a/3324 Find the Sequence of Strings Appeared on the Screen.py b/3324 Find the Sequence of Strings Appeared on the Screen.py new file mode 100644 index 0000000..b003423 --- /dev/null +++ b/3324 Find the Sequence of Strings Appeared on the Screen.py @@ -0,0 +1,59 @@ +#!/usr/bin/python3 +""" +You are given a string target. + +Alice is going to type target on her computer using a special keyboard that has only two keys: + +Key 1 appends the character "a" to the string on the screen. +Key 2 changes the last character of the string on the screen to its next character in the English alphabet. For example, "c" changes to "d" and "z" changes to "a". +Note that initially there is an empty string "" on the screen, so she can only press key 1. + +Return a list of all strings that appear on the screen as Alice types target, in the order they appear, using the minimum key presses. + + + +Example 1: + +Input: target = "abc" + +Output: ["a","aa","ab","aba","abb","abc"] + +Explanation: + +The sequence of key presses done by Alice are: + +Press key 1, and the string on the screen becomes "a". +Press key 1, and the string on the screen becomes "aa". +Press key 2, and the string on the screen becomes "ab". +Press key 1, and the string on the screen becomes "aba". +Press key 2, and the string on the screen becomes "abb". +Press key 2, and the string on the screen becomes "abc". +Example 2: + +Input: target = "he" + +Output: ["a","b","c","d","e","f","g","h","ha","hb","hc","hd","he"] + + + +Constraints: + +1 <= target.length <= 400 +target consists only of lowercase English letters. +""" +class Solution: + def stringSequence(self, target: str) -> List[str]: + """ + append + modify the last + greedy + """ + ret = [] + cur = [] + for c in target: + cur.append("a") + ret.append("".join(cur)) + while cur[-1] != c: + cur[-1] = chr(ord(cur[-1]) + 1) + ret.append("".join(cur)) + + return ret \ No newline at end of file diff --git a/333 Largest BST Subtree.py b/333 Largest BST Subtree.py new file mode 100644 index 0000000..6b220d1 --- /dev/null +++ b/333 Largest BST Subtree.py @@ -0,0 +1,91 @@ +""" +Premium Question +""" +import sys + +__author__ = 'Daniel' + + +# Definition for a binary tree node. +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class BSTInfo(object): + def __init__(self, sz, lo, hi): + self.sz = sz + self.lo = lo + self.hi = hi + + +MAX = sys.maxint +MIN = -MAX - 1 + + +class Solution(object): + def __init__(self): + self.gmax = 0 + + def largestBSTSubtree(self, root): + """ + :type root: TreeNode + :rtype: int + """ + self.measure(root) + return self.gmax + + def measure(self, root): + if not root: + return BSTInfo(0, MAX, MIN) + + left = self.measure(root.left) + right = self.measure(root.right) + if left.sz == -1 or right.sz == -1 or not left.hi <= root.val or not root.val <= right.lo: + return BSTInfo(-1, MIN, MAX) + + sz = 1 + left.sz + right.sz + self.gmax = max(self.gmax, sz) + # when root.left is None + return BSTInfo(sz, min(root.val, left.lo), max(root.val, right.hi)) + + +class SolutionError(object): + def __init__(self): + self.gmax = 0 + + def largestBSTSubtree(self, root): + """ + :type root: TreeNode + :rtype: int + """ + self.measure(root) + return self.gmax + + def measure(self, root): + if not root: + return 0 + + left = self.measure(root.left) + right = self.measure(root.right) + + if root.left and not root.val >= root.left.val or root.right and not root.val <= root.right.val: + return 0 + + if root.left and left == 0 or root.right and right == 0: + return 0 + + ret = 1 + left + right + self.gmax = max(self.gmax, ret) + return ret + +if __name__ == "__main__": + root = TreeNode(1) + root.left = TreeNode(2) + print Solution().largestBSTSubtree(root) + + + + diff --git a/3331 Find Subtree Sizes After Changes.py b/3331 Find Subtree Sizes After Changes.py new file mode 100644 index 0000000..8756098 --- /dev/null +++ b/3331 Find Subtree Sizes After Changes.py @@ -0,0 +1,147 @@ +#!/usr/bin/python3 +""" +You are given a tree rooted at node 0 that consists of n nodes numbered from 0 to n - 1. The tree is represented by an array parent of size n, where parent[i] is the parent of node i. Since node 0 is the root, parent[0] == -1. + +You are also given a string s of length n, where s[i] is the character assigned to node i. + +We make the following changes on the tree one time simultaneously for all nodes x from 1 to n - 1: + +Find the closest node y to node x such that y is an ancestor of x, and s[x] == s[y]. +If node y does not exist, do nothing. +Otherwise, remove the edge between x and its current parent and make node y the new parent of x by adding an edge between them. +Return an array answer of size n where answer[i] is the size of the +subtree + rooted at node i in the final tree. + + + +Example 1: + +Input: parent = [-1,0,0,1,1,1], s = "abaabc" + +Output: [6,3,1,1,1,1] + +Explanation: + + +The parent of node 3 will change from node 1 to node 0. + +Example 2: + +Input: parent = [-1,0,4,0,1], s = "abbba" + +Output: [5,2,1,1,1] + +Explanation: + + +The following changes will happen at the same time: + +The parent of node 4 will change from node 1 to node 0. +The parent of node 2 will change from node 4 to node 1. + + +Constraints: + +n == parent.length == s.length +1 <= n <= 10^5 +0 <= parent[i] <= n - 1 for all i >= 1. +parent[0] == -1 +parent represents a valid tree. +s consists only of lowercase English letters. +""" +from collections import defaultdict + + +class Solution: + def findSubtreeSizes(self, parent: List[int], s: str) -> List[int]: + """ + Naively dfs updating the tree results in TLE of O(N^2). + Need to do a topological dfs update on the tree for O(N). + * Does not require `visited` in topological sort since it's acyclic tree + * The `path` holds the map of a list of ancestors with a given char, with the last one as the closest + """ + G = defaultdict(list) + for i, pi in enumerate(parent): + G[pi].append(i) + + self.topo(G, 0, defaultdict(list), parent, s) + + G = defaultdict(list) + for i, pi in enumerate(parent): + G[pi].append(i) + + ret = [0 for _ in range(len(parent))] + self.dfs(G, 0, ret) + return ret + + def topo(self, G, cur, path, parent, s): + # topological dfs + char = s[cur] + if len(path[char]) > 0: + pi = path[char][~0] # or path[char][-1] + parent[cur] = pi + + path[char].append(cur) + for v in G[cur]: + self.topo(G, v, path, parent, s) + path[char].pop() + + def dfs(self, G, cur, ret): + # compute size + sz = 1 + for v in G[cur]: + sz += self.dfs(G, v, ret) + + ret[cur] = sz + return sz + + + +class SolutionTLE: + def findSubtreeSizes(self, parent: List[int], s: str) -> List[int]: + """ + Just do the operation + index 0 is always the root + + To get sub tree size, we can + 1. convert to TreeNode + 2. Sort pi array and then count. It does not work. It is not necessary pi > i + """ + new_parent = list(parent) # clone + for i in range(len(parent)): + pi = parent[i] # index + while pi != -1 and s[pi] != s[i]: + pi = parent[pi] + + if pi != -1: + new_parent[i] = pi + + return self.find_size(new_parent) + + def find_size(self, parent): + G = defaultdict(list) + for i, pi in enumerate(parent): + G[pi].append(i) + + ret = [0 for _ in parent] + self.dfs(G, 0, ret) + return ret + + def dfs(self, G, i, ret): + sz = 1 + for v in G[i]: + sz += self.dfs(G, v, ret) + + ret[i] = sz + return sz + + def find_size_wrong(self, parent): + # compute size + sz = [1 for _ in parent] + parent = [(pi, i) for i, pi in enumerate(parent)] + for pi, i in sorted(parent, reverse=True): + if pi != -1: + sz[pi] += sz[i] + + return sz diff --git a/334 Increasing Triplet Subsequence py3.py b/334 Increasing Triplet Subsequence py3.py new file mode 100644 index 0000000..2645765 --- /dev/null +++ b/334 Increasing Triplet Subsequence py3.py @@ -0,0 +1,38 @@ +#!/usr/bin/python3 +""" +Given an unsorted array return whether an increasing subsequence of length 3 +exists or not in the array. + +Formally the function should: + +Return true if there exists i, j, k +such that arr[i] < arr[j] < arr[k] given 0 ≤ i < j < k ≤ n-1 else return false. +Note: Your algorithm should run in O(n) time complexity and O(1) space complexity. + +Example 1: + +Input: [1,2,3,4,5] +Output: true +Example 2: + +Input: [5,4,3,2,1] +Output: false +""" +from typing import List +from bisect import bisect_left + + +class Solution: + def increasingTriplet(self, nums: List[int]) -> bool: + """ + Patience sort + LIS dp with binary search + """ + F = [float('inf') for _ in range(3)] + for n in nums: + i = bisect_left(F, n) + if i >= 2: + return True + F[i] = n + + return False diff --git a/334 Increasing Triplet Subsequence.py b/334 Increasing Triplet Subsequence.py new file mode 100644 index 0000000..6bd9611 --- /dev/null +++ b/334 Increasing Triplet Subsequence.py @@ -0,0 +1,57 @@ +""" +Given an unsorted array return whether an increasing subsequence of length 3 exists or not in the array. + +Formally the function should: +Return true if there exists i, j, k +such that arr[i] < arr[j] < arr[k] given 0 <= i < j < k <= n-1 else return false. +Your algorithm should run in O(n) time complexity and O(1) space complexity. + +Examples: +Given [1, 2, 3, 4, 5], +return true. + +Given [5, 4, 3, 2, 1], +return false. +""" +import sys + +__author__ = 'Daniel' + + +class Solution(object): + def increasingTriplet(self, nums): + """ + Brute force: O(N^3) + + dp: O(N) + :type nums: List[int] + :rtype: bool + """ + min1 = sys.maxint + min2 = sys.maxint + for e in nums: + if e < min1: + min1 = e + elif e != min1 and e < min2: + min2 = e + elif e > min2: + return True + + return False + + def increasingTripletError(self, nums): + """ + use stack + :type nums: List[int] + :rtype: bool + """ + stk = [] + for elt in nums: + while stk and stk[-1] >= elt: + stk.pop() + + stk.append(elt) + if len(stk) >= 3: + return True + + return False diff --git a/3355 Zero Array Transformation I.py b/3355 Zero Array Transformation I.py new file mode 100644 index 0000000..78bbbf5 --- /dev/null +++ b/3355 Zero Array Transformation I.py @@ -0,0 +1,88 @@ +#!/usr/bin/python3 +""" +You are given an integer array nums of length n and a 2D array queries, where queries[i] = [li, ri]. + +For each queries[i]: + +Select a subset of indices within the range [li, ri] in nums. +Decrement the values at the selected indices by 1. +A Zero Array is an array where all elements are equal to 0. + +Return true if it is possible to transform nums into a Zero Array after processing all the queries sequentially, otherwise return false. + +A subset of an array is a selection of elements (possibly none) of the array. + + + +Example 1: + +Input: nums = [1,0,1], queries = [[0,2]] + +Output: true + +Explanation: + +For i = 0: +Select the subset of indices as [0, 2] and decrement the values at these indices by 1. +The array will become [0, 0, 0], which is a Zero Array. +Example 2: + +Input: nums = [4,3,2,1], queries = [[1,3],[0,2]] + +Output: false + +Explanation: + +For i = 0: +Select the subset of indices as [1, 2, 3] and decrement the values at these indices by 1. +The array will become [4, 2, 1, 0]. +For i = 1: +Select the subset of indices as [0, 1, 2] and decrement the values at these indices by 1. +The array will become [3, 1, 0, 0], which is not a Zero Array. + + +Constraints: + +1 <= nums.length <= 10^5 +0 <= nums[i] <= 10^5 +1 <= queries.length <= 10^5 +queries[i].length == 2 +0 <= li <= ri < nums.length +""" +class Solution: + def isZeroArray_TLE(self, nums: List[int], queries: List[List[int]]) -> bool: + """ + Naive solution: + Counter[i] represent times index i got hit by queries + Just check whether the counter is non-positive + We can reuse array as counter + + Time complexity: O(Q * N) + """ + for l, r in queries: + for i in range(l, r + 1): + nums[i] -= 1 + + for e in nums: + if e > 0: + return False + return True + + def isZeroArray(self, nums: List[int], queries: List[List[int]]) -> bool: + """ + prefix sum + sweep line algorithm + """ + n = len(nums) + pre = [0 for _ in range(n + 1)] + for l, r in queries: + pre[l] += 1 + pre[r+1] -= 1 + + # accumulate + for i in range(1, n + 1): + pre[i] += pre[i-1] + + for i in range(n): + if pre[i] < nums[i]: + return False + return True \ No newline at end of file diff --git a/3356 Zero Array Transformation II.py b/3356 Zero Array Transformation II.py new file mode 100644 index 0000000..d83c024 --- /dev/null +++ b/3356 Zero Array Transformation II.py @@ -0,0 +1,112 @@ +#!/usr/bin/python3 +""" +You are given an integer array nums of length n and a 2D array queries where queries[i] = [li, ri, vali]. + +Each queries[i] represents the following action on nums: + +Decrement the value at each index in the range [li, ri] in nums by at most vali. +The amount by which each value is decremented can be chosen independently for each index. +A Zero Array is an array with all its elements equal to 0. + +Return the minimum possible non-negative value of k, such that after processing the first k queries in sequence, nums becomes a Zero Array. If no such k exists, return -1. + + + +Example 1: + +Input: nums = [2,0,2], queries = [[0,2,1],[0,2,1],[1,1,3]] + +Output: 2 + +Explanation: + +For i = 0 (l = 0, r = 2, val = 1): +Decrement values at indices [0, 1, 2] by [1, 0, 1] respectively. +The array will become [1, 0, 1]. +For i = 1 (l = 0, r = 2, val = 1): +Decrement values at indices [0, 1, 2] by [1, 0, 1] respectively. +The array will become [0, 0, 0], which is a Zero Array. Therefore, the minimum value of k is 2. +Example 2: + +Input: nums = [4,3,2,1], queries = [[1,3,2],[0,2,1]] + +Output: -1 + +Explanation: + +For i = 0 (l = 1, r = 3, val = 2): +Decrement values at indices [1, 2, 3] by [2, 2, 1] respectively. +The array will become [4, 1, 0, 0]. +For i = 1 (l = 0, r = 2, val = 1): +Decrement values at indices [0, 1, 2] by [1, 1, 0] respectively. +The array will become [3, 0, 0, 0], which is not a Zero Array. + + +Constraints: + +1 <= nums.length <= 10^5 +0 <= nums[i] <= 5 * 10^5 +1 <= queries.length <= 10^5 +queries[i].length == 3 +0 <= li <= ri < nums.length +1 <= vali <= 5 +""" +class Solution: + def minZeroArray(self, nums: List[int], queries: List[List[int]]) -> int: + """ + online prefix sum + sweep line + optiized + """ + n = len(nums) + events = [0 for i in range(n+1)] + + accu = 0 + k = 0 + for i in range(n): + # process one num + while accu + events[i] < nums[i]: + # process one query + if k >= len(queries): + return -1 + + l, r, val = queries[k] + if i <= r: + events[max(l, i)] += val + events[r+1] -= val + + k += 1 + + # lazy increment at the end + accu += events[i] + + return k + + def minZeroArray_alternative(self, nums: List[int], queries: List[List[int]]) -> int: + """ + online prefix sum + sweep line + """ + n = len(nums) + events = [0 for i in range(n+1)] + + accu = 0 + k = 0 + for i in range(n): + # process one num + accu += events[i] # eager increment + while accu < nums[i] and k < len(queries): + # process one query + l, r, val = queries[k] + # future events + if l > i: + events[l] += val + if i <= r: + events[r+1] -= val + if l <= i and i <= r: + accu += val + + k += 1 + + if k >= len(queries) and accu < nums[i]: + return -1 + + return k diff --git a/336 Palindrome Pairs.py b/336 Palindrome Pairs.py new file mode 100644 index 0000000..be86857 --- /dev/null +++ b/336 Palindrome Pairs.py @@ -0,0 +1,98 @@ +#!/usr/bin/python3 +""" +Given a list of unique words, find all pairs of distinct indices (i, j) in the +given list, so that the concatenation of the two words, i.e. words[i] + words[j] +is a palindrome. + +Example 1: + +Input: ["abcd","dcba","lls","s","sssll"] +Output: [[0,1],[1,0],[3,2],[2,4]] +Explanation: The palindromes are ["dcbaabcd","abcddcba","slls","llssssll"] +Example 2: + +Input: ["bat","tab","cat"] +Output: [[0,1],[1,0]] +Explanation: The palindromes are ["battab","tabbat"] +""" +from typing import List +from collections import defaultdict + + +class TrieNode: + def __init__(self): + self.pali_prefix_idxes = [] # suffix ends, prefix pali + self.word_idx = None + self.children = defaultdict(TrieNode) + + +class Solution: + def palindromePairs(self, words: List[str]) -> List[List[int]]: + """ + Brute force, i, j and then check palindrom + O(N^2 * L) + + Reverse the str, and then check O(N * L). Does it work actually? + Check: map str -> idx + + |---s1---|---s2--| |---s1---|-s2-| |-s1-|---s2---| + Need to check whether part of the str is palindrome. + Part of str -> Trie. + How to check part of the str. Useful + + Better way of checking palindrome? Infamouse Manacher + + word_i | word_j + abc pppp | cba + abc | pppp cba + + If palindrome suffix in work_i, we only need to check the "abc" against word_j + Similarly for palindrome prefix in word_j + + Construct Trie for word_j reversely, since word_j is being checked + """ + root = TrieNode() + for idx, w in enumerate(words): + cur = root + for i in range(len(w) - 1, -1, -1): + # cur.children[w[i]] # error, pre-advancing the trie is unable to handle empty str + if self.is_palindrome(w, 0, i + 1): + cur.pali_prefix_idxes.append(idx) + + cur = cur.children[w[i]] + + cur.pali_prefix_idxes.append(idx) # empty str is palindrome + cur.word_idx = idx # word ends + + ret = [] + for idx, w in enumerate(words): + cur = root + for i in range(len(w)): + # cur.children.get(w[i], None) # error, pre-advancing the trie is unable to handle empty str + if self.is_palindrome(w, i, len(w)) and cur.word_idx is not None and cur.word_idx != idx: + ret.append([idx, cur.word_idx]) + + cur = cur.children.get(w[i], None) + if cur is None: + break + else: + for idx_j in cur.pali_prefix_idxes: + if idx != idx_j: + ret.append([idx, idx_j]) + + return ret + + def is_palindrome(self, w, lo, hi): + i = lo + j = hi - 1 + while i < j: + if w[i] != w[j]: + return False + i += 1 + j -= 1 + return True + + +if __name__ == "__main__": + assert Solution().palindromePairs(["a", ""]) == [[0,1],[1,0]] + assert Solution().palindromePairs(["abcd","dcba","lls","s","sssll"]) == [[0,1],[1,0],[2,4],[3,2]] diff --git a/337 House Robber III.py b/337 House Robber III.py new file mode 100644 index 0000000..a974de4 --- /dev/null +++ b/337 House Robber III.py @@ -0,0 +1,107 @@ +""" +The thief has found himself a new place for his thievery again. There is only one entrance to this area, called the +"root." Besides the root, each house has one and only one parent house. After a tour, the smart thief realized that +"all houses in this place forms a binary tree". It will automatically contact the police if two directly-linked houses +were broken into on the same night. + +Determine the maximum amount of money the thief can rob tonight without alerting the police. + +Example 1: + 3 + / \ + 2 3 + \ \ + 3 1 +Maximum amount of money the thief can rob = 3 + 3 + 1 = 7. +Example 2: + 3 + / \ + 4 5 + / \ \ + 1 3 1 +Maximum amount of money the thief can rob = 4 + 5 = 9. +""" +__author__ = 'Daniel' + + +# Definition for a binary tree node. +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution(object): + def __init__(self): + self.cache_rob = {} + self.cache_notrob = {} + + def rob(self, root): + """ + possible rob at root + :type root: TreeNode + :rtype: int + """ + if root is None: + return 0 + + if root not in self.cache_rob: + val = max( + self.notrob(root), + root.val + self.notrob(root.left) + self.notrob(root.right) + ) + self.cache_rob[root] = val + + return self.cache_rob[root] + + def notrob(self, root): + """ + not rob at the root + :param root: TreeNode + :return: int + """ + if root is None: + return 0 + + if root not in self.cache_notrob: + val = ( + self.rob(root.left) + + self.rob(root.right) + ) + + self.cache_notrob[root] = val + + return self.cache_notrob[root] + + +class SolutionTLE(object): + def rob(self, root): + """ + :type root: TreeNode + :rtype: int + """ + if root is None: + return 0 + + return max( + self.dorob(root), + self.notrob(root) + ) + + def dorob(self, root): + if root is None: + return 0 + + return ( + root.val + + self.notrob(root.left) + + self.notrob(root.right) + ) + + def notrob(self, root): + if root is None: + return 0 + + return (max(self.notrob(root.left), self.rob(root.left)) + + max(self.notrob(root.right), self.rob(root.right))) diff --git a/3371 Identify the Largest Outlier in an Array.py b/3371 Identify the Largest Outlier in an Array.py new file mode 100644 index 0000000..892d42b --- /dev/null +++ b/3371 Identify the Largest Outlier in an Array.py @@ -0,0 +1,72 @@ +#!/usr/bin/python3 +""" +You are given an integer array nums. This array contains n elements, where exactly n - 2 elements are special numbers. One of the remaining two elements is the sum of these special numbers, and the other is an outlier. + +An outlier is defined as a number that is neither one of the original special numbers nor the element representing the sum of those numbers. + +Note that special numbers, the sum element, and the outlier must have distinct indices, but may share the same value. + +Return the largest potential outlier in nums. + +Example 1: + +Input: nums = [2,3,5,10] + +Output: 10 + +Explanation: + +The special numbers could be 2 and 3, thus making their sum 5 and the outlier 10. + +Example 2: + +Input: nums = [-2,-1,-3,-6,4] + +Output: 4 + +Explanation: + +The special numbers could be -2, -1, and -3, thus making their sum -6 and the outlier 4. + +Example 3: + +Input: nums = [1,1,1,1,1,5,5] + +Output: 5 + +Explanation: + +The special numbers could be 1, 1, 1, 1, and 1, thus making their sum 5 and the other 5 as the outlier. + +Constraints: + +3 <= nums.length <= 105 +-1000 <= nums[i] <= 1000 +The input is generated such that at least one potential outlier exists in nums. +""" +import sys +from collections import defaultdict +from typing import List + + +class Solution: + def getLargestOutlier(self, nums: List[int]) -> int: + """ + if remove outlier, what will be the value of array sum + """ + total = sum(nums) + hm = defaultdict(list) + for i, v in enumerate(nums): + hm[v].append(i) + + maxa = -sys.maxsize-1 + for v in nums: + remain = total - v + if remain % 2 == 0: + half = remain // 2 + if half == v and len(hm[half]) == 1: + continue + if half in hm: + maxa = max(maxa, v) + + return maxa diff --git a/3372 Maximize the Number of Target Nodes After Connecting Trees I.py b/3372 Maximize the Number of Target Nodes After Connecting Trees I.py new file mode 100644 index 0000000..62e2930 --- /dev/null +++ b/3372 Maximize the Number of Target Nodes After Connecting Trees I.py @@ -0,0 +1,88 @@ +#!/usr/bin/python3 +""" +There exist two undirected trees with n and m nodes, with distinct labels in ranges [0, n - 1] and [0, m - 1], respectively. + +You are given two 2D integer arrays edges1 and edges2 of lengths n - 1 and m - 1, respectively, where edges1[i] = [ai, bi] indicates that there is an edge between nodes ai and bi in the first tree and edges2[i] = [ui, vi] indicates that there is an edge between nodes ui and vi in the second tree. You are also given an integer k. + +Node u is target to node v if the number of edges on the path from u to v is less than or equal to k. Note that a node is always target to itself. + +Return an array of n integers answer, where answer[i] is the maximum possible number of nodes target to node i of the first tree if you have to connect one node from the first tree to another node in the second tree. + +Note that queries are independent from each other. That is, for every query you will remove the added edge before proceeding to the next query. + +Example 1: + +Input: edges1 = [[0,1],[0,2],[2,3],[2,4]], edges2 = [[0,1],[0,2],[0,3],[2,7],[1,4],[4,5],[4,6]], k = 2 + +Output: [9,7,9,8,8] + +Explanation: + +For i = 0, connect node 0 from the first tree to node 0 from the second tree. +For i = 1, connect node 1 from the first tree to node 0 from the second tree. +For i = 2, connect node 2 from the first tree to node 4 from the second tree. +For i = 3, connect node 3 from the first tree to node 4 from the second tree. +For i = 4, connect node 4 from the first tree to node 4 from the second tree. + +Example 2: + +Input: edges1 = [[0,1],[0,2],[0,3],[0,4]], edges2 = [[0,1],[1,2],[2,3]], k = 1 + +Output: [6,3,3,3,3] + +Explanation: + +For every i, connect node i of the first tree with any node of the second tree. + +Constraints: + +2 <= n, m <= 1000 +edges1.length == n - 1 +edges2.length == m - 1 +edges1[i].length == edges2[i].length == 2 +edges1[i] = [ai, bi] +0 <= ai, bi < n +edges2[i] = [ui, vi] +0 <= ui, vi < m +The input is generated such that edges1 and edges2 represent valid trees. +0 <= k <= 1000 +""" +from collections import defaultdict + + +class Solution: + def maxTargetNodes(self, edges1: List[List[int]], edges2: List[List[int]], k: int) -> List[int]: + """ + Just greedily connect to the highest cardinality. + 2nd tree only calculate k-1 + """ + n = len(edges1) + 1 + m = len(edges2) + 1 + G1 = defaultdict(list) + for u, v in edges1: + G1[u].append(v) + G1[v].append(u) + + cardinality1 = [self.getCardinality(G1, i, k, [False] * n) for i in range(n)] + + G2 = defaultdict(list) + for u, v in edges2: + G2[u].append(v) + G2[v].append(u) + + cardinality2 = [self.getCardinality(G2, i, k - 1, [False] * m) for i in range(m)] + max2 = max(cardinality2) + return [ + cardinality1[i] + max2 + for i in range(n) + ] + + def getCardinality(self, G, u, k, visited): + # dfs + cardinality = 1 + visited[u] = True + for nbr in G[u]: + if not visited[nbr] and k - 1 >= 0: + cardinality += self.getCardinality(G, nbr, k - 1, visited) + + return cardinality \ No newline at end of file diff --git a/338 Counting Bits.py b/338 Counting Bits.py new file mode 100644 index 0000000..dec74d0 --- /dev/null +++ b/338 Counting Bits.py @@ -0,0 +1,49 @@ +""" +Given a non negative integer number num. For every numbers i in the range 0 <= i <= num calculate the number of 1's in +their binary representation and return them as an array. + +Example: +For num = 5 you should return [0,1,1,2,1,2]. + +Follow up: + +It is very easy to come up with a solution with run time O(n*sizeof(integer)). But can you do it in linear time O(n) / +possibly in a single pass? + +Space complexity should be O(n). +Can you do it like a boss? Do it without using any builtin function like __builtin_popcount in c++ or in any other +language. +""" +__author__ = 'Daniel' + + +class Solution(object): + def countBits(self, num): + """ + Dynamic programming: make use of what you have produced already + 0 => 0 + 1 => 1 + + 10 => 1+0 + 11 => 1+1 + + 100 => 1+0 + 101 => 1+1 + 110 => 1+1 + 111 => 1+2 + + :type num: int + :rtype: List[int] + """ + ret = [0] + i = 0 + hi = len(ret) + while len(ret) < num + 1: + if i == hi: + i = 0 + hi = len(ret) + + ret.append(1+ret[i]) + i += 1 + + return ret diff --git a/3381 Maximum Subarray Sum With Length Divisible by K.py b/3381 Maximum Subarray Sum With Length Divisible by K.py new file mode 100644 index 0000000..8cc217a --- /dev/null +++ b/3381 Maximum Subarray Sum With Length Divisible by K.py @@ -0,0 +1,84 @@ +""" +You are given an array of integers nums and an integer k. + +Return the maximum sum of a +subarray + of nums, such that the size of the subarray is divisible by k. + + + +Example 1: + +Input: nums = [1,2], k = 1 + +Output: 3 + +Explanation: + +The subarray [1, 2] with sum 3 has length equal to 2 which is divisible by 1. + +Example 2: + +Input: nums = [-1,-2,-3,-4,-5], k = 4 + +Output: -10 + +Explanation: + +The maximum sum subarray is [-1, -2, -3, -4] which has length equal to 4 which is divisible by 4. + +Example 3: + +Input: nums = [-5,1,2,-3,4], k = 2 + +Output: 4 + +Explanation: + +The maximum sum subarray is [1, 2, -3, 4] which has length equal to 4 which is divisible by 2. + + + +Constraints: + +1 <= k <= nums.length <= 2 * 10^5 +-10^9 <= nums[i] <= 10^9 +""" +import sys + +class Solution: + def maxSubarraySum(self, A: List[int], k: int) -> int: + """ + subarray sum -> prefix sum + search by i, j incremental of k + search is TLE, do a DP: + F[i] = max subarray sum at index of size divisible by k + """ + n = len(A) + prefix = [0 for _ in range(n+1)] + for i in range(n): + prefix[i+1] = prefix[i] + A[i] + + F = [-sys.maxsize-1 for _ in range(n+1)] + for i in range(k, n+1): + F[i] = prefix[i] - prefix[i-k] + max(0, F[i-k]) + + return max(F) + + def maxSubarraySum_TLE(self, A: List[int], k: int) -> int: + """ + subarray sum -> prefix sum + search by i, j incremental of k + """ + n = len(A) + prefix = [0 for _ in range(n+1)] + for i in range(n): + prefix[i+1] = prefix[i] + A[i] + + ret = -sys.maxsize-1 + for i in range(n): + for j in range(i + k, n + 1, k): + # sum(A[i:j]) + ret = max(ret, prefix[j] - prefix[i]) + + return ret diff --git a/339 Nested List Weight Sum.py b/339 Nested List Weight Sum.py new file mode 100644 index 0000000..b3060ec --- /dev/null +++ b/339 Nested List Weight Sum.py @@ -0,0 +1,56 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +""" +This is the interface that allows for creating nested lists. +You should not implement it, or speculate about its implementation +""" + + +class NestedInteger(object): + def isInteger(self): + """ + @return True if this NestedInteger holds a single integer, rather than a nested list. + :rtype bool + """ + + def getInteger(self): + """ + @return the single integer that this NestedInteger holds, if it holds a single integer + Return None if this NestedInteger holds a nested list + :rtype int + """ + + def getList(self): + """ + @return the nested list that this NestedInteger holds, if it holds a nested list + Return None if this NestedInteger holds a single integer + :rtype List[NestedInteger] + """ + + +class Solution(object): + def __init__(self): + self.sum = 0 + + def depthSum(self, nestedList): + """ + NestedInteger is a union type + :type nestedList: List[NestedInteger] + :rtype: int + """ + for elt in nestedList: + self.dfs(elt, 1) + + return self.sum + + def dfs(self, ni, depth): + if ni.isInteger(): + self.sum += ni.getInteger() * depth + else: + lst = ni.getList() + for elt in lst: + self.dfs(elt, depth + 1) diff --git a/3393 Count Paths With the Given XOR Value.py b/3393 Count Paths With the Given XOR Value.py new file mode 100644 index 0000000..a5fd15f --- /dev/null +++ b/3393 Count Paths With the Given XOR Value.py @@ -0,0 +1,91 @@ +#!/usr/bin/python3 +""" +You are given a 2D integer array grid with size m x n. You are also given an integer k. + +Your task is to calculate the number of paths you can take from the top-left cell (0, 0) to the bottom-right cell (m - 1, n - 1) satisfying the following constraints: + +You can either move to the right or down. Formally, from the cell (i, j) you may move to the cell (i, j + 1) or to the cell (i + 1, j) if the target cell exists. +The XOR of all the numbers on the path must be equal to k. +Return the total number of such paths. + +Since the answer can be very large, return the result modulo 10^9 + 7. + + + +Example 1: + +Input: grid = [[2, 1, 5], [7, 10, 0], [12, 6, 4]], k = 11 + +Output: 3 + +Explanation: + +The 3 paths are: + +(0, 0) → (1, 0) → (2, 0) → (2, 1) → (2, 2) +(0, 0) → (1, 0) → (1, 1) → (1, 2) → (2, 2) +(0, 0) → (0, 1) → (1, 1) → (2, 1) → (2, 2) +Example 2: + +Input: grid = [[1, 3, 3, 3], [0, 3, 3, 2], [3, 0, 1, 1]], k = 2 + +Output: 5 + +Explanation: + +The 5 paths are: + +(0, 0) → (1, 0) → (2, 0) → (2, 1) → (2, 2) → (2, 3) +(0, 0) → (1, 0) → (1, 1) → (2, 1) → (2, 2) → (2, 3) +(0, 0) → (1, 0) → (1, 1) → (1, 2) → (1, 3) → (2, 3) +(0, 0) → (0, 1) → (1, 1) → (1, 2) → (2, 2) → (2, 3) +(0, 0) → (0, 1) → (0, 2) → (1, 2) → (2, 2) → (2, 3) +Example 3: + +Input: grid = [[1, 1, 1, 2], [3, 0, 3, 2], [3, 0, 2, 2]], k = 10 + +Output: 0 + + + +Constraints: + +1 <= m == grid.length <= 300 +1 <= n == grid[r].length <= 300 +0 <= grid[r][c] < 16 +0 <= k < 16 +""" +from collections import defaultdict + +MOD = int(1e9 + 7) + +class Solution: + def countPathsWithXorValue(self, grid: List[List[int]], K: int) -> int: + """ + DP with a map of counter + F[i][j] -> dict + dict: number -> count + """ + m = len(grid) + n = len(grid[0]) + F = [ + [defaultdict(int) for _ in range(n)] + for _ in range(m) + ] + for i in range(m): + for j in range(n): + k = grid[i][j] + if i == 0 and j == 0: + F[i][j][k] = 1 + continue + + if i > 0: + for v, cnt in F[i-1][j].items(): + F[i][j][k ^ v] += cnt + F[i][j][k ^ v] %= MOD + if j > 0: + for v, cnt in F[i][j-1].items(): + F[i][j][k ^ v] += cnt + F[i][j][k ^ v] %= MOD + + return F[~0][~0][K] diff --git a/340 Longest Substring with At Most K Distinct Characters.py b/340 Longest Substring with At Most K Distinct Characters.py new file mode 100644 index 0000000..1770200 --- /dev/null +++ b/340 Longest Substring with At Most K Distinct Characters.py @@ -0,0 +1,47 @@ +""" +Given a string, find the length of the longest substring T that contains at most k distinct characters. + +For example, Given s = "eceba" and k = 2, + +T is "ece" which its length is 3. + +Show Company Tags +Show Tags +Show Similar Problems +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def lengthOfLongestSubstringKDistinct(self, s, k): + """ + Brute force: O(n^2 * n) + + Sliding window O(n) + :type s: str + :type k: int + :rtype: int + """ + st = 0 # start + counter = defaultdict(int) + maxa = 0 + for idx, val in enumerate(s): + if counter[val] == 0: + k -= 1 + + counter[val] += 1 + while k < 0: + counter[s[st]] -= 1 + if counter[s[st]] == 0: + k += 1 + st += 1 + + maxa = max(maxa, idx - st + 1) + + return maxa + + +if __name__ == "__main__": + assert Solution().lengthOfLongestSubstringKDistinct("eceba", 2) == 3 diff --git a/341 Flatten Nested List Iterator.py b/341 Flatten Nested List Iterator.py new file mode 100644 index 0000000..3a71429 --- /dev/null +++ b/341 Flatten Nested List Iterator.py @@ -0,0 +1,151 @@ +""" +Given a nested list of integers, implement an iterator to flatten it. + +Each element is either an integer, or a list -- whose elements may also be integers or other lists. + +Example 1: +Given the list [[1,1],2,[1,1]], + +By calling next repeatedly until hasNext returns false, the order of elements returned by next should be: [1,1,2,1,1]. + +Example 2: +Given the list [1,[4,[6]]], + +By calling next repeatedly until hasNext returns false, the order of elements returned by next should be: [1,4,6]. +""" +__author__ = 'Daniel' + + +""" +This is the interface that allows for creating nested lists. +You should not implement it, or speculate about its implementation +""" + + +class NestedInteger(object): + def isInteger(self): + """ + @return True if this NestedInteger holds a single integer, rather than a nested list. + :rtype bool + """ + return True + + def getInteger(self): + """ + @return the single integer that this NestedInteger holds, if it holds a single integer + Return None if this NestedInteger holds a nested list + :rtype int + """ + return 0 + + def getList(self): + """ + @return the nested list that this NestedInteger holds, if it holds a nested list + Return None if this NestedInteger holds a single integer + :rtype List[NestedInteger] + """ + return [] + + +class NestedIterator(object): + def __init__(self, nestedList): + """ + Initialize your data structure here. + :type nestedList: List[NestedInteger] + + Linear structure usually use stack as structure. + Iterator Invariant: + 1. has the value to be returned ready: idx pointing to the integer to be return in the next(). + 2. rember move the parent pointer in hasNext() + + Possible to compile nl and idx into a tuple. + """ + self.stk = [[nestedList, 0]] # stack of iterators + + def next(self): + """ + :rtype: int + """ + nl, idx = self.stk[-1] + nxt = nl[idx].getInteger() + self.stk[-1][1] = idx + 1 # advance the index + return nxt + + def hasNext(self): + """ + Put the pointer movement logic in the hasNext() + :rtype: bool + """ + while self.stk: + nl, idx = self.stk[-1] + if idx < len(nl): + ni = nl[idx] + if ni.isInteger(): + return True + else: + self.stk[-1][1] = idx + 1 # prepare the parent, otherwise dead loop + nxt_nl = ni.getList() + self.stk.append([nxt_nl, 0]) + else: + self.stk.pop() + + return False + + + +class NestedIteratorVerbose(object): + def __init__(self, nestedList): + """ + Initialize your data structure here. + :type nestedList: List[NestedInteger] + + Iterator Invariant: + 1. has the value to be returned ready: idx pointing to the integer to be return in the next(). + 2. move the pointer in hasNext() + + Possible to compile nl and idx into a tuple. + """ + self.nl_stk = [nestedList] + self.idx_stk = [0] + + def next(self): + """ + :rtype: int + """ + if self.hasNext(): + nl = self.nl_stk[-1] + idx = self.idx_stk[-1] + nxt = nl[idx] + self.idx_stk[-1] = idx + 1 + return nxt + + raise StopIteration() + + def hasNext(self): + """ + Put the pointer movement logic in the hasNext() + :rtype: bool + """ + while self.nl_stk: + nl = self.nl_stk[-1] + idx = self.idx_stk[-1] + if idx < len(nl): + ni = nl[idx] + if ni.isInteger(): + return True + else: + self.idx_stk[-1] = idx+1 + nxt_nl = ni.getList() + nxt_idx = 0 + self.nl_stk.append(nxt_nl) + self.idx_stk.append(nxt_idx) + else: + self.nl_stk.pop() + self.idx_stk.pop() + + return False + + +# Your NestedIterator object will be instantiated and called as such: +# i, v = NestedIterator(nestedList), [] +# while i.hasNext(): v.append(i.next()) diff --git a/3418 Maximum Amount of Money Robot Can Earn.py b/3418 Maximum Amount of Money Robot Can Earn.py new file mode 100644 index 0000000..4b5a314 --- /dev/null +++ b/3418 Maximum Amount of Money Robot Can Earn.py @@ -0,0 +1,133 @@ +""" +You are given an m x n grid. A robot starts at the top-left corner of the grid (0, 0) and wants to reach the bottom-right corner (m - 1, n - 1). The robot can move either right or down at any point in time. + +The grid contains a value coins[i][j] in each cell: + +If coins[i][j] >= 0, the robot gains that many coins. +If coins[i][j] < 0, the robot encounters a robber, and the robber steals the absolute value of coins[i][j] coins. +The robot has a special ability to neutralize robbers in at most 2 cells on its path, preventing them from stealing coins in those cells. + +Note: The robot's total coins can be negative. + +Return the maximum profit the robot can gain on the route. + + + +Example 1: + +Input: coins = [[0,1,-1],[1,-2,3],[2,-3,4]] + +Output: 8 + +Explanation: + +An optimal path for maximum coins is: + +Start at (0, 0) with 0 coins (total coins = 0). +Move to (0, 1), gaining 1 coin (total coins = 0 + 1 = 1). +Move to (1, 1), where there's a robber stealing 2 coins. The robot uses one neutralization here, avoiding the robbery (total coins = 1). +Move to (1, 2), gaining 3 coins (total coins = 1 + 3 = 4). +Move to (2, 2), gaining 4 coins (total coins = 4 + 4 = 8). +Example 2: + +Input: coins = [[10,10,10],[10,10,10]] + +Output: 40 + +Explanation: + +An optimal path for maximum coins is: + +Start at (0, 0) with 10 coins (total coins = 10). +Move to (0, 1), gaining 10 coins (total coins = 10 + 10 = 20). +Move to (0, 2), gaining another 10 coins (total coins = 20 + 10 = 30). +Move to (1, 2), gaining the final 10 coins (total coins = 30 + 10 = 40). + + +Constraints: + +m == coins.length +n == coins[i].length +1 <= m, n <= 500 +-1000 <= coins[i][j] <= 1000 +""" +import sys + + +class Solution: + def maximumAmount_error(self, M: List[List[int]]) -> int: + """ + Let F[i][j][k] be the max amount at M[i-1][j-1] with k-1 number of neutralization + + F[i][j][k] = max( + F[i-1][j][k] + M[i-1][j-1], + F[i][j-1][k] + M[i-1][j-1], + F[i-1][j][k-1], + F[i][j-1][k-1], + ) + """ + m = len(M) + n = len(M[0]) + F = [ + [ + [ + 0 + for _ in range(4) # error here + ] + for _ in range(n+1) + ] + for _ in range(m+1) + ] + for i in range(m+1): + for j in range(n+1): + F[i][j][0] = -sys.maxsize-1 + + for i in range(1, m+1): + for j in range(1, n+1): + for k in range(1, 4): + F[i][j][k] = max( + F[i-1][j][k] + M[i-1][j-1], + F[i][j-1][k] + M[i-1][j-1], + F[i-1][j][k-1], + F[i][j-1][k-1], + ) + + return max(F[m][n]) + + def maximumAmount(self, M: List[List[int]]) -> int: + """ + Let F[i][j][k] be the max amount at M[i-1][j-1] with k-1 number of neutralization + + F[i][j][k] = max( + F[i-1][j][k] + M[i-1][j-1], + F[i][j-1][k] + M[i-1][j-1], + F[i-1][j][k-1], + F[i][j-1][k-1], + ) + """ + m = len(M) + n = len(M[0]) + F = [ + [ + [ + -sys.maxsize-1 + for _ in range(4) + ] + for _ in range(n+1) + ] + for _ in range(m+1) + ] + # prepare for M[0][0] + F[0][1][1] = 0 + F[1][0][1] = 0 + + for i in range(1, m+1): + for j in range(1, n+1): + for k in range(1, 4): + F[i][j][k] = max( + F[i-1][j][k] + M[i-1][j-1], + F[i][j-1][k] + M[i-1][j-1], + F[i-1][j][k-1], + F[i][j-1][k-1], + ) + return max(F[m][n]) diff --git a/3419 Minimize the Maximum Edge Weight of Graph.py b/3419 Minimize the Maximum Edge Weight of Graph.py new file mode 100644 index 0000000..ebbc750 --- /dev/null +++ b/3419 Minimize the Maximum Edge Weight of Graph.py @@ -0,0 +1,107 @@ +#!/usr/bin/python3 +""" +You are given two integers, n and threshold, as well as a directed weighted graph of n nodes numbered from 0 to n - 1. The graph is represented by a 2D integer array edges, where edges[i] = [Ai, Bi, Wi] indicates that there is an edge going from node Ai to node Bi with weight Wi. + +You have to remove some edges from this graph (possibly none), so that it satisfies the following conditions: + +Node 0 must be reachable from all other nodes. +The maximum edge weight in the resulting graph is minimized. +Each node has at most threshold outgoing edges. +Return the minimum possible value of the maximum edge weight after removing the necessary edges. If it is impossible for all conditions to be satisfied, return -1. + + + +Example 1: + +Input: n = 5, edges = [[1,0,1],[2,0,2],[3,0,1],[4,3,1],[2,1,1]], threshold = 2 + +Output: 1 + +Explanation: + + + +Remove the edge 2 -> 0. The maximum weight among the remaining edges is 1. + +Example 2: + +Input: n = 5, edges = [[0,1,1],[0,2,2],[0,3,1],[0,4,1],[1,2,1],[1,4,1]], threshold = 1 + +Output: -1 + +Explanation: + +It is impossible to reach node 0 from node 2. + +Example 3: + +Input: n = 5, edges = [[1,2,1],[1,3,3],[1,4,5],[2,3,2],[3,4,2],[4,0,1]], threshold = 1 + +Output: 2 + +Explanation: + + + +Remove the edges 1 -> 3 and 1 -> 4. The maximum weight among the remaining edges is 2. + +Example 4: + +Input: n = 5, edges = [[1,2,1],[1,3,3],[1,4,5],[2,3,2],[4,0,1]], threshold = 1 + +Output: -1 + + + +Constraints: + +2 <= n <= 10^5 +1 <= threshold <= n - 1 +1 <= edges.length <= min(105, n * (n - 1) / 2). +edges[i].length == 3 +0 <= Ai, Bi < n +Ai != Bi +1 <= Wi <= 10^6 +There may be multiple edges between a pair of nodes, but they must have unique weights. +""" +from collections import defaultdict +import sys + +class Solution: + def minMaxWeight(self, n: int, edges: List[List[int]], threshold: int) -> int: + """ + Node 0 must be reachable -> inverse the direction s.t. from 0 we can reach every node + Maximum Edge -> all edge above max edge are removed + Minimize the maxmium edge -> binary serach the maximum edge + """ + G = defaultdict(lambda: defaultdict(lambda: sys.maxsize)) + W = set() + for u, v, w in edges: + G[v][u] = min(w, G[v][u]) # handle duplicated edge + W.add(w) + + W = list(W) + W.sort() + + lo = 0 + hi = len(W) + while lo < hi: + mid = (lo + hi) // 2 + visited = [False for _ in range(n)] + self.dfs(G, 0, W[mid], visited) + if all(visited): # go left + hi = mid + else: # go right + lo = mid + 1 + + ret = hi # last found + if ret < len(W): + return W[ret] + else: + return -1 + + def dfs(self, G, o, w, visited): + visited[o] = True + for nbr in G[o].keys(): + if G[o][nbr] <= w and not visited[nbr]: + self.dfs(G, nbr, w, visited) diff --git a/342 Power of Four.py b/342 Power of Four.py new file mode 100644 index 0000000..02eeea9 --- /dev/null +++ b/342 Power of Four.py @@ -0,0 +1,48 @@ +""" +Given an integer (signed 32 bits), write a function to check whether it is a power of 4. + +Example: +Given num = 16, return true. Given num = 5, return false. + +Follow up: Could you solve it without loops/recursion? +""" + + +__author__ = 'Daniel' + + +class Solution(object): + def isPowerOfFour(self, num): + """ + Modular calculation + 4^a mod 3 + = (1)^a mod 3 + = 1 + :param num: + :return: + """ + if num < 1: + return False + if num & num -1 != 0: + return False + + return num % 3 == 1 + + def isPowerOfFourNaive(self, num): + """ + Naive Determine number of 0 bits to be even + :type num: int + :rtype: bool + """ + if num < 1: + return False + if num & num-1 != 0: + return False + + while True: + if num == 0: + return False + elif num == 1: + return True + + num >>= 2 \ No newline at end of file diff --git a/3424 Minimum Cost to Make Arrays Identical.py b/3424 Minimum Cost to Make Arrays Identical.py new file mode 100644 index 0000000..744cfa2 --- /dev/null +++ b/3424 Minimum Cost to Make Arrays Identical.py @@ -0,0 +1,66 @@ +""" +You are given two integer arrays arr and brr of length n, and an integer k. You can perform the following operations on arr any number of times: + +Split arr into any number of contiguous +subarrays + and rearrange these subarrays in any order. This operation has a fixed cost of k. +Choose any element in arr and add or subtract a positive integer x to it. The cost of this operation is x. + +Return the minimum total cost to make arr equal to brr. + + + +Example 1: + +Input: arr = [-7,9,5], brr = [7,-2,-5], k = 2 + +Output: 13 + +Explanation: + +Split arr into two contiguous subarrays: [-7] and [9, 5] and rearrange them as [9, 5, -7], with a cost of 2. +Subtract 2 from element arr[0]. The array becomes [7, 5, -7]. The cost of this operation is 2. +Subtract 7 from element arr[1]. The array becomes [7, -2, -7]. The cost of this operation is 7. +Add 2 to element arr[2]. The array becomes [7, -2, -5]. The cost of this operation is 2. +The total cost to make the arrays equal is 2 + 2 + 7 + 2 = 13. + +Example 2: + +Input: arr = [2,1], brr = [2,1], k = 0 + +Output: 0 + +Explanation: + +Since the arrays are already equal, no operations are needed, and the total cost is 0. + + + +Constraints: + +1 <= arr.length == brr.length <= 10^5 +0 <= k <= 2 * 10^10 +-10^5 <= arr[i] <= 10^5 +-10^5 <= brr[i] <= 10^5 +""" +class Solution: + def minCost(self, arr: List[int], brr: List[int], k: int) -> int: + """ + greedy sort all + x = |a - b| + minimize the sum of |a-b| of two numbers + """ + mini = self.match_cost(arr, brr) + + arr.sort() + brr.sort() + mini = min(mini, k + self.match_cost(arr, brr)) + + return mini + + def match_cost(self, A, B): + ret = 0 + for a, b in zip(A, B): + ret += abs(a - b) + + return ret \ No newline at end of file diff --git a/3428 Maximum and Minimum Sums of at Most Size K Subsequences.py b/3428 Maximum and Minimum Sums of at Most Size K Subsequences.py new file mode 100644 index 0000000..f020b97 --- /dev/null +++ b/3428 Maximum and Minimum Sums of at Most Size K Subsequences.py @@ -0,0 +1,97 @@ +""" +You are given an integer array nums and a positive integer k. Return the sum of the maximum and minimum elements of all +subsequences of nums with at most k elements. + +Since the answer may be very large, return it modulo 10^9 + 7. + +Example 1: + +Input: nums = [1,2,3], k = 2 + +Output: 24 + +Explanation: + +The subsequences of nums with at most 2 elements are: + +Subsequence Minimum Maximum Sum +[1] 1 1 2 +[2] 2 2 4 +[3] 3 3 6 +[1, 2] 1 2 3 +[1, 3] 1 3 4 +[2, 3] 2 3 5 +Final Total 24 +The output would be 24. + +Example 2: + +Input: nums = [5,0,6], k = 1 + +Output: 22 + +Explanation: + +For subsequences with exactly 1 element, the minimum and maximum values are the element itself. Therefore, the total is 5 + 5 + 0 + 0 + 6 + 6 = 22. + +Example 3: + +Input: nums = [1,1,1], k = 2 + +Output: 12 + +Explanation: + +The subsequences [1, 1] and [1] each appear 3 times. For all of them, the minimum and maximum are both 1. Thus, the total is 12. + + + +Constraints: + +1 <= nums.length <= 10^5 +0 <= nums[i] <= 10^9 +1 <= k <= min(70, nums.length) +""" +MOD = int(1e9 + 7) + +class Solution: + def minMaxSums(self, A: List[int], K: int) -> int: + """ + sort + calcualte how many subsequence between i, j with i and j selected. n \choose r + Select i, j is O(N^2) + + Contribution based, when select A[i]: + * A[i] is the min + * A[i] is the max + """ + A.sort() + + N = len(A) + nCr = [ + [0 for _ in range(K)] + for _ in range(N+1) + ] + # nCr[0][x] must be 0 where x > 0 + + nCr[0][0] = 1 + for n in range(1, N+1): + nCr[n][0] = 1 + for r in range(1, K): + nCr[n][r] = nCr[n-1][r-1] + nCr[n-1][r] + + ret = 0 + for i in range(N): + # choose A[i] + sequences = 0 + for r in range(K): # choose up to k-1 items + if r <= i: + sequences += nCr[i][r] + else: + break + + ret += A[i] * sequences # A[i] is the max + ret += A[~i] * sequences # A[~i] is the min + ret %= MOD + + return ret \ No newline at end of file diff --git a/343 Integer Break.py b/343 Integer Break.py new file mode 100644 index 0000000..d8339f9 --- /dev/null +++ b/343 Integer Break.py @@ -0,0 +1,37 @@ +""" +Given a positive integer n, break it into the sum of at least two positive integers and maximize the product of those +integers. Return the maximum product you can get. + +For example, given n = 2, return 1 (2 = 1 + 1); given n = 10, return 36 (10 = 3 + 3 + 4). + +Note: You may assume that n is not less than 2 and not larger than 58. +""" +__author__ = 'Daniel' + + +class Solution(object): + def integerBreak(self, n): + """ + First visualize the breakdown process into a search tree. The search tree dynamic programming + Dynamic programming + Let F[i] be the max product of summation breakdown integers of number i + For each operands of the plus sign, there are choices of break it or not; thus we have for cases + F[i] = max( + F[j] * F[i-j], + j * F[i-j], + F[j] * (i-j), + j * (i-j), + for j in [1, i) + ) if break down i + :type n: int + :rtype: int + """ + F = [None for _ in xrange(n+1)] + F[1] = 1 + for i in xrange(2, n+1): + F[i] = max( + max(F[j] * F[i-j], j * F[i-j], F[j] * (i-j), j * (i-j)) + for j in xrange(1, i/2) + ) + + return F[n] diff --git a/3433 Count Mentions Per User.py b/3433 Count Mentions Per User.py new file mode 100644 index 0000000..7ecebe2 --- /dev/null +++ b/3433 Count Mentions Per User.py @@ -0,0 +1,130 @@ +""" +You are given an integer numberOfUsers representing the total number of users and an array events of size n x 3. + +Each events[i] can be either of the following two types: + +Message Event: ["MESSAGE", "timestampi", "mentions_stringi"] +This event indicates that a set of users was mentioned in a message at timestampi. +The mentions_stringi string can contain one of the following tokens: +id: where is an integer in range [0,numberOfUsers - 1]. There can be multiple ids separated by a single whitespace and may contain duplicates. This can mention even the offline users. +ALL: mentions all users. +HERE: mentions all online users. +Offline Event: ["OFFLINE", "timestampi", "idi"] +This event indicates that the user idi had become offline at timestampi for 60 time units. The user will automatically be online again at time timestampi + 60. +Return an array mentions where mentions[i] represents the number of mentions the user with id i has across all MESSAGE events. + +All users are initially online, and if a user goes offline or comes back online, their status change is processed before handling any message event that occurs at the same timestamp. + +Note that a user can be mentioned multiple times in a single message event, and each mention should be counted separately. + + + +Example 1: + +Input: numberOfUsers = 2, events = [["MESSAGE","10","id1 id0"],["OFFLINE","11","0"],["MESSAGE","71","HERE"]] + +Output: [2,2] + +Explanation: + +Initially, all users are online. + +At timestamp 10, id1 and id0 are mentioned. mentions = [1,1] + +At timestamp 11, id0 goes offline. + +At timestamp 71, id0 comes back online and "HERE" is mentioned. mentions = [2,2] + +Example 2: + +Input: numberOfUsers = 2, events = [["MESSAGE","10","id1 id0"],["OFFLINE","11","0"],["MESSAGE","12","ALL"]] + +Output: [2,2] + +Explanation: + +Initially, all users are online. + +At timestamp 10, id1 and id0 are mentioned. mentions = [1,1] + +At timestamp 11, id0 goes offline. + +At timestamp 12, "ALL" is mentioned. This includes offline users, so both id0 and id1 are mentioned. mentions = [2,2] + +Example 3: + +Input: numberOfUsers = 2, events = [["OFFLINE","10","0"],["MESSAGE","12","HERE"]] + +Output: [0,1] + +Explanation: + +Initially, all users are online. + +At timestamp 10, id0 goes offline. + +At timestamp 12, "HERE" is mentioned. Because id0 is still offline, they will not be mentioned. mentions = [0,1] + + + +Constraints: + +1 <= numberOfUsers <= 100 +1 <= events.length <= 100 +events[i].length == 3 +events[i][0] will be one of MESSAGE or OFFLINE. +1 <= int(events[i][1]) <= 10^5 +The number of id mentions in any "MESSAGE" event is between 1 and 100. +0 <= <= numberOfUsers - 1 +It is guaranteed that the user id referenced in the OFFLINE event is online at the time the event occurs. +""" +import heapq +from collections import defaultdict + + +class Solution: + def countMentions(self, numberOfUsers: int, events: List[List[str]]) -> List[int]: + """ + Counting without offline is easy + How to maintain offline timestamp -> event-driven algo + * Maitain a aet of users that is offline + * Use heap to maintain a set of users to be online O(n lg n) + + Debugging: + * events may be out of order -> sort + * a user can offline and online multiple times -> counter + """ + n = numberOfUsers + mentions = [0 for _ in range(n)] + offline = defaultdict(int) # set() + h = [] # heap, a set of users to be online + + events.sort(key=lambda e: (int(e[1]), 0 if e[0] == "OFFLINE" else 1)) + + for event, ts_str, content in events: + ts = int(ts_str) + if event == "MESSAGE": + if content.startswith("id"): + for s in content.split(" "): + idx = int(s[2:]) + mentions[idx] += 1 + elif content == "ALL": + for i in range(n): + mentions[i] += 1 + elif content == "HERE": + while h and h[0][0] <= ts: # heap peak + _, idx = heapq.heappop(h) + offline[idx] -= 1 + if offline[idx] == 0: + del offline[idx] + + for i in range(n): + if i not in offline: + mentions[i] += 1 + + elif event == "OFFLINE": + idx = int(content) + offline[idx] += 1 + heapq.heappush(h, (ts + 60, idx)) + + return mentions \ No newline at end of file diff --git a/3434 Maximum Frequency After Subarray Operation.py b/3434 Maximum Frequency After Subarray Operation.py new file mode 100644 index 0000000..d677dae --- /dev/null +++ b/3434 Maximum Frequency After Subarray Operation.py @@ -0,0 +1,116 @@ +""" +You are given an array nums of length n. You are also given an integer k. + +You perform the following operation on nums once: + +Select a +subarray + nums[i..j] where 0 <= i <= j <= n - 1. +Select an integer x and add x to all the elements in nums[i..j]. +Find the maximum frequency of the value k after the operation. + + + +Example 1: + +Input: nums = [1,2,3,4,5,6], k = 1 + +Output: 2 + +Explanation: + +After adding -5 to nums[2..5], 1 has a frequency of 2 in [1, 2, -2, -1, 0, 1]. + +Example 2: + +Input: nums = [10,2,3,4,5,5,4,3,2,2], k = 10 + +Output: 4 + +Explanation: + +After adding 8 to nums[1..9], 10 has a frequency of 4 in [10, 10, 11, 12, 13, 13, 12, 11, 10, 10]. + + + +Constraints: + +1 <= n == nums.length <= 10^5 +1 <= nums[i] <= 50 +1 <= k <= 50 +""" +class Solution: + def maxFrequency_TLE(self, nums: List[int], k: int) -> int: + """ + Brute foce: + * i, j subarray search, the max frequency of equal distance to k + * O(N^3) + + k is in [1, 50] + Does k actually matter? It matters for the rest of the array without operations + Define O[i]: In nums[:i], the frequency of number = k + Define F[i][j]: In nums[:i], the frequency of number = j+1 + O(N^2) + """ + n = len(nums) + O = [0 for _ in range(n+1)] + for i in range(n): + O[i+1] = O[i] + if nums[i] == k: + O[i+1] += 1 + + F = [ + [0 for _ in range(50)] + for _ in range(n+1) + ] + for i in range(n): + F[i+1] = list(F[i]) # copy + F[i+1][nums[i] - 1] += 1 + + maxa = 0 + for i in range(n): + for j in range(i+1, n+1): + # subarray nums[i:j] + cnt = 0 + cnt += O[i] + cnt += O[n] - O[j] + + m = 0 + for num in range(50): + m = max(m, F[j][num] - F[i][num]) + + maxa = max(maxa, cnt + m) + + return maxa + + def maxFrequency(self, nums: List[int], k: int) -> int: + """ + Maximum subarray frequency -> Maximum subarray sum + """ + n = len(nums) + freq_k = 0 + for n in nums: + if n == k: + freq_k += 1 + + maxa = 0 + for target in range(1, 51): + maxa = max(maxa, self.count(nums, target, k) + freq_k) + + return maxa + + def count(self, nums, target, k): + cnt = 0 + maxa = 0 + for n in nums: + if n == k: + cnt -= 1 + elif n == target: + cnt += 1 + + if cnt < 0: + cnt = 0 + + maxa = max(maxa, cnt) + + return maxa \ No newline at end of file diff --git a/344 Reverse String.py b/344 Reverse String.py new file mode 100644 index 0000000..ab234f1 --- /dev/null +++ b/344 Reverse String.py @@ -0,0 +1,13 @@ +""" +Write a function that takes a string as input and returns the string reversed. +""" +__author__ = 'Daniel' + + +class Solution(object): + def reverseString(self, s): + """ + :type s: str + :rtype: str + """ + return s[::-1] \ No newline at end of file diff --git a/3446 Sort Matrix by Diagonals.py b/3446 Sort Matrix by Diagonals.py new file mode 100644 index 0000000..b75a8f3 --- /dev/null +++ b/3446 Sort Matrix by Diagonals.py @@ -0,0 +1,97 @@ +""" +You are given an n x n square matrix of integers grid. Return the matrix such that: + +The diagonals in the bottom-left triangle (including the middle diagonal) are sorted in non-increasing order. +The diagonals in the top-right triangle are sorted in non-decreasing order. + + +Example 1: + +Input: grid = [[1,7,3],[9,8,2],[4,5,6]] + +Output: [[8,2,3],[9,6,7],[4,5,1]] + +Explanation: + + + +The diagonals with a black arrow (bottom-left triangle) should be sorted in non-increasing order: + +[1, 8, 6] becomes [8, 6, 1]. +[9, 5] and [4] remain unchanged. +The diagonals with a blue arrow (top-right triangle) should be sorted in non-decreasing order: + +[7, 2] becomes [2, 7]. +[3] remains unchanged. +Example 2: + +Input: grid = [[0,1],[1,2]] + +Output: [[2,1],[1,0]] + +Explanation: + + + +The diagonals with a black arrow must be non-increasing, so [0, 2] is changed to [2, 0]. The other diagonals are already in the correct order. + +Example 3: + +Input: grid = [[1]] + +Output: [[1]] + +Explanation: + +Diagonals with exactly one element are already in order, so no changes are needed. + + + +Constraints: + +grid.length == grid[i].length == n +1 <= n <= 10 +-105 <= grid[i][j] <= 10^5 +""" +class Solution: + def sortMatrix(self, grid: List[List[int]]) -> List[List[int]]: + """ + use a tempary list + """ + m = len(grid) + n = len(grid[0]) + for i in range(m): + r = i + c = 0 + lst = [] + while r < m and c < n: + lst.append(grid[r][c]) + r += 1 + c += 1 + + lst.sort(reverse=True) + r = i + c = 0 + while r < m and c < n: + grid[r][c] = lst[c] + r += 1 + c += 1 + + for j in range(1, n): + r = 0 + c = j + lst = [] + while r < m and c < n: + lst.append(grid[r][c]) + r += 1 + c += 1 + + lst.sort() + r = 0 + c = j + while r < m and c < n: + grid[r][c] = lst[r] + r += 1 + c += 1 + + return grid \ No newline at end of file diff --git a/345 Reverse Vowels of a String.py b/345 Reverse Vowels of a String.py new file mode 100644 index 0000000..aeb55fc --- /dev/null +++ b/345 Reverse Vowels of a String.py @@ -0,0 +1,25 @@ +""" +Write a function that takes a string as input and reverse only the vowels of a string. +""" +__author__ = 'Daniel' + + +class Solution(object): + def reverseVowels(self, s): + """ + :type s: str + :rtype: str + """ + vowels = set(['a', 'e', 'i', 'o', 'u', 'A', 'E', 'I', 'O', 'U']) + s = list(s) + j = len(s) - 1 + i = 0 + while i < j: + if s[i] in vowels: + while s[j] not in vowels: j -= 1 + s[i], s[j] = s[j], s[i] + j -= 1 + + i += 1 + + return "".join(s) \ No newline at end of file diff --git a/3453 Separate Squares I.py b/3453 Separate Squares I.py new file mode 100644 index 0000000..21883fb --- /dev/null +++ b/3453 Separate Squares I.py @@ -0,0 +1,110 @@ +""" +You are given a 2D integer array squares. Each squares[i] = [xi, yi, li] represents the coordinates of the bottom-left point and the side length of a square parallel to the x-axis. + +Find the minimum y-coordinate value of a horizontal line such that the total area of the squares above the line equals the total area of the squares below the line. + +Answers within 10^-5 of the actual answer will be accepted. + +Note: Squares may overlap. Overlapping areas should be counted multiple times. + + + +Example 1: + +Input: squares = [[0,0,1],[2,2,1]] + +Output: 1.00000 + +Explanation: + + + +Any horizontal line between y = 1 and y = 2 will have 1 square unit above it and 1 square unit below it. The lowest option is 1. + +Example 2: + +Input: squares = [[0,0,2],[1,1,1]] + +Output: 1.16667 + +Explanation: + + + +The areas are: + +Below the line: 7/6 * 2 (Red) + 1/6 (Blue) = 15/6 = 2.5. +Above the line: 5/6 * 2 (Red) + 5/6 (Blue) = 15/6 = 2.5. +Since the areas above and below the line are equal, the output is 7/6 = 1.16667. + + + +Constraints: + +1 <= squares.length <= 5 * 10^4 +squares[i] = [xi, yi, li] +squares[i].length == 3 +0 <= xi, yi <= 10^9 +1 <= li <= 10^9 +""" +class Solution: + def separateSquares_brute(self, squares: List[List[int]]) -> float: + """ + brute force: + * bindary search for the real number space + * partition the the squares O(N) + * calcualte the areas + """ + lo = 0 + hi = 2e9 # 1e9 + 1e9 + eps = 1e-5 + while lo < hi - eps: + mid = (lo + hi) / 2 + above = 0 + below = 0 + for x, y, l in squares: + if y + l< mid: + below += l*l + elif y > mid: + above += l*l + else: + # mid between y, y+l + below += l * (mid - y) + above += l * (y+l - mid) + if below < above: + lo = mid + else: + hi = mid + + return lo + + def separateSquares(self, squares: List[List[int]]) -> float: + """ + Event driven. Line Sweep. + F(y) = AreaBelow(y) + dF/dy = slope, the rate of change of F(y) + F(y) is monotonically increasing + """ + events = [] + total_area = 0 + for x, y, l in squares: + # (y-coordiate, delta_slope) + events.append((y, l)) + events.append((y+l, -l)) + total_area += l*l + + events.sort() + target = total_area / 2 + + F = 0 + slope = 0 + prev_y = events[0][0] + for y, d_slope in events: + F += (y - prev_y) * slope + if F >= target: + return y - (F - target) / slope + + slope += d_slope + prev_y = y + + return prev_y diff --git a/3457 Eat Pizzas.py b/3457 Eat Pizzas.py new file mode 100644 index 0000000..4070045 --- /dev/null +++ b/3457 Eat Pizzas.py @@ -0,0 +1,98 @@ +""" +You are given an integer array pizzas of size n, where pizzas[i] represents the weight of the ith pizza. Every day, you eat exactly 4 pizzas. Due to your incredible metabolism, when you eat pizzas of weights W, X, Y, and Z, where W <= X <= Y <= Z, you gain the weight of only 1 pizza! + +On odd-numbered days (1-indexed), you gain a weight of Z. +On even-numbered days, you gain a weight of Y. +Find the maximum total weight you can gain by eating all pizzas optimally. + +Note: It is guaranteed that n is a multiple of 4, and each pizza can be eaten only once. + + + +Example 1: + +Input: pizzas = [1,2,3,4,5,6,7,8] + +Output: 14 + +Explanation: + +On day 1, you eat pizzas at indices [1, 2, 4, 7] = [2, 3, 5, 8]. You gain a weight of 8. +On day 2, you eat pizzas at indices [0, 3, 5, 6] = [1, 4, 6, 7]. You gain a weight of 6. +The total weight gained after eating all the pizzas is 8 + 6 = 14. + +Example 2: + +Input: pizzas = [2,1,1,1,1,1,1,1] + +Output: 3 + +Explanation: + +On day 1, you eat pizzas at indices [4, 5, 6, 0] = [1, 1, 1, 2]. You gain a weight of 2. +On day 2, you eat pizzas at indices [1, 2, 3, 7] = [1, 1, 1, 1]. You gain a weight of 1. +The total weight gained after eating all the pizzas is 2 + 1 = 3. + + + +Constraints: + +4 <= n == pizzas.length <= 2 * 10^5 +1 <= pizzas[i] <= 10^5 +n is a multiple of 4. +""" +class Solution: + def maxWeight_error(self, pizzas: List[int]) -> int: + """ + break into 4 subarray + sort each subarray + + On odd-numbered days, it is optimal to pair the smallest three and the largest one. + On even-numbered days, it is optimal to pair the smallest two and the largest two. + """ + ret = 0 + pizzas.sort() + i = 0 + j = len(pizzas) - 1 + is_odd = True + while i < j: + if is_odd: + ret += pizzas[j] + i += 3 + j -= 1 + else: + ret += pizzas[j-1] + i += 2 + j -= 2 + is_odd ^= True # XOR + + return ret + + + def maxWeight(self, pizzas: List[int]) -> int: + """ + break into 4 subarray + sort each subarray + + On odd-numbered days, it is optimal to pair the smallest three and the largest one. + On even-numbered days, it is optimal to pair the smallest two and the largest two. + + Greedily select pizzas for all odd-numbered days first. + """ + ret = 0 + pizzas.sort() + j = len(pizzas) - 1 + + days = len(pizzas) // 4 + odd_days = days // 2 + days % 2 + even_days = days - odd_days + + for _ in range(odd_days): + ret += pizzas[j] + j -= 1 + for _ in range(even_days): + ret += pizzas[j-1] + j -= 2 + + return ret + \ No newline at end of file diff --git a/346 Moving Average from Data Stream.py b/346 Moving Average from Data Stream.py new file mode 100644 index 0000000..6407d79 --- /dev/null +++ b/346 Moving Average from Data Stream.py @@ -0,0 +1,34 @@ +""" +Premium Question +""" +from collections import deque + +__author__ = 'Daniel' + + +class MovingAverage(object): + def __init__(self, size): + """ + Initialize your data structure here. + :type size: int + """ + self.size = size + self.q = deque() + self.sum = 0 + + def next(self, val): + """ + :type val: int + :rtype: float + """ + self.q.append(val) + self.sum += val + if len(self.q) > self.size: + self.sum -= self.q.popleft() + + return float(self.sum) / len(self.q) + + +# Your MovingAverage object will be instantiated and called as such: +# obj = MovingAverage(size) +# param_1 = obj.next(val) \ No newline at end of file diff --git a/347. Top K Frequent Elements.py b/347. Top K Frequent Elements.py new file mode 100644 index 0000000..b8d15ba --- /dev/null +++ b/347. Top K Frequent Elements.py @@ -0,0 +1,52 @@ +""" +Given a non-empty array of integers, return the k most frequent elements. + +For example, +Given [1,1,1,2,2,3] and k = 2, return [1,2]. + +Note: +You may assume k is always valid, 1 <= k <= number of unique elements. +Your algorithm's time complexity must be better than O(n log n), where n is the array's size. +""" +from collections import defaultdict +import heapq + +__author__ = 'Daniel' + + +class Counter(object): + def __init__(self, val, cnt): + self.val = val + self.cnt = cnt + + def __cmp__(self, other): + return self.cnt - other.cnt + + +class Solution(object): + def topKFrequent(self, nums, K): + """ + Count and Maintain a heap with size k -> O(n lg k) + Since python heapq does not support cmp, need to wrap data in a struct + Need to use min heap instead of max heap, since we need to pop the minimal one + :type nums: List[int] + :type K: int + :rtype: List[int] + """ + cnt = defaultdict(int) + for e in nums: + cnt[e] += 1 + + lst = [] + for k, v in cnt.items(): + lst.append(Counter(k, v)) + + ret = [] + for elt in lst: + if len(ret) < K: + heapq.heappush(ret, elt) + else: + heapq.heappushpop(ret, elt) + + return map(lambda x: x.val, ret) + diff --git a/348 Design Tic-Tac-Toe.py b/348 Design Tic-Tac-Toe.py new file mode 100644 index 0000000..bd1241b --- /dev/null +++ b/348 Design Tic-Tac-Toe.py @@ -0,0 +1,102 @@ +""" +Design a Tic-tac-toe game that is played between two players on a n x n grid. + +You may assume the following rules: + +A move is guaranteed to be valid and is placed on an empty block. +Once a winning condition is reached, no more moves is allowed. +A player who succeeds in placing n of their marks in a horizontal, vertical, or +diagonal row wins the game. +Example: +Given n = 3, assume that player 1 is "X" and player 2 is "O" in the board. + +TicTacToe toe = new TicTacToe(3); + +toe.move(0, 0, 1); -> Returns 0 (no one wins) +|X| | | +| | | | // Player 1 makes a move at (0, 0). +| | | | + +toe.move(0, 2, 2); -> Returns 0 (no one wins) +|X| |O| +| | | | // Player 2 makes a move at (0, 2). +| | | | + +toe.move(2, 2, 1); -> Returns 0 (no one wins) +|X| |O| +| | | | // Player 1 makes a move at (2, 2). +| | |X| + +toe.move(1, 1, 2); -> Returns 0 (no one wins) +|X| |O| +| |O| | // Player 2 makes a move at (1, 1). +| | |X| + +toe.move(2, 0, 1); -> Returns 0 (no one wins) +|X| |O| +| |O| | // Player 1 makes a move at (2, 0). +|X| |X| + +toe.move(1, 0, 2); -> Returns 0 (no one wins) +|X| |O| +|O|O| | // Player 2 makes a move at (1, 0). +|X| |X| + +toe.move(2, 1, 1); -> Returns 1 (player 1 wins) +|X| |O| +|O|O| | // Player 1 makes a move at (2, 1). +|X|X|X| +Follow up: +Could you do better than O(n2) per move() operation? +""" +__author__ = 'Daniel' + + +class TicTacToe(object): + def __init__(self, n): + """ + Initialize your data structure here. + :type n: int + """ + self.n = n + self.rows_count = [0 for _ in xrange(n)] + self.cols_count = [0 for _ in xrange(n)] + self.diag_count = 0 + self.diag_inv_count = 0 + + def move(self, row, col, player): + """ + Since guarantee the move is valid, only store row, col, diagonal. + 1: -1 + 2: +1 + Player {player} makes a move at ({row}, {col}). + @param row The row of the board. + @param col The column of the board. + @param player The player, can be either 1 or 2. + @return The current winning condition, can be either: + 0: No one wins. + 1: Player 1 wins. + 2: Player 2 wins. + :type row: int + :type col: int + :type player: int + :rtype: int + """ + delta = -1 if player == 1 else 1 + self.cols_count[col] += delta + self.rows_count[row] += delta + if col == row: + self.diag_count += delta + if col + row == self.n - 1: + self.diag_inv_count += delta + + # since winning condition is taking up the entire row or col, the row or col must be consecutive + is_win = lambda count: delta * count == self.n + if any(map(is_win, [self.rows_count[row], self.cols_count[col], self.diag_count, self.diag_inv_count])): + return player + + return 0 + +# Your TicTacToe object will be instantiated and called as such: +# obj = TicTacToe(n) +# param_1 = obj.move(row,col,player) diff --git a/349 Intersection of Two Arrays.py b/349 Intersection of Two Arrays.py new file mode 100644 index 0000000..d6ab03a --- /dev/null +++ b/349 Intersection of Two Arrays.py @@ -0,0 +1,23 @@ +""" +Given two arrays, write a function to compute their intersection. + +Example: +Given nums1 = [1, 2, 2, 1], nums2 = [2, 2], return [2]. + +Note: +Each element in the result must be unique. +The result can be in any order. +""" + +__author__ = 'Daniel' + + +class Solution(object): + def intersection(self, nums1, nums2): + """ + O(n+m) + :type nums1: List[int] + :type nums2: List[int] + :rtype: List[int] + """ + return list(set(nums1).intersection(set(nums2))) \ No newline at end of file diff --git a/350 Intersection of Two Arrays II.py b/350 Intersection of Two Arrays II.py new file mode 100644 index 0000000..ac9d779 --- /dev/null +++ b/350 Intersection of Two Arrays II.py @@ -0,0 +1,44 @@ +""" +Given two arrays, write a function to compute their intersection. + +Example: +Given nums1 = [1, 2, 2, 1], nums2 = [2, 2], return [2, 2]. + +Note: +Each element in the result should appear as many times as it shows in both arrays. +The result can be in any order. +Follow up: +What if the given array is already sorted? How would you optimize your algorithm? +What if nums1's size is small compared to nums2's size? Which algorithm is better? +What if elements of nums2 are stored on disk, and the memory is limited such that you cannot load all elements into the +memory at once? +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def intersect(self, nums1, nums2): + """ + Hash table + Time O(m+n) + Memory O(m+n) + :type nums1: List[int] + :type nums2: List[int] + :rtype: List[int] + """ + h1, h2 = defaultdict(int), defaultdict(int) + for a in nums1: + h1[a] += 1 + for b in nums2: + h2[b] += 1 + + ret = [] + for k, v in h1.items(): + cnt = min(v, h2[k]) + ret.extend([k]*cnt) + + return ret + + diff --git a/351 Android Unlock Patterns py3.py b/351 Android Unlock Patterns py3.py new file mode 100644 index 0000000..15dbc11 --- /dev/null +++ b/351 Android Unlock Patterns py3.py @@ -0,0 +1,38 @@ +#!/usr/bin/python3 +""" +Given an Android 3x3 key lock screen and two integers m and n, where 1 ≤ m ≤ n +≤ 9, count the total number of unlock patterns of the Android lock screen, which +consist of minimum of m keys and maximum n keys. + +Rules for a valid pattern: + +Each pattern must connect at least m keys and at most n keys. +All the keys must be distinct. +If the line connecting two consecutive keys in the pattern passes through any +other keys, the other keys must have previously selected in the pattern. No +jumps through non selected key is allowed. +The order of keys used matters. + + + + + +Explanation: + +| 1 | 2 | 3 | +| 4 | 5 | 6 | +| 7 | 8 | 9 | +Invalid move: 4 - 1 - 3 - 6 +Line 1 - 3 passes through key 2 which had not been selected in the pattern. + +Invalid move: 4 - 1 - 9 - 2 +Line 1 - 9 passes through key 5 which had not been selected in the pattern. + +Valid move: 2 - 4 - 1 - 3 - 6 +Line 1 - 3 is valid because it passes through key 2, which had been selected in +the pattern + +Valid move: 6 - 5 - 4 - 1 - 9 - 2 +Line 1 - 9 is valid because it passes through key 5, which had been selected in +the pattern. +""" diff --git a/351 Android Unlock Patterns.py b/351 Android Unlock Patterns.py new file mode 100644 index 0000000..aabc256 --- /dev/null +++ b/351 Android Unlock Patterns.py @@ -0,0 +1,66 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + """ + Skip matrix + Encode rule for 2, 4, 6, 8, 5 + """ + self.skip = [[None for _ in xrange(10)] for _ in xrange(10)] + self.skip[1][3], self.skip[3][1] = 2, 2 + self.skip[1][7], self.skip[7][1] = 4, 4 + self.skip[3][9], self.skip[9][3] = 6, 6 + self.skip[7][9], self.skip[9][7] = 8, 8 + self.skip[4][6], self.skip[6][4] = 5, 5 + self.skip[2][8], self.skip[8][2] = 5, 5 + self.skip[1][9], self.skip[9][1] = 5, 5 + self.skip[3][7], self.skip[7][3] = 5, 5 + + def numberOfPatterns(self, m, n): + """ + NP - O(N!) + dfs + + Maintain a skip matrix + :type m: int + :type n: int + :rtype: int + """ + visited = [False for _ in xrange(10)] + return sum( + self.dfs(1, visited, remain) * 4 + + self.dfs(2, visited, remain) * 4 + + self.dfs(5, visited, remain) + for remain in xrange(m, n+1) + ) + + def dfs(self, cur, visited, remain): + """ + Return the count of combination + Optimization - memoization + """ + if remain == 1: + return 1 + + visited[cur] = True + ret = 0 + for nxt in xrange(1, 10): + if ( + not visited[nxt] and ( + self.skip[cur][nxt] is None or + visited[self.skip[cur][nxt]] + ) + ): + ret += self.dfs(nxt, visited, remain - 1) + + visited[cur] = False + return ret + + +if __name__ == "__main__": + assert Solution().numberOfPatterns(1, 2) == 65 + assert Solution().numberOfPatterns(1, 3) == 385 diff --git a/352 Data Stream as Disjoint Intervals.py b/352 Data Stream as Disjoint Intervals.py new file mode 100644 index 0000000..cd13c41 --- /dev/null +++ b/352 Data Stream as Disjoint Intervals.py @@ -0,0 +1,62 @@ +""" +Given a data stream input of non-negative integers a1, a2, ..., an, ..., summarize the numbers seen so far as a list of +disjoint intervals. + +For example, suppose the integers from the data stream are 1, 3, 7, 2, 6, ..., then the summary will be: + +[1, 1] +[1, 1], [3, 3] +[1, 1], [3, 3], [7, 7] +[1, 3], [7, 7] +[1, 3], [6, 7] +Follow up: +What if there are lots of merges and the number of disjoint intervals are small compared to the data stream's size? +""" +__author__ = 'Daniel' + + +# Definition for an interval. +class Interval(object): + def __init__(self, s=0, e=0): + self.start = s + self.end = e + + +class SummaryRanges(object): + def __init__(self): + """ + BST is the most efficient, while heap is simple to write + Initialize your data structure here. + """ + self.itvls = [] + + def addNum(self, val): + """ + O(lg n) + :type val: int + :rtype: void + """ + self.itvls.append(Interval(val, val)) + + def getIntervals(self): + """ + O(n lg n) + :rtype: List[Interval] + """ + self.itvls.sort(key=lambda x: x.start) + + ret = [self.itvls[0]] + for itvl in self.itvls[1:]: + pre = ret[-1] + if itvl.start <= pre.end + 1: + pre.end = max(itvl.end, pre.end) + else: + ret.append(itvl) + + self.itvls = ret + return ret + +# Your SummaryRanges object will be instantiated and called as such: +# obj = SummaryRanges() +# obj.addNum(val) +# param_2 = obj.getIntervals() \ No newline at end of file diff --git a/353 Design Snake Game.py b/353 Design Snake Game.py new file mode 100644 index 0000000..eb03cfd --- /dev/null +++ b/353 Design Snake Game.py @@ -0,0 +1,67 @@ +""" +Design a Snake game that is played on a device with screen size = width x height. +""" +from collections import deque + +__author__ = 'Daniel' + + +class SnakeGame(object): + def __init__(self, width, height, food): + """ + Initialize your data structure here. + @param width - screen width + @param height - screen height + @param food - A list of food positions + E.g food = [[1,1], [1,0]] means the first food is positioned at [1,1], the second is at [1,0]. + :type width: int + :type height: int + :type food: List[List[int]] + """ + self.w = width + self.h = height + self.food = deque(food) + self.body = deque([(0, 0)]) + self.dirs = { + 'U': (-1, 0), + 'L': (0, -1), + 'R': (0, 1), + 'D': (1, 0), + } + self.eat = 0 + + def move(self, direction): + """ + Moves the snake. + @param direction - 'U' = Up, 'L' = Left, 'R' = Right, 'D' = Down + @return The game's score after the move. Return -1 if game over. + Game over when snake crosses the screen boundary or bites its body. + :type direction: str + :rtype: int + """ + x, y = self.body[0] + dx, dy = self.dirs[direction] + x += dx + y += dy + fx, fy = self.food[0] if self.food else (-1, -1) + if x == fx and y == fy: + self.food.popleft() + self.eat += 1 + else: + self.body.pop() + if (x, y) in self.body or not (0 <= x < self.h and 0 <= y < self.w): + # possible to use set to accelerate check + return -1 + + self.body.appendleft((x, y)) + return self.eat + + +# Your SnakeGame object will be instantiated and called as such: +# obj = SnakeGame(width, height, food) +# param_1 = obj.move(direction) + +if __name__ == "__main__": + game = SnakeGame(3, 2, [[1, 2], [0, 1]]) + for char, expect in zip('RDRULU', [0, 0, 1, 1, 2, -1]): + assert game.move(char) == expect diff --git a/354 Russian Doll Envelopes.py b/354 Russian Doll Envelopes.py new file mode 100644 index 0000000..66e3321 --- /dev/null +++ b/354 Russian Doll Envelopes.py @@ -0,0 +1,64 @@ +""" +You have a number of envelopes with widths and heights given as a pair of integers (w, h). One envelope can fit into +another if and only if both the width and height of one envelope is greater than the width and height of the other +envelope. + +What is the maximum number of envelopes can you Russian doll? (put one inside other) + +Example: +Given envelopes = [[5,4],[6,4],[6,7],[2,3]], the maximum number of envelopes you can Russian doll is 3 ([2,3] => [5,4] +=> [6,7]). +""" +import bisect + +__author__ = 'Daniel' + + +class Solution(object): + def maxEnvelopes(self, A): + """ + LIS + binary search + + sort by width first ascending, then sort by height descending (otherwise [3, 3] put in [3, 4]). + :type A: List[List[int]] + :rtype: int + """ + if not A: return 0 + + A.sort(key=lambda (w, h): (w, -h)) + F = [-1 for _ in xrange(len(A)+1)] + + F[1] = A[0][1] # store value rather than index + k = 1 + for _, h in A[1:]: + idx = bisect.bisect_left(F, h, 1, k+1) + F[idx] = h + k += 1 if idx == k+1 else 0 + + return k + + def maxEnvelopesTLE(self, A): + """ + LIS + O(n^2) + :type A: List[List[int]] + :rtype: int + """ + if not A: return 0 + + predicate = lambda a, b: b[0] > a[0] and b[1] > a[1] + A.sort() + n = len(A) + F = [1 for _ in xrange(n)] + for i in xrange(1, n): + for j in xrange(i): + if predicate(A[j], A[i]): + F[i] = max(F[i], 1 + F[j]) + + return max(F) + + +if __name__ == "__main__": + assert Solution().maxEnvelopes([[5, 4], [6, 4], [6, 7], [2, 3]]) == 3 + assert Solution().maxEnvelopes([[2,100],[3,200],[4,300],[5,500],[5,400],[5,250],[6,370],[6,360],[7,380]]) == 5 diff --git a/355 Design Twitter.py b/355 Design Twitter.py new file mode 100644 index 0000000..56bab26 --- /dev/null +++ b/355 Design Twitter.py @@ -0,0 +1,137 @@ +""" +Design a simplified version of Twitter where users can post tweets, follow/unfollow another user and is able to see the +10 most recent tweets in the user's news feed. Your design should support the following methods: + +postTweet(userId, tweetId): Compose a new tweet. +getNewsFeed(userId): Retrieve the 10 most recent tweet ids in the user's news feed. Each item in the news feed must be +posted by users who the user followed or by the user herself. Tweets must be ordered from most recent to least recent. +follow(followerId, followeeId): Follower follows a followee. +unfollow(followerId, followeeId): Follower unfollows a followee. +Example: + +Twitter twitter = new Twitter(); + +// User 1 posts a new tweet (id = 5). +twitter.postTweet(1, 5); + +// User 1's news feed should return a list with 1 tweet id -> [5]. +twitter.getNewsFeed(1); + +// User 1 follows user 2. +twitter.follow(1, 2); + +// User 2 posts a new tweet (id = 6). +twitter.postTweet(2, 6); + +// User 1's news feed should return a list with 2 tweet ids -> [6, 5]. +// Tweet id 6 should precede tweet id 5 because it is posted after tweet id 5. +twitter.getNewsFeed(1); + +// User 1 unfollows user 2. +twitter.unfollow(1, 2); + +// User 1's news feed should return a list with 1 tweet id -> [5], +// since user 1 is no longer following user 2. +twitter.getNewsFeed(1); +""" +from collections import defaultdict +import heapq + +__author__ = 'Daniel' + + +SZ = 10 + + +class Tweet(object): + central_clk = 0 + + def __init__(self, id, nxt=None): + self.timestamp = Tweet.central_clk + self.id = id + self.next = nxt # LinkedList + Tweet.central_clk += 1 + + def __cmp__(self, other): + return - (self.timestamp - other.timestamp) + + +class Twitter(object): + """ + need assumption about the frequency of calls of each method + + most efficient heap of list + """ + def __init__(self): + """ + Initialize your data structure here. + """ + self.tweets = defaultdict(lambda: None) + self.followees = defaultdict(set) + + def postTweet(self, userId, tweetId): + """ + Compose a new tweet. + :type userId: int + :type tweetId: int + :rtype: void + """ + nxt = self.tweets[userId] # previous post + self.tweets[userId] = Tweet(tweetId, nxt) + + def getNewsFeed(self, userId): + """ + Retrieve the 10 most recent tweet ids in the user's news feed. Each item in the news feed must be posted by + users who the user followed or by the user herself. Tweets must be ordered from most recent to least recent. + :type userId: int + :rtype: List[int] + """ + h = [] + if userId not in self.followees[userId] and self.tweets[userId]: + # possible following oneself + heapq.heappush(h, self.tweets[userId]) + + for followee in self.followees[userId]: + if self.tweets[followee]: + heapq.heappush(h, self.tweets[followee]) + + ret = [] + while h and len(ret) < SZ: + tweet = heapq.heappop(h) + ret.append(tweet.id) + if tweet.next: + heapq.heappush(h, tweet.next) + + return ret + + def follow(self, followerId, followeeId): + """ + Follower follows a followee. If the operation is invalid, it should be a no-op. + :type followerId: int + :type followeeId: int + :rtype: void + """ + self.followees[followerId].add(followeeId) + + def unfollow(self, followerId, followeeId): + """ + Follower unfollows a followee. If the operation is invalid, it should be a no-op. + :type followerId: int + :type followeeId: int + :rtype: void + """ + self.followees[followerId].discard(followeeId) # no KeyError compared to .remove() + + +# Your Twitter object will be instantiated and called as such: +# obj = Twitter() +# obj.postTweet(userId,tweetId) +# param_2 = obj.getNewsFeed(userId) +# obj.follow(followerId,followeeId) +# obj.unfollow(followerId,followeeId) + + +if __name__ == "__main__": + twitter = Twitter() + twitter.postTweet(1, 5) + twitter.unfollow(1, 1) diff --git a/356 Line Reflection.py b/356 Line Reflection.py new file mode 100644 index 0000000..f4b953b --- /dev/null +++ b/356 Line Reflection.py @@ -0,0 +1,51 @@ +""" +Premium Question +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.x = None + + def isReflected(self, points): + """ + :type points: List[List[int]] + :rtype: bool + """ + d = defaultdict(list) + for x, y in points: + d[y].append(x) + + for v in d.values(): + if not self.check(v): + return False + + return True + + def check(self, lst): + lst.sort() + i = 0 + j = len(lst) - 1 + while i < j: + x = (lst[i] + lst[j]) / float(2) + if not self.x: + self.x = x + elif self.x != x: + return False + + i += 1 + j -= 1 + + if i == j: + if not self.x: + self.x = lst[i] + elif self.x != lst[i]: + return False + + return True + +if __name__ == "__main__": + assert Solution().isReflected([[1,1],[-1,-1]]) == False diff --git a/357 Count Numbers with Unique Digits.py b/357 Count Numbers with Unique Digits.py new file mode 100644 index 0000000..d80476a --- /dev/null +++ b/357 Count Numbers with Unique Digits.py @@ -0,0 +1,29 @@ +""" +Given a non-negative integer n, count all numbers with unique digits, x, where 0 <= x < 10^n. + +Example: +Given n = 2, return 91. (The answer should be the total numbers in the range of 0 <= x < 100, excluding +[11,22,33,44,55,66,77,88,99]) +""" +__author__ = 'Daniel' + + +class Solution(object): + def countNumbersWithUniqueDigits(self, n): + """ + Let F(i) be the number of numbers with unique digits of length i + F(1) = 1 // special case + F(i) = (10-1) * 9 * 8 * (10-i+1) // general case, 998 + (10-1) since the leading digit cannot be zero + + return sum F(i) + :type n: int + :rtype: int + """ + ret = 1 + Fi = 1 + for i in xrange(n): + Fi *= (10-i) if i != 0 else 9 + ret += Fi + + return ret diff --git a/358 Rearrange String k Distance Apart.py b/358 Rearrange String k Distance Apart.py new file mode 100644 index 0000000..8df63c2 --- /dev/null +++ b/358 Rearrange String k Distance Apart.py @@ -0,0 +1,87 @@ +""" +Given a non-empty string str and an integer k, rearrange the string such that the same characters are at least distance +k from each other. + +All input strings are given in lowercase letters. If it is not possible to rearrange the string, return an empty string +"". + +Example 1: +str = "aabbcc", k = 3 + +Result: "abcabc" + +The same letters are at least distance 3 from each other. +Example 2: +str = "aaabc", k = 3 + +Answer: "" + +It is not possible to rearrange the string. +Example 3: +str = "aaadbbcc", k = 2 + +Answer: "abacabcd" + +Another possible answer is: "abcabcda" + +The same letters are at least distance 2 from each other. + +""" +from collections import defaultdict +import heapq + +__author__ = 'Daniel' + + +class Val(object): + def __init__(self, cnt, val): + self.cnt = cnt + self.val = val + + def __cmp__(self, other): + if self.cnt == other.cnt: + return cmp(self.val, other.val) + + return -cmp(self.cnt, other.cnt) + + +class Solution(object): + def rearrangeString(self, s, k): + """ + Greedy, largest first, fill k first + O(lg(26) n) + :type s: str + :type k: int + :rtype: str + """ + if not s or k == 0: return s + + d = defaultdict(int) + for c in s: + d[c] += 1 + + h = [] + for char, cnt in d.items(): + heapq.heappush(h, Val(cnt, char)) + + ret = [] + while h: + cur = [] + for _ in xrange(k): + if not h: + return "".join(ret) if len(ret) == len(s) else "" + + e = heapq.heappop(h) + ret.append(e.val) + e.cnt -= 1 + if e.cnt > 0: + cur.append(e) + + for e in cur: + heapq.heappush(h, e) + + return "".join(ret) + + +if __name__ == "__main__": + assert Solution().rearrangeString("aabbccdd", 4) == "abcdabcd" diff --git a/359 Logger Rate Limiter.py b/359 Logger Rate Limiter.py new file mode 100644 index 0000000..e612ea7 --- /dev/null +++ b/359 Logger Rate Limiter.py @@ -0,0 +1,33 @@ +""" +Premium question +""" +__author__ = 'Daniel' + + +class Logger(object): + def __init__(self): + """ + Initialize your data structure here. + """ + self.h = {} + + + def shouldPrintMessage(self, timestamp, message): + """ + Returns true if the message should be printed in the given timestamp, otherwise returns false. + If this method returns false, the message will not be printed. + The timestamp is in seconds granularity. + :type timestamp: int + :type message: str + :rtype: bool + """ + if message not in self.h or timestamp - self.h[message] >= 10: + self.h[message] = timestamp + return True + + return False + + +# Your Logger object will be instantiated and called as such: +# obj = Logger() +# param_1 = obj.shouldPrintMessage(timestamp,message) \ No newline at end of file diff --git a/360 Sort Transformed Array.py b/360 Sort Transformed Array.py new file mode 100644 index 0000000..3bd9564 --- /dev/null +++ b/360 Sort Transformed Array.py @@ -0,0 +1,56 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + +import bisect + + +class Solution(object): + def sortTransformedArray(self, nums, a, b, c): + """ + Key points: + Quadratic function + + Pitfalls: + 1. case when a = 0 + 2. whether need to reverse the string + :type nums: List[int] + :type a: int + :type b: int + :type c: int + :rtype: List[int] + """ + if a == 0: + ret = map(lambda x: self.f(x, a, b, c), nums) + return ret if b > 0 else ret[::-1] + + mid = - float(b) / (2*a) + ri = bisect.bisect_left(nums, mid) + le = ri - 1 + ret = [] + while le >= 0 and ri < len(nums) and le < ri: + f_le = self.f(nums[le], a, b, c) + f_ri = self.f(nums[ri], a, b, c) + if a > 0 and f_le < f_ri or a < 0 and f_le > f_ri: + ret.append(f_le) + le -= 1 + else: + ret.append(f_ri) + ri += 1 + + while le >= 0: + ret.append(self.f(nums[le], a, b, c)) + le -= 1 + while ri < len(nums): + ret.append(self.f(nums[ri], a, b, c)) + ri += 1 + + return ret if a > 0 else ret[::-1] + + def f(self, x, a, b, c): + return a * (x ** 2) + b * x + c + + +if __name__ == "__main__": + assert Solution().sortTransformedArray([-4, -2, 2, 4], -1, 3, 5) == [-23, -5, 1, 7] \ No newline at end of file diff --git a/361 Bomb Enemy.py b/361 Bomb Enemy.py new file mode 100644 index 0000000..38ba321 --- /dev/null +++ b/361 Bomb Enemy.py @@ -0,0 +1,61 @@ +""" +Given a 2D grid, each cell is either a wall 'W', an enemy 'E' or empty '0' (the number zero), return the maximum enemies +you can kill using one bomb. +The bomb kills all the enemies in the same row and column from the planted point until it hits the wall since the wall +is too strong to be destroyed. +Note that you can only put the bomb at an empty cell. + +Example: +For the given grid + +0 E 0 0 +E 0 W E +0 E 0 0 + +return 3. (Placing a bomb at (1,1) kills 3 enemies) +""" +__author__ = 'Daniel' + + +class Solution(object): + def maxKilledEnemies(self, grid): + """ + Brute force: O(n * n^2) + Place the bomb around boundary + The result of boundary bomb can be reused - dp + + The time complexity is O(m + n) + :type grid: List[List[str]] + :rtype: int + """ + if not grid: return 0 + + m, n = len(grid), len(grid[0]) + rows = [0 for _ in xrange(m)] + cols = [0 for _ in xrange(n)] + gmax = 0 + for i in xrange(m): + for j in xrange(n): + if i == 0 or grid[i-1][j] == 'W': + cols[j] = 0 + for k in xrange(i, m): + if grid[k][j] == 'E': + cols[j] += 1 + elif grid[k][j] == 'W': + break + + if j == 0 or grid[i][j-1] == 'W': + rows[i] = 0 + for k in xrange(j, n): + if grid[i][k] == 'E': + rows[i] += 1 + elif grid[i][k] == 'W': + break + + if grid[i][j] == '0': + gmax = max(gmax, rows[i] + cols[j]) + + return gmax + +if __name__ == "__main__": + assert Solution().maxKilledEnemies(["0E00", "E0WE", "0E00"]) == 3 \ No newline at end of file diff --git a/362 Design Hit Counter.py b/362 Design Hit Counter.py new file mode 100644 index 0000000..f70eb7f --- /dev/null +++ b/362 Design Hit Counter.py @@ -0,0 +1,48 @@ +""" +Premium Question +""" +from collections import deque + +__author__ = 'Daniel' + + +class HitCounter(object): + def __init__(self): + """ + Initialize your data structure here. + + calls are being made to the system in chronological order. + It is possible that several hits arrive roughly at the same time. + What if the number of hits per second could be very large? Does your design scale? # use counter + """ + self.q = deque() + + def hit(self, timestamp): + """ + Record a hit. + @param timestamp - The current timestamp (in seconds granularity). + :type timestamp: int + :rtype: void + """ + self.pop(timestamp) + self.q.append(timestamp) + + def getHits(self, timestamp): + """ + Return the number of hits in the past 5 minutes. + @param timestamp - The current timestamp (in seconds granularity). + :type timestamp: int + :rtype: int + """ + self.pop(timestamp) + return len(self.q) + + def pop(self, timestamp): + while self.q and timestamp - self.q[0] >= 300: + self.q.popleft() + + +# Your HitCounter object will be instantiated and called as such: +# obj = HitCounter() +# obj.hit(timestamp) +# param_2 = obj.getHits(timestamp) \ No newline at end of file diff --git a/364 Nested List Weight Sum II.py b/364 Nested List Weight Sum II.py new file mode 100644 index 0000000..15236ad --- /dev/null +++ b/364 Nested List Weight Sum II.py @@ -0,0 +1,114 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +""" +This is the interface that allows for creating nested lists. +You should not implement it, or speculate about its implementation +""" + + +class NestedInteger(object): + def __init__(self, value=None): + """ + If value is not specified, initializes an empty list. + Otherwise initializes a single integer equal to value. + """ + + def isInteger(self): + """ + @return True if this NestedInteger holds a single integer, rather than a nested list. + :rtype bool + """ + + def add(self, elem): + """ + Set this NestedInteger to hold a nested list and adds a nested integer elem to it. + :rtype void + """ + + def setInteger(self, value): + """ + Set this NestedInteger to hold a single integer equal to value. + :rtype void + """ + + def getInteger(self): + """ + @return the single integer that this NestedInteger holds, if it holds a single integer + Return None if this NestedInteger holds a nested list + :rtype int + """ + + def getList(self): + """ + @return the nested list that this NestedInteger holds, if it holds a nested list + Return None if this NestedInteger holds a single integer + :rtype List[NestedInteger] + """ + + +class Solution(object): + def __init__(self): + self.sum = 0 + + def depthSumInverse(self, nestedList): + """ + NestedInteger is a union type + :type nestedList: List[NestedInteger] + :rtype: int + """ + inv_depth = self.height(nestedList) + self.inverseDepthSum(nestedList, inv_depth) + return self.sum + + def height(self, nl): + nl_lst = filter(lambda x: not x.isInteger(), nl) + if not nl_lst: + return 1 + if nl_lst: + return 1 + max( + map(lambda x: self.height(x.getList()), nl_lst) + ) + + def inverseDepthSum(self, nl, inv_depth): + nl_lst = filter(lambda x: not x.isInteger(), nl) + ni_list = filter(lambda x: x.isInteger(), nl) + if nl_lst: + map(lambda x: self.inverseDepthSum(x.getList(), inv_depth - 1), nl_lst) + if ni_list: + self.sum += sum(map(lambda x: x.getInteger() * inv_depth, ni_list)) + + +class SolutionError(object): + def __init__(self): + self.sum = 0 + + def depthSumInverse(self, nestedList): + """ + NestedInteger is a union type + :type nestedList: List[NestedInteger] + :rtype: int + """ + self.dfs(nestedList) + return self.sum + + def dfs(self, nl): + """ + This dfs use height: the number of edges from to the leaves. + But the question is supposedly use height but the calculate sum top down; here is bottom up wrongly. + """ + height = 1 + + nl_lst = filter(lambda x: not x.isInteger(), nl) + ni_list = filter(lambda x: x.isInteger(), nl) + if nl_lst: + height = 1 + max( + map(lambda x: self.dfs(x.getList()), nl_lst) + ) + if ni_list: + self.sum += sum(map(lambda x: x.getInteger() * height, ni_list)) + + return height diff --git a/365 Water and Jug Problem.py b/365 Water and Jug Problem.py new file mode 100644 index 0000000..fff3387 --- /dev/null +++ b/365 Water and Jug Problem.py @@ -0,0 +1,46 @@ +""" +You are given two jugs with capacities x and y litres. There is an infinite amount of water supply available. You need +to determine whether it is possible to measure exactly z litres using these two jugs. + +If z liters of water is measurable, you must have z liters of water contained within one or both buckets by the end. + +Operations allowed: + +Fill any of the jugs completely with water. +Empty any of the jugs. +Pour water from one jug into another till the other jug is completely full or the first jug itself is empty. +Example 1: (From the famous "Die Hard" example) + +Input: x = 3, y = 5, z = 4 +Output: True +Example 2: + +Input: x = 2, y = 6, z = 5 +Output: False +""" +__author__ = 'Daniel' + + +class Solution(object): + def canMeasureWater(self, x, y, z): + """ + Number theory + Use the property of Bezout's identity and check if z is a multiple of GCD(x, y) + https://discuss.leetcode.com/topic/49238/math-solution-java-solution + + ax + by = d + :type x: int + :type y: int + :type z: int + :rtype: bool + """ + if x + y < z: return False + if x == z or y == z: return True + + return z % self.gcd(x, y) == 0 + + def gcd(self, a, b): + while b: + a, b = b, a%b + return a + diff --git a/366 Find Leaves of Binary Tree.py b/366 Find Leaves of Binary Tree.py new file mode 100644 index 0000000..df22de9 --- /dev/null +++ b/366 Find Leaves of Binary Tree.py @@ -0,0 +1,42 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +# Definition for a binary tree node. +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution(object): + def findLeaves(self, root): + """ + The key is + 1. to find height of a tree + 2. to maintain a leaves nested list + + The height of a node is the number of edges from the node to the deepest leaf. + :type root: TreeNode + :rtype: List[List[int]] + """ + leaves = [] + self.dfs(root, leaves) + return leaves + + def dfs(self, node, leaves): + """ + :return: height of of a node + """ + if not node: + return -1 # leaves index start from 0 + + height = 1 + max(self.dfs(node.left, leaves), self.dfs(node.right, leaves)) + if height >= len(leaves): + leaves.append([]) # grow + + leaves[height].append(node.val) + return height diff --git a/367 Valid Perfect Square.py b/367 Valid Perfect Square.py new file mode 100644 index 0000000..ae71a6a --- /dev/null +++ b/367 Valid Perfect Square.py @@ -0,0 +1,38 @@ +""" +Given a positive integer num, write a function which returns True if num is a perfect square else False. + +Note: Do not use any built-in library function such as sqrt. + +Example 1: + +Input: 16 +Returns: True +Example 2: + +Input: 14 +Returns: False +""" +__author__ = 'Daniel' + + +class Solution(object): + def isPerfectSquare(self, num): + """ + Debugging binary search + :type num: int + :rtype: bool + """ + if num == 1: return True + lo = 1 + hi = num/2 + 1 + while lo < hi: + mid = (lo + hi) / 2 + midsq = mid**2 + if midsq == num: + return True + elif midsq < num: + lo = mid + 1 + else: + hi = mid + + return False diff --git a/368 Largest Divisible Subset.py b/368 Largest Divisible Subset.py new file mode 100644 index 0000000..6a8f0e4 --- /dev/null +++ b/368 Largest Divisible Subset.py @@ -0,0 +1,65 @@ +""" +Given a set of distinct positive integers, find the largest subset such that every pair (Si, Sj) of elements in this +subset satisfies: Si % Sj = 0 or Sj % Si = 0. + +If there are multiple solutions, return any subset is fine. + +Example 1: + +nums: [1,2,3] + +Result: [1,2] (of course, [1,3] will also be ok) +Example 2: + +nums: [1,2,4,8] + +Result: [1,2,4,8] +""" +from collections import deque + +__author__ = 'Daniel' + + +class Solution(object): + def largestDivisibleSubset(self, A): + """ + Given a divisible subset, when adding a new number, we only needs to validate whether the new number is + divisible by the largest number in the divisible subset. + + Let F[i] for the size of subset ended with A[i] + F[i] = max(1 + F[j] if A[i] % A[j] == 0 for j in xrange(i-1)) + pi[i] = argmax(...) + :type A: List[int] + :rtype: List[int] + """ + if not A: return [] + + F = {} + pi = {} + A.sort() + for i in xrange(len(A)): + F[i] = 1 + pi[i] = i + for j in xrange(i): + if A[i] % A[j] == 0: + if F[i] < 1 + F[j]: + F[i] = 1 + F[j] + pi[i] = j + + max_i, max_v = 0, 1 + for k, v in F.items(): + if v > max_v: + max_i, max_v = k, v + + ret = deque() + cur = max_i + ret.appendleft(A[cur]) + while pi[cur] != cur: + cur = pi[cur] + ret.appendleft(A[cur]) + + return list(ret) + + +if __name__ == "__main__": + assert Solution().largestDivisibleSubset([1, 2, 4, 8]) == [1, 2, 4, 8] diff --git a/369 Plus One Linked List.py b/369 Plus One Linked List.py new file mode 100644 index 0000000..9a54755 --- /dev/null +++ b/369 Plus One Linked List.py @@ -0,0 +1,57 @@ +""" +Premium question +""" +__author__ = 'Daniel' + + +# Definition for singly-linked list. +class ListNode(object): + def __init__(self, x): + self.val = x + self.next = None + + +class Solution(object): + def plusOne(self, head): + """ + reverse, plus one, then reverse + :type head: ListNode + :rtype: ListNode + """ + head = self.revserse(head) + head = self.plus(head) + head = self.revserse(head) + return head + + def plus(self, head): + cur = head + while cur: + cur.val += 1 + if cur.val >= 10: + cur.val -= 10 + if not cur.next: + cur.next = ListNode(0) + cur = cur.next + else: + break + + return head + + def revserse(self, head): + if not head: + return None + + dummy = ListNode(0) + dummy.next = head + pre = dummy + cur = pre.next + while pre and cur: + nxt = cur.next + + cur.next = pre + + pre = cur + cur = nxt + + dummy.next.next = None # original head + return pre diff --git a/370 Range Addition.py b/370 Range Addition.py new file mode 100644 index 0000000..f867c52 --- /dev/null +++ b/370 Range Addition.py @@ -0,0 +1,37 @@ +""" +Premium question +""" +__author__ = 'Daniel' + + +class Solution(object): + def getModifiedArray(self, length, updates): + """ + Brute force: O(kn) + + Algorithm: Complement + [i, j] increases by delta is equivalent to [i, n) increase delta and [j+1, n) decreases by delta; thus we only + need to update two positions O(1) rather than update the entire range [i, j] in O(n) + + ...++++.... + ...++++++++ + .......---- + + Complexity: O(k + n) + + :type length: int + :type updates: List[List[int]] + :rtype: List[int] + """ + deltas = [0 for _ in xrange(length)] + for i, j, k in updates: + deltas[i] += k + if j + 1 < length: deltas[j + 1] -= k + + ret = [] + acc = 0 + for delta in deltas: + acc += delta + ret.append(acc) + + return ret diff --git a/371 Sum of Two Integers.py b/371 Sum of Two Integers.py new file mode 100644 index 0000000..4fac485 --- /dev/null +++ b/371 Sum of Two Integers.py @@ -0,0 +1,39 @@ +""" +Calculate the sum of two integers a and b, but you are not allowed to use the operator + and -. + +Example: +Given a = 1 and b = 2, return 3. +""" + +__author__ = 'Daniel' + + +class Solution(object): + def getSum(self, a, b): + """ + circuit full-adder + since Python don't restrict to 32bit, we need + 1. Masking + 2. Overflow handling + :type a: int + :type b: int + :rtype: int + """ + MAX = 0x7FFFFFFF + MSK = 0xFFFFFFFF + + carry = (a & b) << 1 + out = a ^ b + + # convert to 32 bit + carry &= MSK + out &= MSK + + if carry != 0: + return self.getSum(out, carry) + else: + # handle overflow + if out < MAX: + return out + else: # negative + return ~(out ^ MSK) \ No newline at end of file diff --git a/372 Super Pow.py b/372 Super Pow.py new file mode 100644 index 0000000..19d6064 --- /dev/null +++ b/372 Super Pow.py @@ -0,0 +1,52 @@ +""" +Your task is to calculate a^b mod 1337 where a is a positive integer and b is an extremely large positive integer given +in the form of an array. + +Example1: + +a = 2 +b = [3] + +Result: 8 +Example2: + +a = 2 +b = [1,0] + +Result: 1024 +""" +__author__ = 'Daniel' + +C = 1337 + + +class Solution(object): + def superPow(self, a, b): + """ + since b is given as a list rather than a number, we need to process it digit by digit. + + a^123 = a^120 * a^3 + = a^12 ^ 10 * a^3 + + Power math. + :type a: int + :type b: List[int] + :rtype: int + """ + if not b: + return 1 + s = 1 + lsd = b.pop() # list significant digit + s *= (a % C) ** lsd + s %= C + rest = self.superPow(a, b) + s *= rest ** 10 + s %= C + return s + +if __name__ == "__main__": + print Solution().superPow(2, [1, 0]) + + + + diff --git a/373 Find K Pairs with Smallest Sums.py b/373 Find K Pairs with Smallest Sums.py new file mode 100644 index 0000000..904b0c2 --- /dev/null +++ b/373 Find K Pairs with Smallest Sums.py @@ -0,0 +1,107 @@ +""" +You are given two integer arrays nums1 and nums2 sorted in ascending order and an integer k. + +Define a pair (u,v) which consists of one element from the first array and one element from the second array. + +Find the k pairs (u1,v1),(u2,v2) ...(uk,vk) with the smallest sums. + +Example 1: +Given nums1 = [1,7,11], nums2 = [2,4,6], k = 3 + +Return: [1,2],[1,4],[1,6] + +The first 3 pairs are returned from the sequence: +[1,2],[1,4],[1,6],[7,2],[7,4],[11,2],[7,6],[11,4],[11,6] +Example 2: +Given nums1 = [1,1,2], nums2 = [1,2,3], k = 2 + +Return: [1,1],[1,1] + +The first 2 pairs are returned from the sequence: +[1,1],[1,1],[1,2],[2,1],[1,2],[2,2],[1,3],[1,3],[2,3] +Example 3: +Given nums1 = [1,2], nums2 = [3], k = 3 + +Return: [1,3],[2,3] + +All possible pairs are returned from the sequence: +[1,3],[2,3] +""" +import heapq + +__author__ = 'Daniel' + + +class Solution(object): + def kSmallestPairs(self, nums1, nums2, k): + """ + Maintain a heap of the k pairs + The art is how to select the next pair. + + O(k log k) + + https://discuss.leetcode.com/topic/50885/simple-java-o-klogk-solution-with-explanation + :type nums1: List[int] + :type nums2: List[int] + :type k: int + :rtype: List[List[int]] + """ + class Node(object): + def __init__(self, i, j): + self.i, self.j = i, j + + def __cmp__(self, other): + return nums1[self.i] + nums2[self.j] - (nums1[other.i] + nums2[other.j]) + + def hasnext(self): + return self.j + 1 < len(nums2) + + def next(self): + if self.hasnext(): + return Node(self.i, self.j + 1) + + raise StopIteration + + if not nums1 or not nums2: + return [] + + h = [] + for i in xrange(min(k, len(nums1))): + heapq.heappush(h, Node(i, 0)) + + ret = [] + while h and len(ret) < k: + node = heapq.heappop(h) + ret.append([nums1[node.i], nums2[node.j]]) + if node.hasnext(): + heapq.heappush(h, node.next()) + + return ret + + def kSmallestPairsError(self, nums1, nums2, k): + """ + The merge process for merge sort + :type nums1: List[int] + :type nums2: List[int] + :type k: int + :rtype: List[List[int]] + """ + i = 0 + j = 0 + ret = [] + for _ in xrange(k): + if i < len(nums1) and j < len(nums2): + ret.append([nums1[i], nums2[j]]) + if nums1[i] < nums2[j]: + j += 1 + else: + i += 1 + else: + break + + return ret + + +if __name__ == "__main__": + assert Solution().kSmallestPairs([1, 7, 11], [2, 4, 6], 9) == [[1, 2], [1, 4], [1, 6], [7, 2], [7, 4], [11, 2], + [7, 6], [11, 4], [11, 6]] \ No newline at end of file diff --git a/374 Guess Number Higher or Lower.py b/374 Guess Number Higher or Lower.py new file mode 100644 index 0000000..9d1588b --- /dev/null +++ b/374 Guess Number Higher or Lower.py @@ -0,0 +1,45 @@ +""" +We are playing the Guess Game. The game is as follows: + +I pick a number from 1 to n. You have to guess which number I picked. + +Every time you guess wrong, I'll tell you whether the number is higher or lower. + +You call a pre-defined API guess(int num) which returns 3 possible results (-1, 1, or 0): + +-1 : My number is lower + 1 : My number is higher + 0 : Congrats! You got it! +Example: +n = 10, I pick 6. + +Return 6. +""" +__author__ = 'Daniel' + + +# The guess API is already defined for you. +# @param num, your guess +# @return -1 if my number is lower, 1 if my number is higher, otherwise return 0 + +def guess(num): + return -1 + + +class Solution(object): + def guessNumber(self, n): + """ + Binary search, transform [1, n] into [1, n+1), to make sure the loop is making progress + :type n: int + :rtype: int + """ + lo, hi = 1, n+1 + while True: + mid = (lo + hi) / 2 + g = guess(mid) + if g == 0: + return mid + elif g < 1: + hi = mid + else: + lo = mid + 1 diff --git a/375 Guess Number Higher or Lower II.py b/375 Guess Number Higher or Lower II.py new file mode 100644 index 0000000..d250963 --- /dev/null +++ b/375 Guess Number Higher or Lower II.py @@ -0,0 +1,83 @@ +""" +We are playing the Guess Game. The game is as follows: + +I pick a number from 1 to n. You have to guess which number I picked. + +Every time you guess wrong, I'll tell you whether the number I picked is higher or lower. + +However, when you guess a particular number x, and you guess wrong, you pay $x. You win the game when you guess the +number I picked. + +Example: + +n = 10, I pick 8. + +First round: You guess 5, I tell you that it's higher. You pay $5. +Second round: You guess 7, I tell you that it's higher. You pay $7. +Third round: You guess 9, I tell you that it's lower. You pay $9. + +Game over. 8 is the number I picked. + +You end up paying $5 + $7 + $9 = $21. +Given a particular n >= 1, find out how much money you need to have to guarantee a win. +""" +__author__ = 'Daniel' + + +class Solution(object): + def getMoneyAmount(self, n): + """ + Let F[i][j] be the min cost of guessing [i, j) + F[i][j] = min( + k + max(F[i][k], F[k+1][j]) for k in [i, j) + ) + Draw a matrix to show the population direction + [ ] -> [ ] + ^ + | + [ ] + O(n^3) + + Edge cases: + F[i][i+1] = 0 + :type n: int + :rtype: int + """ + N = n + 1 # guessing [1, N), where N = n + 1 + F = [[0 for _ in xrange(N+1)] for _ in xrange(N+1)] + for i in xrange(n, 0, -1): + for j in xrange(i+2, N+1): + F[i][j] = min( + k + max(F[i][k], F[k+1][j]) + for k in xrange(i, j) + ) + + return F[1][N] + + def getMoneyAmountError(self, n): + """ + Cost for number. Guarantee a win. + Let C[i] be the min requirement of the number of wrong guesses + Let F[i] be the min requirement of money + + C[i] = min(C[k-1] + 1 + C[i-k] for k in [1, i]) + F[i] = min(F[k-1] + k + k*C[i-k] + F[i-k] for k in [1, i]) + O(n^2) + + Still one-directional guess + Error: F[i] does not correspond to C[i] + :type n: int + :rtype: int + """ + C = [0 for _ in xrange(n+1)] + F = [0 for _ in xrange(n+1)] + for i in xrange(2, n+1): + C[i] = min(1 + max(C[k-1], C[i-k]) for k in xrange(1, i+1)) + F[i] = min(k + max(F[k-1], k*C[i-k] + F[i-k]) for k in xrange(1, i+1)) + + return F[n] + + +if __name__ == "__main__": + print Solution().getMoneyAmount(100) + diff --git a/376 Wiggle Subsequence.py b/376 Wiggle Subsequence.py new file mode 100644 index 0000000..6b09f3d --- /dev/null +++ b/376 Wiggle Subsequence.py @@ -0,0 +1,75 @@ +""" +A sequence of numbers is called a wiggle sequence if the differences between successive numbers strictly alternate +between positive and negative. The first difference (if one exists) may be either positive or negative. A sequence with +fewer than two elements is trivially a wiggle sequence. + +For example, [1,7,4,9,2,5] is a wiggle sequence because the differences (6,-3,5,-7,3) are alternately positive and +negative. In contrast, [1,4,7,2,5] and [1,7,4,5,5] are not wiggle sequences, the first because its first two +differences are positive and the second because its last difference is zero. + +Given a sequence of integers, return the length of the longest subsequence that is a wiggle sequence. A subsequence is +obtained by deleting some number of elements (eventually, also zero) from the original sequence, leaving the remaining +elements in their original order. +""" +__author__ = 'Daniel' + + +class Solution(object): + def wiggleMaxLength(self, A): + """ + Let H[i] be max wiggle length for [0, i] with A[i] as high point + Let L[i] be similarly defined but as low point. + + Consider A[i] > A[i-1]: + H[i] = L[i-1] + 1 # wiggle up + L[i] = L[i-1] # + A[i] < A[i-1] case has similar formula + + H[i] = H[i-1] + = L[i-1] + 1 + + L[i] = L[i-1] + = H[i-1] + 1 + + Therefore, max(H[i], L[i]) are monotonously non-decreasing (rather than H[i] or L[i] monotonously + non-decreasing separately. + O(n) + + Additionally, possibly space optimized to O(1) by reusing space + :type A: List[int] + :rtype: int + """ + if not A: return 0 + N = len(A) + H = [1 for _ in xrange(N)] + L = [1 for _ in xrange(N)] + for i in xrange(1, N): + L[i] = H[i-1] + 1 if A[i] < A[i-1] else L[i-1] + H[i] = L[i-1] + 1 if A[i] > A[i-1] else H[i-1] + + return max(H[N-1], L[N-1]) + + def wiggleMaxLengthSuboptimal(self, A): + """ + Let H[i] be wiggle length ends at i, with A[i] as high point + Let L[i] be similarly defined but as low point. + O(n^2) + :type A: List[int] + :rtype: int + """ + if not A: return 0 + + N = len(A) + H = [1 for _ in xrange(N)] + L = [1 for _ in xrange(N)] + gmax = 1 + for i in xrange(1, N): + for j in xrange(i): + if A[i] > A[j]: + H[i] = max(H[i], L[j] + 1) + elif A[i] < A[j]: + L[i] = max(L[i], H[j] + 1) + + gmax = max(gmax, H[i], L[i]) + + return gmax diff --git a/377 Combination Sum IV.py b/377 Combination Sum IV.py new file mode 100644 index 0000000..1d3d20a --- /dev/null +++ b/377 Combination Sum IV.py @@ -0,0 +1,56 @@ +""" +Given an integer array with all positive numbers and no duplicates, find the number of possible combinations that add up +to a positive integer target. + +Example: + +nums = [1, 2, 3] +target = 4 + +The possible combination ways are: +(1, 1, 1, 1) +(1, 1, 2) +(1, 2, 1) +(1, 3) +(2, 1, 1) +(2, 2) +(3, 1) + +Note that different sequences are counted as different combinations. + +Therefore the output is 7. +Follow up: +What if negative numbers are allowed in the given array? +How does it change the problem? +What limitation we need to add to the question to allow negative numbers? +""" +__author__ = 'Daniel' + + +class Solution(object): + def combinationSum4(self, nums, target): + """ + Let F[i] be the number of combinations ways for number i + F[i] = sum(F[i-k] for k in nums) + + If negative number allowed, [1, -1], 1, then infinite combinations. + If the target is large, recursion & memoization is more space saving + :type nums: List[int] + :type target: int + :rtype: int + """ + F = [0 for _ in xrange(target + 1)] + nums = filter(lambda x: x <= target, nums) + for k in nums: + F[k] = 1 + + for i in xrange(target + 1): + for k in nums: + if i - k >= 0: + F[i] += F[i-k] + + return F[target] + + +if __name__ == "__main__": + assert Solution().combinationSum4([1, 2, 3], 4) == 7 diff --git a/378 Kth Smallest Element in a Sorted Matrix.py b/378 Kth Smallest Element in a Sorted Matrix.py new file mode 100644 index 0000000..810402b --- /dev/null +++ b/378 Kth Smallest Element in a Sorted Matrix.py @@ -0,0 +1,83 @@ +""" +Given a n x n matrix where each of the rows and columns are sorted in ascending order, find the kth smallest element in +the matrix. + +Note that it is the kth smallest element in the sorted order, not the kth distinct element. + +Example: + +matrix = [ + [ 1, 5, 9], + [10, 11, 13], + [12, 13, 15] +], +k = 8, + +return 13. +Note: +You may assume k is always valid, 1 <= k <= n2. +""" +import heapq + + +__author__ = 'Daniel' + + +class Solution(object): + def kthSmallest(self, matrix, k): + """ + Heap of list + :type matrix: List[List[int]] + :type k: int + :rtype: int + """ + m, n = len(matrix), len(matrix[0]) + + class Node(object): + def __init__(self, i, j): + self.i = i + self.j = j + + def __cmp__(self, other): + return matrix[self.i][self.j] - matrix[other.i][other.j] + + def hasnext(self): + return self.j+1 < n + + def next(self): + if self.hasnext(): + return Node(self.i, self.j + 1) + + raise StopIteration + + h = [] + for i in xrange(m): + heapq.heappush(h, Node(i, 0)) + + ret = None + for _ in xrange(k): + ret = heapq.heappop(h) + if ret.hasnext(): + heapq.heappush(h, ret.next()) + + return matrix[ret.i][ret.j] + + def kthSmallestError(self, matrix, k): + """ + :type matrix: List[List[int]] + :type k: int + :rtype: int + """ + m, n = len(matrix), len(matrix[0]) + i = k % n + j = k - (i * m) + return matrix[i][j] + +if __name__ == "__main__": + matrix = [ + [1, 5, 9], + [10, 11, 13], + [12, 13, 15] + ] + k = 8 + print Solution().kthSmallest(matrix, k) diff --git a/379 Design Phone Directory.py b/379 Design Phone Directory.py new file mode 100644 index 0000000..e384577 --- /dev/null +++ b/379 Design Phone Directory.py @@ -0,0 +1,64 @@ +""" +Design a Phone Directory which supports the following operations: + +get: Provide a number which is not assigned to anyone. +check: Check if a number is available or not. +release: Recycle or release a number. +""" +__author__ = 'Daniel' + + +class PhoneDirectory(object): + def __init__(self, maxNumbers): + """ + Pool of numbers + Two parts: + 1. set + 2. range pointers to save memory + @param maxNumbers - The maximum numbers that can be stored in the phone directory. + :type maxNumbers: int + """ + self.released = set() + self.l = maxNumbers + self.i = 0 + + def get(self): + """ + Provide a number which is not assigned to anyone. + @return - Return an available number. Return -1 if none is available. + :rtype: int + """ + if self.released: + return self.released.pop() + if self.i < self.l: + ret = self.i + self.i += 1 + return ret + + return -1 + + def check(self, number): + """ + Check if a number is available or not. + :type number: int + :rtype: bool + """ + return number in self.released or self.i <= number < self.l + + def release(self, number): + """ + Recycle or release a number. + :type number: int + :rtype: void + """ + if self.i <= number < self.l: + return + + self.released.add(number) + + +# Your PhoneDirectory object will be instantiated and called as such: +# obj = PhoneDirectory(maxNumbers) +# param_1 = obj.get() +# param_2 = obj.check(number) +# obj.release(number) \ No newline at end of file diff --git a/380 Insert Delete GetRandom O(1).py b/380 Insert Delete GetRandom O(1).py new file mode 100644 index 0000000..d70cdd4 --- /dev/null +++ b/380 Insert Delete GetRandom O(1).py @@ -0,0 +1,132 @@ +""" +Design a data structure that supports all following operations in average O(1) time. + +insert(val): Inserts an item val to the set if not already present. +remove(val): Removes an item val from the set if present. +getRandom: Returns a random element from current set of elements. Each element must have the same probability of +being returned. +Example: + +// Init an empty set. +RandomizedSet randomSet = new RandomizedSet(); + +// Inserts 1 to the set. Returns true as 1 was inserted successfully. +randomSet.insert(1); + +// Returns false as 2 does not exist in the set. +randomSet.remove(2); + +// Inserts 2 to the set, returns true. Set now contains [1,2]. +randomSet.insert(2); + +// getRandom should return either 1 or 2 randomly. +randomSet.getRandom(); + +// Removes 1 from the set, returns true. Set now contains [2]. +randomSet.remove(1); + +// 2 was already in the set, so return false. +randomSet.insert(2); + +// Since 1 is the only number in the set, getRandom always return 1. +randomSet.getRandom(); +""" +import random + +__author__ = 'Daniel' + + +class RandomizedSet(object): + def __init__(self): + """ + 1. Use List of numbers to support O(1) getRandom + 2. need an efficient way to find and delete an element + 3. Use Map to get the location, move to end and pop + Initialize your data structure here. + """ + self.lst = [] + self.pos = {} + + def insert(self, val): + """ + Inserts a value to the set. Returns true if the set did not already contain the specified element. + :type val: int + :rtype: bool + """ + if val in self.pos: + return False + + self.lst.append(val) + self.pos[val] = len(self.lst) - 1 + + return True + + def remove(self, val): + """ + Removes a value from the set. Returns true if the set contained the specified element. + :type val: int + :rtype: bool + """ + if val not in self.pos: + return False + + idx, last = self.pos[val], len(self.lst) - 1 + + if idx != last: + self.lst[idx], self.lst[last] = self.lst[last], self.lst[idx] + self.pos[self.lst[idx]] = idx + + del self.pos[val] + self.lst.pop() + + return True + + def getRandom(self): + """ + Gets a random element from the set. + :rtype: int + """ + return random.choice(self.lst) + + +class RandomizedSetTLE(object): + def __init__(self): + """ + Initialize your data structure here. + """ + self.set = set() + + def insert(self, val): + """ + Inserts a value to the set. Returns true if the set did not already contain the specified element. + :type val: int + :rtype: bool + """ + ret = val not in self.set + self.set.add(val) + return ret + + def remove(self, val): + """ + Removes a value from the set. Returns true if the set contained the specified element. + :type val: int + :rtype: bool + """ + ret = val in self.set + self.set.discard(val) + return ret + + def getRandom(self): + """ + Get a random element from the set. + :rtype: int + """ + return random.sample(self.set, 1)[0] # O(N), equivalent to random.choice(tuple(allLetters)) + + + +# Your RandomizedSet object will be instantiated and called as such: +# obj = RandomizedSet() +# param_1 = obj.insert(val) +# param_2 = obj.remove(val) +# param_3 = obj.getRandom() diff --git a/381 Insert Delete GetRandom O(1) - Duplicates allowed.py b/381 Insert Delete GetRandom O(1) - Duplicates allowed.py new file mode 100644 index 0000000..7f91800 --- /dev/null +++ b/381 Insert Delete GetRandom O(1) - Duplicates allowed.py @@ -0,0 +1,91 @@ +""" +Design a data structure that supports all following operations in average O(1) time. + +Note: Duplicate elements are allowed. +insert(val): Inserts an item val to the collection. +remove(val): Removes an item val from the collection if present. +getRandom: Returns a random element from current collection of elements. The probability of each element being returned +is linearly related to the number of same value the collection contains. +Example: + +// Init an empty collection. +RandomizedCollection collection = new RandomizedCollection(); + +// Inserts 1 to the collection. Returns true as the collection did not contain 1. +collection.insert(1); + +// Inserts another 1 to the collection. Returns false as the collection contained 1. Collection now contains [1,1]. +collection.insert(1); + +// Inserts 2 to the collection, returns true. Collection now contains [1,1,2]. +collection.insert(2); + +// getRandom should return 1 with the probability 2/3, and returns 2 with the probability 1/3. +collection.getRandom(); + +// Removes 1 from the collection, returns true. Collection now contains [1,2]. +collection.remove(1); + +// getRandom should return 1 and 2 both equally likely. +collection.getRandom(); +""" +from collections import defaultdict +import random + +__author__ = 'Daniel' + + +class RandomizedCollection(object): + def __init__(self): + """ + pop set is O(1), deterministic depends on hash value + Initialize your data structure here. + """ + self.lst = [] + self.pos = defaultdict(set) + + def insert(self, val): + """ + Inserts a value to the collection. Returns true if the collection did not already contain the specified element. + :type val: int + :rtype: bool + """ + flag = True if not self.pos[val] else False + + self.lst.append(val) + self.pos[val].add(len(self.lst) - 1) + + return flag + + def remove(self, val): + """ + Removes a value from the collection. Returns true if the collection contained the specified element. + :type val: int + :rtype: bool + """ + if not self.pos[val]: + return False + + idx, last = self.pos[val].pop(), len(self.lst) - 1 + if idx != last: + self.lst[idx], self.lst[last] = self.lst[last], self.lst[idx] + self.pos[self.lst[idx]].remove(last) + self.pos[self.lst[idx]].add(idx) + + self.lst.pop() + + return True + + def getRandom(self): + """ + Get a random element from the collection. + :rtype: int + """ + return random.choice(self.lst) + + +# Your RandomizedCollection object will be instantiated and called as such: +# obj = RandomizedCollection() +# param_1 = obj.insert(val) +# param_2 = obj.remove(val) +# param_3 = obj.getRandom() \ No newline at end of file diff --git a/382 Linked List Random Node.py b/382 Linked List Random Node.py new file mode 100644 index 0000000..f4d7b1d --- /dev/null +++ b/382 Linked List Random Node.py @@ -0,0 +1,61 @@ +""" +Given a singly linked list, return a random node's value from the linked list. Each node must have the same probability +of being chosen. + +Follow up: +What if the linked list is extremely large and its length is unknown to you? Could you solve this efficiently without +using extra space? + +Example: + +// Init a singly linked list [1,2,3]. +ListNode head = new ListNode(1); +head.next = new ListNode(2); +head.next.next = new ListNode(3); +Solution solution = new Solution(head); + +// getRandom() should return either 1, 2, or 3 randomly. Each element should have equal probability of returning. +solution.getRandom(); +""" +import random + +__author__ = 'Daniel' + + +# Definition for singly-linked list. +class ListNode(object): + def __init__(self, x): + self.val = x + self.next = None + + +class Solution(object): + def __init__(self, head): + """ + Reservoir sampling + :param: head The linked list's head. + Note that the head is guaranteed to be not null, so it contains at least one node. + :type head: ListNode + """ + self.head = head + + def getRandom(self): + """ + Returns a random node's value. + :rtype: int + """ + ret = self.head + cur = self.head.next + idx = 1 + while cur: + if random.randrange(0, idx+1) == 0: + ret = cur + cur = cur.next + idx += 1 + + return ret.val + + +# Your Solution object will be instantiated and called as such: +# obj = Solution(head) +# param_1 = obj.getRandom() \ No newline at end of file diff --git a/383 Ransom Note.py b/383 Ransom Note.py new file mode 100644 index 0000000..2af1daa --- /dev/null +++ b/383 Ransom Note.py @@ -0,0 +1,36 @@ +""" +Given an arbitrary ransom note string and another string containing letters from all the magazines, write a function +that will return true if the ransom note can be constructed from the magazines; otherwise, it will return false. + +Each letter in the magazine string can only be used once in your ransom note. + +Note: +You may assume that both strings contain only lowercase letters. + +canConstruct("a", "b") -> false +canConstruct("aa", "ab") -> false +canConstruct("aa", "aab") -> true +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def canConstruct(self, ransomNote, magazine): + """ + :type ransomNote: str + :type magazine: str + :rtype: bool + """ + d = defaultdict(int) + + for e in magazine: + d[e] += 1 + + for e in ransomNote: + if d[e] == 0: + return False + d[e] -= 1 + + return True \ No newline at end of file diff --git a/384 Shuffle an Array.py b/384 Shuffle an Array.py new file mode 100644 index 0000000..f38d5dd --- /dev/null +++ b/384 Shuffle an Array.py @@ -0,0 +1,58 @@ +""" +Shuffle a set of numbers without duplicates. + +Example: + +// Init an array with set 1, 2, and 3. +int[] nums = {1,2,3}; +Solution solution = new Solution(nums); + +// Shuffle the array [1,2,3] and return its result. Any permutation of [1,2,3] must equally likely to be returned. +solution.shuffle(); + +// Resets the array back to its original configuration [1,2,3]. +solution.reset(); + +// Returns the random shuffling of array [1,2,3]. +solution.shuffle(); +""" +import random + +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self, nums): + """ + :type nums: List[int] + :type size: int + """ + self.original = nums + + def reset(self): + """ + Resets the array to its original configuration and return it. + :rtype: List[int] + """ + return list(self.original) + + def shuffle(self): + """ + Returns a random shuffling of the array. + like shuffle the poker cards + in-place shuffling and avoid dynamic resizing the list + :rtype: List[int] + """ + lst = self.reset() + n = len(lst) + for i in xrange(n): + j = random.randrange(i, n) + lst[i], lst[j] = lst[j], lst[i] + + return lst + + +# Your Solution object will be instantiated and called as such: +# obj = Solution(nums) +# param_1 = obj.reset() +# param_2 = obj.shuffle() \ No newline at end of file diff --git a/385 Mini Parser Nested Integer.py b/385 Mini Parser Nested Integer.py new file mode 100644 index 0000000..a7da4df --- /dev/null +++ b/385 Mini Parser Nested Integer.py @@ -0,0 +1,123 @@ +""" +Given a nested list of integers represented as a string, implement a parser to deserialize it. + +Each element is either an integer, or a list -- whose elements may also be integers or other lists. + +Note: You may assume that the string is well-formed: + +String is non-empty. +String does not contain white spaces. +String contains only digits 0-9, [, - ,, ]. +Example 1: + +Given s = "324", + +You should return a NestedInteger object which contains a single integer 324. +Example 2: + +Given s = "[123,[456,[789]]]", + +Return a NestedInteger object containing a nested list with 2 elements: + +1. An integer containing value 123. +2. A nested list containing two elements: + i. An integer containing value 456. + ii. A nested list with one element: + a. An integer containing value 789. +""" +__author__ = 'Daniel' + +# """ +# This is the interface that allows for creating nested lists. +# You should not implement it, or speculate about its implementation +# """ + + +class NestedInteger(object): + def __init__(self, value=None): + """ + If value is not specified, initializes an empty list. + Otherwise initializes a single integer equal to value. + """ + def isInteger(self): + """ + @return True if this NestedInteger holds a single integer, rather than a nested list. + :rtype bool + """ + + def add(self, elem): + """ + Set this NestedInteger to hold a nested list and adds a nested integer elem to it. + :rtype void + """ + + def setInteger(self, value): + """ + Set this NestedInteger to hold a single integer equal to value. + :rtype void + """ + + def getInteger(self): + """ + @return the single integer that this NestedInteger holds, if it holds a single integer + Return None if this NestedInteger holds a nested list + :rtype int + """ + + def getList(self): + """ + @return the nested list that this NestedInteger holds, if it holds a nested list + Return None if this NestedInteger holds a single integer + :rtype List[NestedInteger] + """ + + +class Solution(object): + def deserialize(self, s): + """ + NestedInteger is a UnionType in functional programming jargon. + + [1, [1, [2]], 3, 4] + From a general example, develop an algorithm using stack + The algorithm itself is easy, but the string parsing contains lots of edge cases + :type s: str + :rtype: NestedInteger + """ + if not s: return None + stk = [] + + i = 0 + while i < len(s): + if s[i] == '[': + stk.append(NestedInteger()) + i += 1 + elif s[i] == ']': + ni = stk.pop() + if not stk: return ni + + stk[-1].add(ni) + i += 1 + elif s[i] == ',': + i += 1 + else: + j = i + while j < len(s) and (s[j].isdigit() or s[j] == '-'): j += 1 + + ni = NestedInteger(int(s[i: j]) if s[i: j] else None) + if not stk: return ni + stk[-1].add(ni) + i = j + + return stk.pop() + + +if __name__ == "__main__": + Solution().deserialize("[123,[456,[789]]]") + + + + + + + + diff --git a/386 Lexicographical Numbers.py b/386 Lexicographical Numbers.py new file mode 100644 index 0000000..f9474f7 --- /dev/null +++ b/386 Lexicographical Numbers.py @@ -0,0 +1,52 @@ +""" +Given an integer n, return 1 - n in lexicographical order. + +For example, given 13, return: [1,10,11,12,13,2,3,4,5,6,7,8,9]. + +Please optimize your algorithm to use less time and space. The input size may be as large as 5,000,000. +""" +__author__ = 'Daniel' + + +class Solution(object): + def lexicalOrder(self, n): + """ + :type n: int + :rtype: List[int] + """ + def gen(): + i = 1 + for _ in xrange(n): # erroneous for while i <= n: + yield i + if i * 10 <= n: + i *= 10 # * 10 + elif i % 10 != 9 and i + 1 <= n: + i += 1 # for current digit + else: + while i % 10 == 9 or i + 1 > n: + i /= 10 + i += 1 + + return list(gen()) + + def lexicalOrderError(self, n): + """ + :type n: int + :rtype: List[int] + """ + ret = [] + for i in xrange(1, 10): + sig = 1 + while i * sig <= n: + ret.extend(range( + i * sig, + min((1+i)*sig-1, n)+1), + ) + sig *= 10 + + return ret + + +if __name__ == "__main__": + assert Solution().lexicalOrder(30) == [1, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 2, 20, 21, 22, 23, 24, 25, 26, 27, + 28, 29, 3, 30, 4, 5, 6, 7, 8, 9] diff --git a/387 First Unique Character in a String.py b/387 First Unique Character in a String.py new file mode 100644 index 0000000..35b18ac --- /dev/null +++ b/387 First Unique Character in a String.py @@ -0,0 +1,39 @@ +""" +Given a string, find the first non-repeating character in it and return it's index. If it doesn't exist, return -1. + +Examples: + +s = "leetcode" +return 0. + +s = "loveleetcode", +return 2. +Note: You may assume the string contain only lowercase letters. + + +""" +__author__ = 'Daniel' + + +class Solution(object): + def firstUniqChar(self, s): + """ + :type s: str + :rtype: int + """ + if not s: + return -1 + + first = {} + for i, v in enumerate(list(s)): + if v not in first: + first[v] = i + else: + first[v] = -1 + + lst = filter(lambda x: x != -1, first.values()) + return min(lst) if lst else -1 + + +if __name__ == "__main__": + assert Solution().firstUniqChar("leetcode") == 0 \ No newline at end of file diff --git a/388 Longest Absolute File Path.py b/388 Longest Absolute File Path.py new file mode 100644 index 0000000..5a6f38b --- /dev/null +++ b/388 Longest Absolute File Path.py @@ -0,0 +1,67 @@ +""" +Suppose we abstract our file system by a string in the following manner: + +The string "dir\n\tsubdir1\n\tsubdir2\n\t\tfile.ext" represents: + +dir + subdir1 + subdir2 + file.ext +The directory dir contains an empty sub-directory subdir1 and a sub-directory subdir2 containing a file file.ext. + +The string "dir\n\tsubdir1\n\t\tfile1.ext\n\t\tsubsubdir1\n\tsubdir2\n\t\tsubsubdir2\n\t\t\tfile2.ext" represents: + +dir + subdir1 + file1.ext + subsubdir1 + subdir2 + subsubdir2 + file2.ext +The directory dir contains two sub-directories subdir1 and subdir2. subdir1 contains a file file1.ext and an empty +second-level sub-directory subsubdir1. subdir2 contains a second-level sub-directory subsubdir2 containing a file +file2.ext. + +We are interested in finding the longest (number of characters) absolute path to a file within our file system. For +example, in the second example above, the longest absolute path is "dir/subdir2/subsubdir2/file2.ext", and its length +is 32 (not including the double quotes). + +Given a string representing the file system in the above format, return the length of the longest absolute path to file +in the abstracted file system. If there is no file in the system, return 0. + +Note: +The name of a file contains at least a . and an extension. +The name of a directory or sub-directory will not contain a .. +Time complexity required: O(n) where n is the size of the input string. + +Notice that a/aa/aaa/file1.txt is not the longest file path, if there is another path aaaaaaaaaaaaaaaaaaaaa/sth.png. +""" +__author__ = 'Daniel' + + +class Solution(object): + def lengthLongestPath(self, input): + """ + :type input: str + :rtype: int + """ + input = input.split('\n') + F = [] + gmax = 0 + for elt in input: + idx = elt.count('\t') + idx = min(idx, len(F)) + e = elt.strip('\t') + prev = -1 if idx == 0 else F[idx-1] + if idx == len(F): + F.append(prev + 1 + len(e)) + else: + F[idx] = prev + 1 + len(e) # reset + + if '.' in elt: + gmax = max(gmax, F[idx]) + + return gmax + +if __name__ == "__main__": + assert Solution().lengthLongestPath("dir\n file.txt") == 12 diff --git a/389 Find the Difference.py b/389 Find the Difference.py new file mode 100644 index 0000000..a06cd21 --- /dev/null +++ b/389 Find the Difference.py @@ -0,0 +1,42 @@ +""" +Given two strings s and t which consist of only lowercase letters. + +String t is generated by random shuffling string s and then add one more letter at a random position. + +Find the letter that was added in t. + +Example: + +Input: +s = "abcd" +t = "abcde" + +Output: +e + +Explanation: +'e' is the letter that was added. + +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def findTheDifference(self, s, t): + """ + :type s: str + :type t: str + :rtype: str + """ + d = defaultdict(int) + for e in s: + d[e] += 1 + + for e in t: + if d[e] == 0: + return e + d[e] -= 1 + + return '' \ No newline at end of file diff --git a/390 Elimination Game.py b/390 Elimination Game.py new file mode 100644 index 0000000..6892255 --- /dev/null +++ b/390 Elimination Game.py @@ -0,0 +1,50 @@ +""" +There is a list of sorted integers from 1 to n. Starting from left to right, remove the first number and every other +number afterward until you reach the end of the list. + +Repeat the previous step again, but this time from right to left, remove the right most number and every other number +from the remaining numbers. + +We keep repeating the steps again, alternating left to right and right to left, until a single number remains. + +Find the last number that remains starting with a list of length n. + +Example: + +Input: +n = 9, +1 2 3 4 5 6 7 8 9 +2 4 6 8 +2 6 +6 + +Output: +6 +""" +__author__ = 'Daniel' + + +class Solution(object): + def lastRemaining(self, n): + """ + Brute force O(n): A = A[::2][::-1] + + Simulate the game and find pattern of head/first element: O(lg n) + :type n: int + :rtype: int + """ + remain = n + head = 1 + step = 1 + from_left = True + while remain > 1: + if from_left: + head += step + elif remain % 2 == 1: + head += step + + step *= 2 + remain /= 2 + from_left = not from_left + + return head diff --git a/392 Is Subsequence py3.py b/392 Is Subsequence py3.py new file mode 100644 index 0000000..45de13d --- /dev/null +++ b/392 Is Subsequence py3.py @@ -0,0 +1,59 @@ +#!/usr/bin/python3 +""" +Given a string s and a string t, check if s is subsequence of t. + +You may assume that there is only lower case English letters in both s and t. t +is potentially a very long (length ~= 500,000) string, and s is a short string +(<=100). + +A subsequence of a string is a new string which is formed from the original +string by deleting some (can be none) of the characters without disturbing the +relative positions of the remaining characters. (ie, "ace" is a subsequence of +"abcde" while "aec" is not). + +Example 1: +s = "abc", t = "ahbgdc" +Return true. + +Example 2: +s = "axc", t = "ahbgdc" +Return false. + +Follow up: +If there are lots of incoming S, say S1, S2, ... , Sk where k >= 1B, and you +want to check one by one to see if T has its subsequence. In this scenario, how +would you change your code? + +Credits: +Special thanks to @pbrother for adding this problem and creating all test cases +""" +from bisect import bisect_left +from collections import defaultdict + + +class Solution: + def isSubsequence(self, s: str, t: str) -> bool: + """ + Subsequence - Binary search + """ + char_pos = defaultdict(list) + for p, c in enumerate(t): + char_pos[c].append(p) + # the list is naturally sorted + + lo_po = -1 + for c in s: + if c not in char_pos: + return False + pos = char_pos[c] + i = bisect_left(pos, lo_po) + if i == len(pos): + return False + lo_po = pos[i] + 1 # pitfall + + return True + + +if __name__ == "__main__": + assert Solution().isSubsequence("abc", "ahbgdc") == True + assert Solution().isSubsequence("acb", "ahbgdc") == False diff --git a/392 Is Subsequence.py b/392 Is Subsequence.py new file mode 100644 index 0000000..ab8534d --- /dev/null +++ b/392 Is Subsequence.py @@ -0,0 +1,40 @@ +""" +Given a string s and a string t, check if s is subsequence of t. + +You may assume that there is only lower case English letters in both s and t. t is potentially a very long (length ~= +500,000) string, and s is a short string (<=100). + +A subsequence of a string is a new string which is formed from the original string by deleting some (can be none) of the +characters without disturbing the relative positions of the remaining characters. (ie, "ace" is a subsequence of "abcde" while "aec" is not). + +Example 1: +s = "abc", t = "ahbgdc" + +Return true. + +Example 2: +s = "axc", t = "ahbgdc" + +Return false. +""" +__author__ = 'Daniel' + + +class Solution(object): + def isSubsequence(self, s, t): + """ + Greedy matching + :type s: str + :type t: str + :rtype: bool + """ + i = 0 + j = 0 + while i < len(s) and j < len(t): + if t[j] != s[i]: + j += 1 + else: + i += 1 + j += 1 + + return i == len(s) diff --git a/393 UTF-8 Validation.py b/393 UTF-8 Validation.py new file mode 100644 index 0000000..2e57683 --- /dev/null +++ b/393 UTF-8 Validation.py @@ -0,0 +1,74 @@ +""" +A character in UTF8 can be from 1 to 4 bytes long, subjected to the following rules: + +For 1-byte character, the first bit is a 0, followed by its unicode code. +For n-bytes character, the first n-bits are all one's, the n+1 bit is 0, followed by n-1 bytes with most significant 2 +bits being 10. +This is how the UTF-8 encoding would work: + + Char. number range | UTF-8 octet sequence + (hexadecimal) | (binary) + --------------------+--------------------------------------------- + 0000 0000-0000 007F | 0xxxxxxx + 0000 0080-0000 07FF | 110xxxxx 10xxxxxx + 0000 0800-0000 FFFF | 1110xxxx 10xxxxxx 10xxxxxx + 0001 0000-0010 FFFF | 11110xxx 10xxxxxx 10xxxxxx 10xxxxxx +Given an array of integers representing the data, return whether it is a valid utf-8 encoding. + +Note: +The input is an array of integers. Only the least significant 8 bits of each integer is used to store the data. This +means each integer represents only 1 byte of data. + +Example 1: + +data = [197, 130, 1], which represents the octet sequence: 11000101 10000010 00000001. + +Return true. +It is a valid utf-8 encoding for a 2-bytes character followed by a 1-byte character. +Example 2: + +data = [235, 140, 4], which represented the octet sequence: 11101011 10001100 00000100. + +Return false. +The first 3 bits are all one's and the 4th bit is 0 means it is a 3-bytes character. +The next byte is a continuation byte which starts with 10 and that's correct. +But the second continuation byte does not start with 10, so it is invalid. +""" + +__author__ = 'Daniel' + + +class Solution(object): + def validUtf8(self, data): + """ + starts with 0, then skip + start with 1, check number of numbers + :type data: List[int] + :rtype: bool + """ + required = 0 + for d in data: + if d & 0x80 == 0: + if required != 0: + return False + else: + one_cnt = 0 + while d & 0x80 == 0x80: + one_cnt += 1 + d <<= 1 + + if required != 0: + if one_cnt != 1: + return False + required -= 1 + else: + if one_cnt == 1: + return False + required += (one_cnt - 1) + + return required == 0 + + +if __name__ == "__main__": + assert Solution().validUtf8([197, 130, 1]) == True + assert Solution().validUtf8([235, 140, 4]) == False diff --git a/394 Decode String.py b/394 Decode String.py new file mode 100644 index 0000000..e794f6d --- /dev/null +++ b/394 Decode String.py @@ -0,0 +1,119 @@ +""" +Given an encoded string, return it's decoded string. + +The encoding rule is: k[encoded_string], where the encoded_string inside the square brackets is being repeated exactly +k times. Note that k is guaranteed to be a positive integer. + +You may assume that the input string is always valid; No extra white spaces, square brackets are well-formed, etc. + +Furthermore, you may assume that the original data does not contain any digits and that digits are only for those repeat +numbers, k. For example, there won't be input like 3a or 2[4]. + +Examples: + +s = "3[a]2[bc]", return "aaabcbc". +s = "3[a2[c]]", return "accaccacc". +s = "2[abc]3[cd]ef", return "abcabccdcdcdef". +""" +__author__ = 'Daniel' + + +class Solution(object): + def decodeString(self, s): + """ + :type s: str + :rtype: str + """ + stk = [ + [1, []] + ] # with default + i = 0 + while i < len(s): + if s[i].isdigit(): # construct number from digit + j = i+1 + while s[j] != '[': j += 1 + stk.append([ + int(s[i:j]), [] + ]) + i = j+1 + elif s[i].islower(): # append alphabet + stk[-1][1].append(s[i]) + i += 1 + elif s[i] == ']': # pop + cnt, partial = stk.pop() + partial = ''.join(partial) * cnt + stk[-1][1].append(partial) + i += 1 + + return ''.join(stk.pop()[1]) + + +class SolutionVerbose(object): + def decodeString(self, s): + """ + :type s: str + :rtype: str + """ + stk = [] + i = 0 + ret = [] + while i < len(s): + if s[i].isdigit(): # construct number from digit + j = i+1 + while s[j] != '[': j += 1 + stk.append([ + int(s[i:j]), [] + ]) + i = j+1 + elif s[i].islower(): # append alphabet + if not stk: + ret.append(s[i]) + else: + stk[-1][1].append(s[i]) + i += 1 + elif s[i] == ']': # pop + cnt, partial = stk.pop() + partial = ''.join(partial) * cnt + if not stk: + ret.append(partial) + else: + stk[-1][1].append(partial) + + i += 1 + + return ''.join(ret) + + +class SolutionError(object): + def decodeString(self, s): + """ + :type s: str + :rtype: str + """ + stk = [] + i = 0 + ret = [] + while i < len(s): + if s[i].isdigit(): + j = i + 1 + while s[j] != '[': j += 1 + prev = stk[-1] if stk else 1 + stk.append(prev * int(s[i:j])) + i = j + 1 + elif s[i].islower(): + repeat = stk[-1] if stk else 1 + for _ in xrange(repeat): ret.append(s[i]) + i += 1 + elif s[i] == ']': + stk.pop() + i += 1 + + return ''.join(ret) + + +if __name__ == "__main__": + assert Solution().decodeString('2[abc]3[cd]ef') == 'abcabccdcdcdef' + + + + diff --git a/395 Longest Substring with At Least K Repeating Characters.py b/395 Longest Substring with At Least K Repeating Characters.py new file mode 100644 index 0000000..9d6c7fb --- /dev/null +++ b/395 Longest Substring with At Least K Repeating Characters.py @@ -0,0 +1,53 @@ +""" +Find the length of the longest substring T of a given string (consists of lowercase letters only) such that every +character in T appears no less than k times. + +Example 1: + +Input: +s = "aaabb", k = 3 + +Output: +3 + +The longest substring is "aaa", as 'a' is repeated 3 times. +Example 2: + +Input: +s = "ababbc", k = 2 + +Output: +5 + +The longest substring is "ababb", as 'a' is repeated 2 times and 'b' is repeated 3 times. +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def longestSubstring(self, s, k): + """ + D & C, forming boundary by the letter of min count + :type s: str + :type k: int + :rtype: int + """ + if not s: + return 0 + + cnt = defaultdict(int) + for e in s: cnt[e] += 1 + + c = min( + s, + key=lambda x: cnt[x], + ) + + if cnt[c] >= k: + return len(s) + + return max( + map(lambda x: self.longestSubstring(x, k), s.split(c)) + ) diff --git a/396 Rotate Function.py b/396 Rotate Function.py new file mode 100644 index 0000000..397a9a4 --- /dev/null +++ b/396 Rotate Function.py @@ -0,0 +1,52 @@ +""" +Given an array of integers A and let n to be its length. + +Assume Bk to be an array obtained by rotating the array A k positions clock-wise, we define a "rotation function" F on +A as follow: + +F(k) = 0 * Bk[0] + 1 * Bk[1] + ... + (n-1) * Bk[n-1]. + +Calculate the maximum value of F(0), F(1), ..., F(n-1). + +Note: +n is guaranteed to be less than 105. + +Example: + +A = [4, 3, 2, 6] + +F(0) = (0 * 4) + (1 * 3) + (2 * 2) + (3 * 6) = 0 + 3 + 4 + 18 = 25 +F(1) = (0 * 6) + (1 * 4) + (2 * 3) + (3 * 2) = 0 + 4 + 6 + 6 = 16 +F(2) = (0 * 2) + (1 * 6) + (2 * 4) + (3 * 3) = 0 + 6 + 8 + 9 = 23 +F(3) = (0 * 3) + (1 * 2) + (2 * 6) + (3 * 4) = 0 + 2 + 12 + 12 = 26 + +So the maximum value of F(0), F(1), F(2), F(3) is F(3) = 26. +""" +import sys + +__author__ = 'Daniel' + + +class Solution(object): + def maxRotateFunction(self, A): + """ + See the rotation pattern + :type A: List[int] + :rtype: int + """ + if not A: return 0 + + gmax = -sys.maxint + n = len(A) + s = sum(A) + + cur = sum(idx * val for idx, val in enumerate(A)) + for r in reversed(A): + cur = cur + s - n * r + gmax = max(gmax, cur) + + return gmax + + +if __name__ == "__main__": + assert Solution().maxRotateFunction([4, 3, 2, 6]) == 26 diff --git a/397 Integer Replacement.py b/397 Integer Replacement.py new file mode 100644 index 0000000..2a0332c --- /dev/null +++ b/397 Integer Replacement.py @@ -0,0 +1,72 @@ +""" +Given a positive integer n and you can do operations as follow: + +If n is even, replace n with n/2. +If n is odd, you can replace n with either n + 1 or n - 1. +What is the minimum number of replacements needed for n to become 1? + +Example 1: + +Input: +8 + +Output: +3 + +Explanation: +8 -> 4 -> 2 -> 1 +Example 2: + +Input: +7 + +Output: +4 + +Explanation: +7 -> 8 -> 4 -> 2 -> 1 +or +7 -> 6 -> 3 -> 2 -> 1 +""" +__author__ = 'Daniel' + + +class Solution(object): + def integerReplacement(self, n): + """ + Simulation using dp fails since bi-directional + Simple recursion + + Math solution: bit manipulation + https://discuss.leetcode.com/topic/58334/a-couple-of-java-solutions-with-explanations/ + 3 is a special case + :type n: int + :rtype: int + """ + ret = 0 + while n != 1: + ret += 1 + if n & 1 == 0: + n >>= 1 + elif n == 0b11 or n >> 1 & 1 == 0: + n -= 1 + else: + n += 1 + + return ret + + def integerReplacementRecur(self, n): + """ + Simple recursion + :type n: int + :rtype: int + """ + if n == 1: return 0 + + ret = 1 + if n%2 == 0: + ret += self.integerReplacement(n/2) + else: + ret += min(self.integerReplacement(n+1), self.integerReplacement(n-1)) + + return ret diff --git a/398 Random Pick Index.py b/398 Random Pick Index.py new file mode 100644 index 0000000..f43a4a0 --- /dev/null +++ b/398 Random Pick Index.py @@ -0,0 +1,74 @@ +""" +Given an array of integers with possible duplicates, randomly output the index of a given target number. You can assume +that the given target number must exist in the array. + +Note: +The array size can be very large. Solution that uses too much extra space will not pass the judge. + +Example: + +int[] nums = new int[] {1,2,3,3,3}; +Solution solution = new Solution(nums); + +// pick(3) should return either index 2, 3, or 4 randomly. Each index should have equal probability of returning. +solution.pick(3); + +// pick(1) should return 0. Since in the array only nums[0] is equal to 1. +solution.pick(1); +""" +import random + +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self, nums): + """ + :type nums: List[int] + """ + self.A = nums + + def pick(self, target): + """ + O(n) + Reservoir Sampling + :type target: int + :rtype: int + """ + sz = 0 + ret = None + for idx, val in enumerate(self.A): + if val == target: + sz += 1 + p = random.randrange(0, sz) + if p == 0: + ret = idx + + return ret + + +class SolutionError(object): + def __init__(self, nums): + """ + Reservoir Sampling + Assume pick is only called once + :type nums: List[int] + """ + self.d = {} + for idx, val in enumerate(nums): + if val not in self.d: + self.d[val] = (idx, 1) + else: + prev, sz = self.d[val] + p = random.randrange(0, sz) + if p < sz: + self.d[val] = (idx, sz + 1) + else: + self.d[val] = (prev, sz + 1) + + def pick(self, target): + """ + :type target: int + :rtype: int + """ + return self.d[target][0] \ No newline at end of file diff --git a/399 Evaluate Division.py b/399 Evaluate Division.py new file mode 100644 index 0000000..8249d44 --- /dev/null +++ b/399 Evaluate Division.py @@ -0,0 +1,83 @@ +""" +Equations are given in the format A / B = k, where A and B are variables represented as strings, and k is a real number +(floating point number). Given some queries, return the answers. If the answer does not exist, return -1.0. + +Example: +Given a / b = 2.0, b / c = 3.0. +queries are: a / c = ?, b / a = ?, a / e = ?, a / a = ?, x / x = ? . +return [6.0, 0.5, -1.0, 1.0, -1.0 ]. + +The input is: vector> equations, vector& values, vector> queries , +where equations.size() == values.size(), and the values are positive. This represents the equations. Return +vector. + +According to the example above: + +equations = [ ["a", "b"], ["b", "c"] ], +values = [2.0, 3.0], +queries = [ ["a", "c"], ["b", "a"], ["a", "e"], ["a", "a"], ["x", "x"] ]. + +""" +from collections import defaultdict +from itertools import izip + +__author__ = 'Daniel' + + +class Solution(object): + def calcEquation(self, equations, values, queries): + """ + transitive closure + :type equations: List[List[str]] + :type values: List[float] + :type queries: List[List[str]] + :rtype: List[float] + """ + G = defaultdict(dict) + for edge, val in izip(equations, values): + s, e = edge + G[s][e], G[e][s] = val, 1/val + G[s][s], G[e][e] = 1, 1 + + return [self.dfs(G, s, e, set()) for s, e in queries] + + def dfs(self, G, s, e, path): + if s not in G or e not in G: + return -1.0 + if e in G[s]: + return G[s][e] + for nbr in G[s]: + if nbr not in path: + path.add(nbr) + val = self.dfs(G, nbr, e, path) + if val != -1.0: + return val * G[s][nbr] + path.remove(nbr) + + return -1.0 + + +class Solution(object): + def calcEquation(self, equations, values, queries): + """ + Floyd-Warshall algorithm + transitive closure + :type equations: List[List[str]] + :type values: List[float] + :type queries: List[List[str]] + :rtype: List[float] + """ + G = defaultdict(dict) + for edge, val in izip(equations, values): + s, e = edge + G[s][e], G[e][s] = val, 1/val + G[s][s], G[e][e] = 1, 1 + + # Floyd-Warshall + for mid in G: + for s in G[mid]: + for e in G[mid]: + G[s][e] = G[s][mid] * G[mid][e] + + return [G[s].get(e, -1.0) for s, e in queries] + diff --git a/400 Nth Digit.py b/400 Nth Digit.py new file mode 100644 index 0000000..e4aa088 --- /dev/null +++ b/400 Nth Digit.py @@ -0,0 +1,45 @@ +""" +Find the nth digit of the infinite integer sequence 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, ... + +Note: +n is positive and will fit within the range of a 32-bit signed integer (n < 231). + +Example 1: + +Input: +3 + +Output: +3 +Example 2: + +Input: +11 + +Output: +0 + +Explanation: +The 11th digit of the sequence 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, ... is a 0, which is part of the number 10. +""" +__author__ = 'Daniel' + + +class Solution(object): + def findNthDigit(self, n): + """ + Math, quotient and remainder + :type n: int + :rtype: int + """ + digit_cnt = 1 + num_cnt = 9 + while n > digit_cnt * num_cnt: + n -= digit_cnt * num_cnt + digit_cnt += 1 + num_cnt *= 10 + + n -= 1 # debugging: without -1, it just pass over the target digit + q, r = n / digit_cnt, n % digit_cnt + target = num_cnt / 9 + q + return int(str(target)[r]) diff --git a/401 Binary Watch.py b/401 Binary Watch.py new file mode 100644 index 0000000..2da0e2d --- /dev/null +++ b/401 Binary Watch.py @@ -0,0 +1,73 @@ +""" +A binary watch has 4 LEDs on the top which represent the hours (0-11), and the 6 LEDs on the bottom represent the +minutes (0-59). + +Each LED represents a zero or one, with the least significant bit on the right. + + +For example, the above binary watch reads "3:25". + +Given a non-negative integer n which represents the number of LEDs that are currently on, return all possible times the +watch could represent. + +Example: + +Input: n = 1 +Return: ["1:00", "2:00", "4:00", "8:00", "0:01", "0:02", "0:04", "0:08", "0:16", "0:32"] +Note: +The order of output does not matter. +The hour must not contain a leading zero, for example "01:00" is not valid, it should be "1:00". +The minute must be consist of two digits and may contain a leading zero, for example "10:2" is not valid, it should be +"10:02". +""" +__author__ = 'Daniel' + + +class Solution(object): + def __init__(self): + self.hours = (1, 2, 4, 8) + self.minutes = (1, 2, 4, 8, 16, 32) + + def readBinaryWatch(self, num): + """ + orderly backtracking + + :type num: int + :rtype: List[str] + """ + def gen(): + for hour_n in xrange(min(num, 4)+1): + for hour in self.hour(hour_n): + for minute in self.minute(num-hour_n): + hour = str(hour) + minute = ('0' + str(minute))[-2:] + yield hour + ':' + minute + + return list(gen()) + + def gen(self, n, head, lst, func): + if head == len(lst): + yield None + + if n == 0: + yield 0 + + for i in xrange(head, len(lst)): + for rest in self.gen(n-1, i+1, lst, func): + if rest is not None: + ret = lst[i]+rest + if func(ret): + yield ret + else: + break + + def hour(self, n): + return self.gen(n, 0, self.hours, lambda x: x < 12) + + def minute(self, n): + return self.gen(n, 0, self.minutes, lambda x: x < 60) + + +if __name__ == "__main__": + assert Solution().readBinaryWatch(1) == ['0:01', '0:02', '0:04', '0:08', '0:16', '0:32', '1:00', '2:00', '4:00', + '8:00'] diff --git a/402 Remove K Digits.py b/402 Remove K Digits.py new file mode 100644 index 0000000..8203f76 --- /dev/null +++ b/402 Remove K Digits.py @@ -0,0 +1,46 @@ +""" +Given a non-negative integer num represented as a string, remove k digits from the number so that the new number is the +smallest possible. + +Note: +The length of num is less than 10002 and will be >= k. +The given num does not contain any leading zero. +Example 1: + +Input: num = "1432219", k = 3 +Output: "1219" +Explanation: Remove the three digits 4, 3, and 2 to form the new number 1219 which is the smallest. +Example 2: + +Input: num = "10200", k = 1 +Output: "200" +Explanation: Remove the leading 1 and the number is 200. Note that the output must not contain leading zeroes. +Example 3: + +Input: num = "10", k = 2 +Output: "0" +Explanation: Remove all the digits from the number and it is left with nothing which is 0. +""" +__author__ = 'Daniel' + + +class Solution(object): + def removeKdigits(self, num, k): + """ + Stack and greedy. + The leading digits should be as small as possible + :type num: str + :type k: int + :rtype: str + """ + stk = [] # result after removal + for char in num: + while k and stk and stk[-1] > char: + stk.pop() + k -= 1 + + stk.append(char) + + for _ in xrange(k): stk.pop() + + return ''.join(stk).lstrip('0') or '0' diff --git a/403 Frog Jump.py b/403 Frog Jump.py new file mode 100644 index 0000000..476c3df --- /dev/null +++ b/403 Frog Jump.py @@ -0,0 +1,69 @@ +""" +A frog is crossing a river. The river is divided into x units and at each unit there may or may not exist a stone. The +frog can jump on a stone, but it must not jump into the water. + +Given a list of stones' positions (in units) in sorted ascending order, determine if the frog is able to cross the river +by landing on the last stone. Initially, the frog is on the first stone and assume the first jump must be 1 unit. + +If the frog's last jump was k units, then its next jump must be either k - 1, k, or k + 1 units. Note that the frog can +only jump in the forward direction. + +Note: + +The number of stones is >= 2 and is < 1,100. +Each stone's position will be a non-negative integer < 231. +The first stone's position is always 0. +Example 1: + +[0,1,3,5,6,8,12,17] + +There are a total of 8 stones. +The first stone at the 0th unit, second stone at the 1st unit, +third stone at the 3rd unit, and so on... +The last stone at the 17th unit. + +Return true. The frog can jump to the last stone by jumping +1 unit to the 2nd stone, then 2 units to the 3rd stone, then +2 units to the 4th stone, then 3 units to the 6th stone, +4 units to the 7th stone, and 5 units to the 8th stone. +Example 2: + +[0,1,2,3,4,8,9,11] + +Return false. There is no way to jump to the last stone as +the gap between the 5th and 6th stone is too large. +""" +__author__ = 'Daniel' + + +class Solution(object): + def canCross(self, stones): + """ + Instead of having F[i][step] = True/False, use F[i] = set of steps + + F, step table + Let F[i] be all possible steps at stone i. + + dp with a set as the table cell. + :type stones: List[int] + :rtype: bool + """ + F = {} + for stone in stones: + F[stone] = set() + + F[0].add(0) + for stone in stones: + for step in F[stone]: + for i in (-1, 0, 1): + nxt = stone + step + i + if nxt != stone and nxt in F: + F[nxt].add(step + i) + + return True if F[stones[-1]] else False + + +if __name__ == "__main__": + assert Solution().canCross([0, 2]) == False + assert Solution().canCross([0, 1, 3, 5, 6, 8, 12, 17]) == True + assert Solution().canCross([0, 1, 2, 3, 4, 8, 9, 11]) == False diff --git a/404 Sum of Left Leaves.py b/404 Sum of Left Leaves.py new file mode 100644 index 0000000..e617757 --- /dev/null +++ b/404 Sum of Left Leaves.py @@ -0,0 +1,45 @@ +""" +Find the sum of all left leaves in a given binary tree. + +Example: + + 3 + / \ + 9 20 + / \ + 15 7 + +There are two left leaves in the binary tree, with values 9 and 15 respectively. Return 24. +""" +__author__ = 'Daniel' + + +# Definition for a binary tree node. +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution(object): + def __init__(self): + self.s = 0 + + def sumOfLeftLeaves(self, root): + """ + :type root: TreeNode + :rtype: int + """ + self.traverse(root) + return self.s + + def traverse(self, node): + if not node: + return + + if node.left and not node.left.left and not node.left.right: + self.s += node.left.val + + self.traverse(node.left) + self.traverse(node.right) diff --git a/405 Convert a Number to Hexadecimal.py b/405 Convert a Number to Hexadecimal.py new file mode 100644 index 0000000..eb8f2ea --- /dev/null +++ b/405 Convert a Number to Hexadecimal.py @@ -0,0 +1,65 @@ +""" +Given an integer, write an algorithm to convert it to hexadecimal. For negative integer, two's complement method is +used. + +Note: + +All letters in hexadecimal (a-f) must be in lowercase. +The hexadecimal string must not contain extra leading 0s. If the number is zero, it is represented by a single zero +character '0'; otherwise, the first character in the hexadecimal string will not be the zero character. +The given number is guaranteed to fit within the range of a 32-bit signed integer. +You must not use any method provided by the library which converts/formats the number to hex directly. +Example 1: + +Input: +26 + +Output: +"1a" +Example 2: + +Input: +-1 + +Output: +"ffffffff" +""" +__author__ = 'Daniel' + + +class Solution(object): + def toHex(self, num): + """ + All use bit manipulation + :type num: int + :rtype: str + """ + ret = [] + while len(ret) < 8 and num: + ret.append(self.encode(num & 0xf)) + num >>= 4 + + return ''.join(ret[::-1]) or '0' + + def toHexNormal(self, num): + """ + Python arithmetic handles the negative number very well + :type num: int + :rtype: str + """ + ret = [] + while len(ret) < 8 and num: + ret.append(self.encode(num % 16)) + num /= 16 + + return ''.join(ret[::-1]) or '0' + + def encode(self, d): + if 0 <= d < 10: + return str(d) + + return chr(ord('a') + d - 10) + + +if __name__ == "__main__": + assert Solution().toHex(-1) == 'ffffffff' diff --git a/406 Queue Reconstruction by Height.py b/406 Queue Reconstruction by Height.py new file mode 100644 index 0000000..a52ea7f --- /dev/null +++ b/406 Queue Reconstruction by Height.py @@ -0,0 +1,98 @@ +""" +Suppose you have a random list of people standing in a queue. Each person is described by a pair of integers (h, k), +where h is the height of the person and k is the number of people in front of this person who have a height greater +than or equal to h. Write an algorithm to reconstruct the queue. + +Note: +The number of people is less than 1,100. + +Example + +Input: +[[7,0], [4,4], [7,1], [5,0], [6,1], [5,2]] + +Output: +[[5,0], [7,0], [5,2], [6,1], [4,4], [7,1]] +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Node(object): + def __init__(self, lo, hi, cnt): + self.lo = lo + self.hi = hi + self.cnt = cnt # size of empty slots + + self.left = None + self.right = None + + def __repr__(self): + return repr("[%d,%d)" % (self.lo, self.hi)) + + +class SegmentTree(object): + """empty space""" + + def __init__(self): + self.root = None + + def build(self, lo, hi): + """a node can have right ONLY IF has left""" + if lo >= hi: return + if lo == hi-1: return Node(lo, hi, 1) + + root = Node(lo, hi, hi-lo) + root.left = self.build(lo, (hi+lo)/2) + root.right = self.build((lo+hi)/2, hi) + return root + + def find_delete(self, root, sz): + """ + :return: index + """ + root.cnt -= 1 + if not root.left: + return root.lo + elif root.left.cnt >= sz: + return self.find_delete(root.left, sz) + else: + return self.find_delete(root.right, + sz-root.left.cnt) + + +class Solution(object): + def reconstructQueue(self, A): + """ + :type A: List[List[int]] + :rtype: List[List[int]] + """ + + def cmp(a, b): + if a[0] != b[0]: + return a[0]-b[0] + else: + return a[1]-b[1] + + st = SegmentTree() + n = len(A) + st.root = st.build(0, n) + A.sort(cmp=cmp) + ret = [0]*n + ret_cnt = defaultdict(int) # handle duplicate element + for a in A: + val, inv = a + idx = st.find_delete(st.root, inv+1-ret_cnt[val]) + ret_cnt[val] += 1 + ret[idx] = a + + return ret + + +if __name__ == "__main__": + assert Solution().reconstructQueue( + [[9, 0], [7, 0], [1, 9], [3, 0], [2, 7], [5, 3], [6, 0], [3, 4], [6, 2], [5, 2]]) == [[3, 0], [6, 0], [7, 0], + [5, 2], [3, 4], [5, 3], + [6, 2], [2, 7], [9, 0], + [1, 9]] \ No newline at end of file diff --git a/407 Trapping Rain Water II.py b/407 Trapping Rain Water II.py new file mode 100644 index 0000000..9c30497 --- /dev/null +++ b/407 Trapping Rain Water II.py @@ -0,0 +1,101 @@ +""" +Given an m x n matrix of positive integers representing the height of each unit cell in a 2D elevation map, compute the +volume of water it is able to trap after raining. + +Note: +Both m and n are less than 110. The height of each unit cell is greater than 0 and is less than 20,000. + +Example: + +Given the following 3x6 height map: +[ + [1,4,3,1,3,2], + [3,2,1,3,2,4], + [2,3,3,2,3,1] +] + +Return 4. + +The above image represents the elevation map [[1,4,3,1,3,2],[3,2,1,3,2,4],[2,3,3,2,3,1]] before the rain. + + +After the rain, water are trapped between the blocks. The total volume of water trapped is 4. +""" +import heapq + +__author__ = 'Daniel' + + +class Cell: + def __init__(self, i, j, h): + self.i = i + self.j = j + self.h = h + + def __cmp__(self, other): + return self.h - other.h + + +class Solution(object): + def __init__(self): + self.dirs = [(-1, 0), (1, 0), (0, -1), (0, 1)] + + def trapRainWater(self, mat): + """ + Find the min height with no water that higher than the current height and keep it. + Starting from the min height with no water + Do BFS with heap (similar to Dijkstra's algorithm) + + :param mat: List[List[int]] + :return: an integer + """ + if not mat: return 0 + + m, n = len(mat), len(mat[0]) + visited = [[False for _ in xrange(n)] for _ in xrange(m)] + h = [] + # add cells at the four edges + for i in xrange(m): + visited[i][0] = True + heapq.heappush(h, Cell(i, 0, mat[i][0])) + visited[i][n-1] = True + heapq.heappush(h, Cell(i, n-1, mat[i][n-1])) + + for j in xrange(1, n-1): + visited[0][j] = True + heapq.heappush(h, Cell(0, j, mat[0][j])) + visited[m-1][j] = True + heapq.heappush(h, Cell(m-1, j, mat[m-1][j])) + + # BFS with heap + trapped = 0 + while h: + cur = heapq.heappop(h) + for dir in self.dirs: + I, J = cur.i+dir[0], cur.j+dir[1] + if 0 <= I < m and 0 <= J < n and not visited[I][J]: + nxt = Cell(I, J, mat[I][J]) + if nxt.h < cur.h: # fill + trapped += cur.h - nxt.h + nxt.h = cur.h + + visited[I][J] = True + heapq.heappush(h, nxt) + + return trapped + + +if __name__ == "__main__": + assert Solution().trapRainWater([ + [12, 13, 0, 12], + [13, 4, 13, 12], + [13, 8, 10, 12], + [12, 13, 12, 12], + [13, 13, 13, 13]] + ) == 14 + assert Solution().trapRainWater([ + [9, 1, 10, 10], + [9, 1, 2, 8], + [2, 6, 5, 0], + [6, 0, 9, 0]] + ) == 0 diff --git a/408 Valid Word Abbreviation.py b/408 Valid Word Abbreviation.py new file mode 100644 index 0000000..bf83fce --- /dev/null +++ b/408 Valid Word Abbreviation.py @@ -0,0 +1,36 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Solution(object): + def validWordAbbreviation(self, word, abbr): + """ + pointers + :type word: str + :type abbr: str + :rtype: bool + """ + w = 0 + a = 0 + while w < len(word) and a < len(abbr): + if abbr[a].isdigit() and abbr[a] != '0': + e = a + while e < len(abbr) and abbr[e].isdigit(): e += 1 + num = int(abbr[a:e]) + a = e + w += num + else: + if word[w] != abbr[a]: + return False + + w += 1 + a += 1 + + return w == len(word) and a == len(abbr) + + +if __name__ == "__main__": + assert Solution().validWordAbbreviation("internationalization", "i12iz4n") == True + assert Solution().validWordAbbreviation("apple", "a2e") == False diff --git a/409 Longest Palindrome.py b/409 Longest Palindrome.py new file mode 100644 index 0000000..5d43f96 --- /dev/null +++ b/409 Longest Palindrome.py @@ -0,0 +1,47 @@ +""" +Given a string which consists of lowercase or uppercase letters, find the length of the longest palindromes that can be +built with those letters. + +This is case sensitive, for example "Aa" is not considered a palindrome here. + +Note: +Assume the length of given string will not exceed 1,010. + +Example: + +Input: +"abccccdd" + +Output: +7 + +Explanation: +One longest palindrome that can be built is "dccaccd", whose length is 7. +""" +from collections import defaultdict + +__author__ = 'Daniel' + + +class Solution(object): + def longestPalindrome(self, s): + """ + :type s: str + :rtype: int + """ + c = defaultdict(int) + for elt in s: + c[elt] += 1 + + ret = 0 + for v in c.values(): + ret += (v/2) * 2 + + if any(map(lambda x: x % 2 == 1, c.values())): + ret += 1 + + return ret + + +if __name__ == "__main__": + assert Solution().longestPalindrome("abccccdd") == 7 diff --git a/410 Split Array Largest Sum.py b/410 Split Array Largest Sum.py new file mode 100644 index 0000000..a258f4b --- /dev/null +++ b/410 Split Array Largest Sum.py @@ -0,0 +1,152 @@ +#!/usr/bin/python3 +""" +Given an array which consists of non-negative integers and an integer m, you can +split the array into m non-empty continuous subarrays. Write an algorithm to +minimize the largest sum among these m subarrays. + +Note: +If n is the length of array, assume the following constraints are satisfied: + +1 ≤ n ≤ 1000 +1 ≤ m ≤ min(50, n) +Examples: + +Input: +nums = [7,2,5,10,8] +m = 2 + +Output: +18 + +Explanation: +There are four ways to split nums into two subarrays. +The best way is to split it into [7,2,5] and [10,8], +where the largest sum among the two subarrays is only 18. +""" +from typing import List +from functools import lru_cache + + +class SolutionDP: + def splitArray(self, nums: List[int], m: int) -> int: + """ + non-aftereffect, dp + Let F[l][k] be the minimized max sum in nums[:l] with k parts + F[l][k] = max(F[j][k-1], sum(nums[j:l])), minimize over j + """ + n = len(nums) + sums = [0] + for e in nums: + sums.append(sums[-1] + e) + + F = [[float("inf") for _ in range(m + 1)] for _ in range(n + 1)] + for l in range(1, n + 1): + F[l][1] = sums[l] - sums[0] + # or F[0][0] = 0 + + for l in range(1, n + 1): + for k in range(1, m + 1): + for j in range(l): + F[l][k] = min( + F[l][k], max(F[j][k-1], sums[l] - sums[j]) + ) + + return F[n][m] + + +class Solution: + def splitArray(self, nums: List[int], m: int) -> int: + """ + Binary search over the subarray sum values + """ + lo = max(nums) + hi = sum(nums) + 1 + ret = hi + while lo < hi: + mid = (lo + hi) // 2 + cnt = 1 # pitfall, initial is 1 (the 1st running sum) + cur_sum = 0 + for e in nums: + if cur_sum + e > mid: + cnt += 1 + cur_sum = e + else: + cur_sum += e + + if cnt <= m: + ret = min(ret, mid) # pitfall. Condition satisfied + hi = mid + else: + lo = mid + 1 + + return ret + + +class SolutionTLE2: + def __init__(self): + self.sums = [0] + + def splitArray(self, nums: List[int], m: int) -> int: + """ + memoization with 1 less param + """ + for n in nums: + self.sums.append(self.sums[-1] + n) + + ret = self.dfs(len(nums), m) + return ret + + @lru_cache(maxsize=None) + def dfs(self, hi, m): + """ + j break the nums[:hi] into left and right part + """ + if m == 1: + return self.sums[hi] - self.sums[0] + + mini = float("inf") + for j in range(hi): + right = self.sums[hi] - self.sums[j] + left = self.dfs(j, m - 1) + # minimize the max + mini = min(mini, max(left, right)) + + return mini + + +class SolutionTLE: + def __init__(self): + self.sums = [0] + + def splitArray(self, nums: List[int], m: int) -> int: + """ + Minimize the largest subarray sum + + backtracking + memoization + """ + for n in nums: + self.sums.append(self.sums[-1] + n) + ret = self.dfs(tuple(nums), 0, len(nums), m) + return ret + + @lru_cache(maxsize=None) + def dfs(self, nums, lo, hi, m): + """ + j break the nums[lo:hi] into left and right part + """ + if m == 1: + return self.sums[hi] - self.sums[lo] + + mini = float("inf") + for j in range(lo, hi): + left = self.sums[j] - self.sums[lo] + right = self.dfs(nums, j, hi, m - 1) + # minimize the max + mini = min(mini, max(left, right)) + + return mini + + +if __name__ == "__main__": + assert Solution().splitArray([1, 4, 4], 3) == 4 + assert Solution().splitArray([7,2,5,10,8], 2) == 18 diff --git a/411 Minimum Unique Word Abbreviation.py b/411 Minimum Unique Word Abbreviation.py new file mode 100644 index 0000000..c21242c --- /dev/null +++ b/411 Minimum Unique Word Abbreviation.py @@ -0,0 +1,76 @@ +""" +Premium Question +""" +__author__ = 'Daniel' + + +class Solution(object): + def minAbbreviation(self, target, dictionary): + """ + :type target: str + :type dictionary: List[str] + :rtype: str + """ + ret = (target, len(target)) + for abbr, abbr_l in self.dfs(target): + if self.validate(dictionary, abbr) and ret[1] > abbr_l: + ret = (abbr, abbr_l) + + return ret[0] + + def dfs(self, word): + """ + backtracking, pivoting letter + :type word: str + :rtype: List[str] + """ + if not word: + return [("", 0)] + + ret = [] + for l in xrange(len(word)+1): + left_num = str(l) if l else "" + left_l = 1 if left_num != "" else 0 + left_l += 1 if l < len(word) else 0 + + for right, right_l in self.dfs(word[l+1:]): + cur = left_num + word[l:l+1] + right # word[l:l+1] possible "" + ret.append((cur, left_l + right_l)) + + return ret + + def validate(self, dictionary, abbr): + for w in dictionary: + if self.validWordAbbreviation(w, abbr): + return False + + return True + + def validWordAbbreviation(self, word, abbr): + """ + pointers + :type word: str + :type abbr: str + :rtype: bool + """ + w = 0 + a = 0 + while w < len(word) and a < len(abbr): + if abbr[a].isdigit() and abbr[a] != '0': + e = a + while e < len(abbr) and abbr[e].isdigit(): e += 1 + num = int(abbr[a:e]) + a = e + w += num + else: + if word[w] != abbr[a]: + return False + + w += 1 + a += 1 + + return w == len(word) and a == len(abbr) + + +if __name__ == "__main__": + assert Solution().minAbbreviation("apple", ["blade"]) == "a4" diff --git a/412 Fizz Buzz.py b/412 Fizz Buzz.py new file mode 100644 index 0000000..771cb4d --- /dev/null +++ b/412 Fizz Buzz.py @@ -0,0 +1,51 @@ +""" +Write a program that outputs the string representation of numbers from 1 to n. + +But for multiples of three it should output "Fizz" instead of the number and for the multiples of five output "Buzz". +For numbers which are multiples of both three and five output "FizzBuzz". + +Example: + +n = 15, + +Return: +[ + "1", + "2", + "Fizz", + "4", + "Buzz", + "Fizz", + "7", + "8", + "Fizz", + "Buzz", + "11", + "Fizz", + "13", + "14", + "FizzBuzz" +] +""" +__author__ = 'Daniel' + + +class Solution(object): + def fizzBuzz(self, n): + """ + :type n: int + :rtype: List[str] + """ + ret = [] + for i in xrange(1, n+1): + cur = "" + if i % 3 == 0: + cur += "Fizz" + if i % 5 == 0: + cur += "Buzz" + if not cur: + cur = str(i) + + ret.append(cur) + + return ret \ No newline at end of file diff --git a/413 Arithmetic Slices.py b/413 Arithmetic Slices.py new file mode 100644 index 0000000..b4694db --- /dev/null +++ b/413 Arithmetic Slices.py @@ -0,0 +1,45 @@ +#!/usr/bin/python3 +""" +A sequence of number is called arithmetic if it consists of at least three +elements and if the difference between any two consecutive elements is the same. + +The function should return the number of arithmetic slices in the array A. +""" + +class Solution: + def count(self, l): + return (l-1) * l // 2 + + def numberOfArithmeticSlices(self, A): + """ + Diff the array, find the pattern. + Find that it is a function of length of the sequence + With 3 consecutive sequence (l - 1) * l / 2 + + :type A: List[int] + :rtype: int + """ + ret = 0 + if len(A) < 3: + return ret + + delta = [] + for i in range(1, len(A)): + delta.append(A[i] - A[i-1]) + + s = 0 + e = 0 + while s < len(delta): + while e < len(delta) and delta[s] == delta[e]: + e += 1 + + l = e - s + ret += self.count(l) + + s = e + + return ret + + +if __name__ == "__main__": + assert Solution().numberOfArithmeticSlices([1, 2, 3, 4]) == 3 diff --git a/414 Third Maximum Number.py b/414 Third Maximum Number.py new file mode 100644 index 0000000..0d5c823 --- /dev/null +++ b/414 Third Maximum Number.py @@ -0,0 +1,43 @@ +#!/usr/bin/python3 +""" +Given a non-empty array of integers, return the third maximum number in this +array. If it does not exist, return the maximum number. The time complexity +must be in O(n). +""" +__author__ = 'Danyang' +import heapq + + +class Solution: + def thirdMax(self, nums): + """ + It is an easy question but error prone: + 1. Choice of min heap or max heap: use min heap (not max heap) because + we want to know the smallest maximum number + 2. Duplicate number + :type nums: List[int] + :rtype: int + """ + if not nums: + return None + + h = [] + for e in set(nums): + if len(h) < 3: + heapq.heappush(h, e) + elif len(h) == 3 and e > h[0]: + heapq.heappushpop(h, e) + + assert len(h) <= 3 + if len(h) == 3: + ret = min(h) + else: + ret = max(h) + return ret + + +if __name__ == "__main__": + assert Solution().thirdMax([1, 2, 3, 4]) == 2 + assert Solution().thirdMax([4, 3, 2, 1]) == 2 + assert Solution().thirdMax([2, 2, 3, 1]) == 1 + assert Solution().thirdMax([4, 3]) == 4 diff --git a/415 Add Strings.py b/415 Add Strings.py new file mode 100644 index 0000000..8140737 --- /dev/null +++ b/415 Add Strings.py @@ -0,0 +1,56 @@ +#!/usr/bin/python3 +""" +Given two non-negative integers num1 and num2 represented as string, return the sum of num1 and num2. + +Note: +The length of both num1 and num2 is < 5100. +Both num1 and num2 contains only digits 0-9. +Both num1 and num2 does not contain any leading zero. +You must not use any built-in BigInteger library or convert the inputs to integer directly. +""" + + +class Solution: + def int(self, n): + return ord(n) - ord("0") + + def addStrings(self, num1, num2): + """ + :type num1: str + :type num2: str + :rtype: str + """ + ret = [] + # let num2 to be one has more digit + if len(num1) > len(num2): + num1, num2 = num2, num1 + + num1 = num1[::-1] + num2 = num2[::-1] + carry = 0 + idx = 0 + while idx < len(num2): + if idx < len(num1): + s = self.int(num1[idx]) + self.int(num2[idx]) + carry + else: + s = self.int(num2[idx]) + carry + + if s >= 10: + s -= 10 + carry = 1 + else: + carry = 0 + + ret.append(s) + idx += 1 + + if carry: + ret.append(carry) + + return "".join(map(str, ret[::-1])) + + +if __name__ == "__main__": + assert Solution().addStrings("9999", "1") == "10000" + assert Solution().addStrings("9999", "9999") == "19998" + assert Solution().addStrings("23", "8") == "31" diff --git a/416 Partition Equal Subset Sum.py b/416 Partition Equal Subset Sum.py new file mode 100644 index 0000000..5b20bbc --- /dev/null +++ b/416 Partition Equal Subset Sum.py @@ -0,0 +1,78 @@ +#!/usr/bin/python3 +""" +Given a non-empty array containing only positive integers, find if the array can +be partitioned into two subsets such that the sum of elements in both subsets is +equal. +""" +from collections import defaultdict + + +class Solution: + def canPartition(self, nums): + """ + 0/1 Knapsack problem + + Carefully define the state: + Let d[i][s] be # subset of nums[:i+1], can be sum to s + + Transition function: + d[i][s] = d[i-1][s] + d[i-1][s-nums[i]] + = case not choose nums[i] + case choose nums[i] + + :type nums: List[int] + :rtype: bool + """ + if not nums: + return False + + s = sum(nums) + if s % 2 != 0: + return False + + target = s // 2 + d = defaultdict(lambda: defaultdict(int)) + d[0][0] = 1 + d[0][nums[0]] = 1 + + for i in range(1, len(nums)): + for v in range(target + 1): + d[i][v] = d[i-1][v] + d[i-1][v-nums[i]] + + return any(d[i][target] > 0 for i in range(len(nums))) + + def canPartition_TLE(self, nums): + """ + subset rather than sub array + positive number only + + dfs with pruning O(2^n), whether to choose the number or not + + :type nums: List[int] + :rtype: bool + """ + nums.sort() + s = sum(nums) + if s % 2 != 0: + return False + + target = s // 2 + return self.dfs(nums, 0, target) + + def dfs(self, nums, idx, target): + """Find a subset that sum to target""" + if not idx < len(nums): + return False + if nums[idx] == target: + return True + if nums[idx] > target: + return False + + return ( + self.dfs(nums, idx + 1, target) or # not take nums[idx] + self.dfs(nums, idx + 1, target - nums[idx]) # take nums[idx] + ) + + +if __name__ == "__main__": + assert Solution().canPartition([1, 5, 11, 5]) == True + assert Solution().canPartition([1, 2, 3, 5]) == False diff --git a/417 Pacific Atlantic Water Flow.py b/417 Pacific Atlantic Water Flow.py new file mode 100644 index 0000000..26ec85b --- /dev/null +++ b/417 Pacific Atlantic Water Flow.py @@ -0,0 +1,150 @@ +#!/usr/bin/python3 +""" +Given an m x n matrix of non-negative integers representing the height of each +nit cell in a continent, the "Pacific ocean" touches the left and top edges of +the matrix and the "Atlantic ocean" touches the right and bottom edges. + +Water can only flow in four directions (up, down, left, or right) from a cell to +another one with height equal or lower. + +Find the list of grid coordinates where water can flow to both the Pacific and +Atlantic ocean. + +Note: +The order of returned grid coordinates does not matter. +Both m and n are less than 150. +Example: + +Given the following 5x5 matrix: + + Pacific ~ ~ ~ ~ ~ + ~ 1 2 2 3 (5) * + ~ 3 2 3 (4) (4) * + ~ 2 4 (5) 3 1 * + ~ (6) (7) 1 4 5 * + ~ (5) 1 1 2 4 * + * * * * * Atlantic + +Return: + +[[0, 4], [1, 3], [1, 4], [2, 2], [3, 0], [3, 1], [4, 0]] (positions with +parentheses in above matrix). +""" +dirs = ((0, 1), (0, -1), (1, 0), (-1, 0)) + + +class Solution: + def pacificAtlantic(self, matrix): + """ + dfs, visisted O(1) + Similar to Trapping Rainwater II (BFS + heap), but no need to record + volume, thus, dfs is enough. + + Similar to longest increasing path + + Starting from the edge point rather than any point, dfs visit the + possible cell + + Complexity analysis, although a cell can be checked multiple times + (at most 4 times); but only perform 1 dfs on each cell; thus + O(mn) + + :type matrix: List[List[int]] + :rtype: List[List[int]] + """ + if not matrix or not matrix[0]: + return [] + + m, n = len(matrix), len(matrix[0]) # row, col + # don't do [[False] * n ] * m, memory management, all rows reference the same row + P = [[False for _ in range(n)] for _ in range(m)] + A = [[False for _ in range(n)] for _ in range(m)] + + # starting from edge point + for i in range(m): + self.dfs(matrix, i, 0, P) + self.dfs(matrix, i, n-1, A) + + for j in range(n): + self.dfs(matrix, 0, j, P) + self.dfs(matrix, m-1, j, A) + + ret = [ + [i, j] + for i in range(m) + for j in range(n) + if P[i][j] and A[i][j] + ] + return ret + + def dfs(self, matrix, i, j, C): + # check before dfs (to be consistent) + C[i][j] = True + m, n = len(matrix), len(matrix[0]) + for x, y in dirs: + I = i + x + J = j + y + if 0 <= I < m and 0 <= J < n and matrix[i][j] <= matrix[I][J]: + if not C[I][J]: + self.dfs(matrix, I, J, C) + + + def pacificAtlantic_error(self, matrix): + """ + DP + dfs, visisted O(1) + :type matrix: List[List[int]] + :rtype: List[List[int]] + """ + if not matrix or not matrix[0]: + return [] + + m, n = len(matrix), len(matrix[0]) # row, col + P = [[False] * n ] * m + A = [[False] * n ] * m + + visisted = [[False] * n ] * m + for i in range(m): + for j in range(n): + self.dfs_error(matrix, i, j, visisted, P, lambda i, j: i < 0 or j <0) + + visisted = [[False] * n ] * m + for i in range(m): + for j in range(n): + self.dfs_error(matrix, i, j, visisted, A, lambda i, j: i >= m or j >= n) + + ret = [ + [i, j] + for i in range(m) + for j in range(n) + if P[i][j] and A[i][j] + ] + return ret + + + def dfs_error(self, matrix, i, j, visisted, C, predicate): + m, n = len(matrix), len(matrix[0]) + if visisted[i][j]: + return C[i][j] + + visisted[i][j] = True + for x, y in dirs: + i2 = i + x + j2= j + y + if 0 <= i2 < m and 0 <= j2 < n: + if self.dfs_error(matrix, i2, j2, visisted, C, predicate) and matrix[i][j] >= matrix[i2][j2]: + C[i][j] = True + elif predicate(i2, j2): + C[i][j] = True + + return C[i][j] + + +if __name__ == "__main__": + assert Solution().pacificAtlantic([ + [1,2,2,3,5], + [3,2,3,4,4], + [2,4,5,3,1], + [6,7,1,4,5], + [5,1,1,2,4] + ]) == [[0, 4], [1, 3], [1, 4], [2, 2], [3, 0], [3, 1], [4, 0]] diff --git a/418 Sentence Screen Fitting.py b/418 Sentence Screen Fitting.py new file mode 100644 index 0000000..cddb779 --- /dev/null +++ b/418 Sentence Screen Fitting.py @@ -0,0 +1,77 @@ +#!/usr/bin/python3 +""" +Given a rows x cols screen and a sentence represented by a list of non-empty +words, find how many times the given sentence can be fitted on the screen. + +Note: +A word cannot be split into two lines. +The order of words in the sentence must remain unchanged. +Two consecutive words in a line must be separated by a single space. +Total words in the sentence won't exceed 100. +Length of each word is greater than 0 and won't exceed 10. +1 ≤ rows, cols ≤ 20,000. +Example 1: + +Input: +rows = 2, cols = 8, sentence = ["hello", "world"] + +Output: +1 + +Explanation: +hello--- +world--- + +The character '-' signifies an empty space on the screen. +Example 2: + +Input: +rows = 3, cols = 6, sentence = ["a", "bcd", "e"] + +Output: +2 + +Explanation: +a-bcd- +e-a--- +bcd-e- + +The character '-' signifies an empty space on the screen. +Example 3: + +Input: +rows = 4, cols = 5, sentence = ["I", "had", "apple", "pie"] + +Output: +1 + +Explanation: +I-had +apple +pie-I +had-- + +The character '-' signifies an empty space on the screen. +""" +from typing import List + + +class Solution: + def wordsTyping(self, sentence: List[str], rows: int, cols: int) -> int: + """ + How many times to fit + + Combine the words in to a string and wrap it around + """ + sentence = " ".join(sentence) + " " # unify the condition checking for the last word; tail will wrap with head with space + i = 0 + for r in range(rows): + i += cols + while sentence[i % len(sentence)] != " ": + i -= 1 + + # now sentence[i] is " " + i += 1 + + ret = i // len(sentence) + return ret diff --git a/419 Battleships in a Board.py b/419 Battleships in a Board.py new file mode 100644 index 0000000..6c30b4e --- /dev/null +++ b/419 Battleships in a Board.py @@ -0,0 +1,63 @@ +""" +Given an m x n matrix board where each cell is a battleship 'X' or empty '.', return the number of the battleships on board. + +Battleships can only be placed horizontally or vertically on board. In other words, they can only be made of the shape 1 x k (1 row, k columns) or k x 1 (k rows, 1 column), where k can be of any size. At least one horizontal or vertical cell separates between two battleships (i.e., there are no adjacent battleships). + + + +Example 1: + + +Input: board = [["X",".",".","X"],[".",".",".","X"],[".",".",".","X"]] +Output: 2 +Example 2: + +Input: board = [["."]] +Output: 0 + + +Constraints: + +m == board.length +n == board[i].length +1 <= m, n <= 200 +board[i][j] is either '.' or 'X'. + + +Follow up: Could you do it in one-pass, using only O(1) extra memory and without modifying the values board? +""" + + +class Solution: + def countBattleships(self, board: List[List[str]]) -> int: + """ + dfs + counting + since no adjacent + """ + self.dirs = [(0, -1), (0, 1), (1, 0), (-1, 0)] + self.M = len(board) + self.N = len(board[0]) + self.board = board + + visited = [ + [False for _ in range(self.N)] + for _ in range(self.M) + ] + ret = 0 + for i in range(self.M): + for j in range(self.N): + if board[i][j] == "X" and not visited[i][j]: + ret += 1 + self.dfs(i, j, visited) + + return ret + + def dfs(self, i, j, visited): + visited[i][j] = True + for di, dj in self.dirs: + I = i + di + J = j + dj + if 0 <= I < self.M and 0 <= J < self.N \ + and self.board[I][J] == "X" and not visited[I][J]: + self.dfs(I, J, visited) + \ No newline at end of file diff --git a/421 Maximum XOR of Two Numbers in an Array.py b/421 Maximum XOR of Two Numbers in an Array.py new file mode 100644 index 0000000..9a0829a --- /dev/null +++ b/421 Maximum XOR of Two Numbers in an Array.py @@ -0,0 +1,38 @@ +#!/usr/bin/python3 +""" +Given a non-empty array of numbers, a0, a1, a2, … , an-1, where 0 ≤ ai < 2^31. + +Find the maximum result of ai XOR aj, where 0 ≤ i, j < n. + +Could you do this in O(n) runtime? +""" + + +class Solution: + def findMaximumXOR(self, nums): + """ + Brute force: O(n^2) + constrinat: 32 bit + check bit by bit rather than number by number + build the bit from MSB to LSB, since be need the largest + + :type nums: List[int] + :rtype: int + """ + ret = 0 + for i in reversed(range(32)): + prefixes = set(num >> i for num in nums) + ret <<= 1 + # fixing the remaining bit, set the LSB + cur = ret + 1 + for p in prefixes: + # a ^ b ^ a = b + if cur ^ p in prefixes: + ret = cur + break # found one + + return ret + + +if __name__ == "__main__": + assert Solution().findMaximumXOR([3, 10, 5, 25, 2, 8]) == 28 diff --git a/424 Longest Repeating Character Replacement.py b/424 Longest Repeating Character Replacement.py new file mode 100644 index 0000000..3deca2b --- /dev/null +++ b/424 Longest Repeating Character Replacement.py @@ -0,0 +1,51 @@ +#!/usr/bin/python3 +""" +Given a string that consists of only uppercase English letters, you can replace +any letter in the string with another letter at most k times. Find the length of +a longest substring containing all repeating letters you can get after +performing the above operations. +""" +import string +import operator + + +class Solution: + def characterReplacement(self, s, k): + """ + Replace any letter with another letter - replace any letter with any + letter. + + Longest substring with all repeating letters, replace k + + Sliding window, replace every letter except for the most common letter + to the most comm letter + + :type s: str + :type k: int + :rtype: int + """ + counter = { + alphabet: 0 + for alphabet in string.ascii_uppercase + } + lo = 0 + ret = 0 + assert k > 0 + for hi in range(len(s)): + counter[s[hi]] += 1 + while True: + most = max(counter.values()) # O(26) + l = hi - lo + 1 + if l - most > k: + counter[s[lo]] -= 1 + lo += 1 + else: + ret = max(ret, l) + break + + return ret + + +if __name__ == "__main__": + assert Solution().characterReplacement("AABABBA", 1) == 4 + assert Solution().characterReplacement("ABAB", 2) == 4 diff --git a/427 Construct Quad Tree.py b/427 Construct Quad Tree.py new file mode 100644 index 0000000..2dd16cc --- /dev/null +++ b/427 Construct Quad Tree.py @@ -0,0 +1,57 @@ +#!/usr/bin/python3 +""" +We want to use quad trees to store an N x N boolean grid. Each cell in the grid +can only be true or false. The root node represents the whole grid. For each +node, it will be subdivided into four children nodes until the values in the +region it represents are all the same. + +Each node has another two boolean attributes : isLeaf and val. isLeaf is true if +and only if the node is a leaf node. The val attribute for a leaf node contains +the value of the region it represents. +""" +__author__ = 'Danyang' + + +# Definition for a QuadTree node. +class Node: + def __init__(self, val, isLeaf, topLeft, topRight, bottomLeft, bottomRight): + self.val = val + self.isLeaf = isLeaf + self.topLeft = topLeft + self.topRight = topRight + self.bottomLeft = bottomLeft + self.bottomRight = bottomRight + + +class Solution: + def construct(self, grid): + """ + DPS, check 4 children then merge + + :type grid: List[List[int]] + :rtype: Node + """ + l = len(grid) + return self._construct(grid, 0, 0, l) + + def _construct(self, grid, row, col, l): + """ + Use row col for matrix rather than x y coordiate since the direction is + error-prone + """ + if l == 1: + return Node(grid[row][col], True, None, None, None, None) + + l_child = l // 2 + topLeft = self._construct(grid, row, col, l_child) + topRight = self._construct(grid, row, col + l_child, l_child) + bottomLeft = self._construct(grid, row + l_child, col, l_child) + bottomRight = self._construct(grid, row + l_child, col + l_child, l_child) + is_leaf = ( + topLeft.val == topRight.val == bottomLeft.val == bottomRight.val + != "*" + ) + if is_leaf: + return Node(grid[row][col], True, None, None, None, None) + + return Node("*", False, topLeft, topRight, bottomLeft, bottomRight) diff --git a/429 N-ary Tree Level Order Traversal.py b/429 N-ary Tree Level Order Traversal.py new file mode 100644 index 0000000..cacb5d3 --- /dev/null +++ b/429 N-ary Tree Level Order Traversal.py @@ -0,0 +1,37 @@ +#!/usr/bin/python3 +""" +Given an n-ary tree, return the level order traversal of its nodes' values. (ie, from left to right, level by level). +""" + + +# Definition for a Node. +class Node: + def __init__(self, val, children): + self.val = val + self.children = children + + +class Solution: + def levelOrder(self, root): + """ + BFS + + :type root: Node + :rtype: List[List[int]] + """ + if not root: + return [] + + q = [root] + ret = [] + while q: + cur = [] + q_new = [] + for e in q: + q_new.extend(e.children) + cur.append(e.val) + + ret.append(cur) + q = q_new + + return ret diff --git a/433 Minimum Genetic Mutation.py b/433 Minimum Genetic Mutation.py new file mode 100644 index 0000000..d408ae1 --- /dev/null +++ b/433 Minimum Genetic Mutation.py @@ -0,0 +1,70 @@ +#!/usr/bin/python3 +""" +A gene string can be represented by an 8-character long string, with choices +from "A", "C", "G", "T". + +Suppose we need to investigate about a mutation (mutation from "start" to +"end"), where ONE mutation is defined as ONE single character changed in the +gene string. + +For example, "AACCGGTT" -> "AACCGGTA" is 1 mutation. + +Also, there is a given gene "bank", which records all the valid gene mutations. +A gene must be in the bank to make it a valid gene string. + +Now, given 3 things - start, end, bank, your task is to determine what is the +minimum number of mutations needed to mutate from "start" to "end". If there is +no such a mutation, return -1. + +Note: + +Starting point is assumed to be valid, so it might not be included in the bank. +If multiple mutations are needed, all mutations during in the sequence must be +valid. +You may assume start and end string is not the same. +""" + + +class Solution: + def is_neighbor(self, p, q): + diff = 0 + for a, b in zip(p, q): + if a != b: + diff += 1 + if diff > 1: + return False + return True + + def minMutation(self, start, end, bank): + """ + BFS, record level and avoid loop + + Similar to 127 Word Ladder + + :type start: str + :type end: str + :type bank: List[str] + :rtype: int + """ + q = [start] + visited = {start} + lvl = 0 + while q: + cur_q = [] + for e in q: + if e == end: + return lvl + for t in bank: + if t not in visited and self.is_neighbor(e, t): + visited.add(t) + cur_q.append(t) + + lvl += 1 + q = cur_q + + return -1 + + +if __name__ == "__main__": + assert Solution().minMutation("AACCTTGG", "AATTCCGG", ["AATTCCGG","AACCTGGG","AACCCCGG","AACCTACC"]) == -1 + assert Solution().minMutation("AACCGGTT", "AAACGGTA", ["AACCGGTA", "AACCGCTA", "AAACGGTA"]) == 2 diff --git a/434 Number of Segments in a String.py b/434 Number of Segments in a String.py new file mode 100644 index 0000000..6de0c51 --- /dev/null +++ b/434 Number of Segments in a String.py @@ -0,0 +1,34 @@ +#!/usr/bin/python3 +""" +Count the number of segments in a string, where a segment is defined to be a +contiguous sequence of non-space characters. + +Please note that the string does not contain any non-printable characters. +""" + + +class Solution: + def countSegments(self, s): + """ + I could use split but it may not be the intention of this problem + + :type s: str + :rtype: int + """ + ret = 0 + if not s: + return ret + + # count at start + if s[0] != " ": + ret = 1 + prev = s[0] + for c in s[1:]: + if c != " " and prev == " ": + ret += 1 + prev = c + return ret + + +if __name__ == "__main__": + assert Solution().countSegments("Hello, my name is John") == 5 diff --git a/435 Non-overlapping Intervals.py b/435 Non-overlapping Intervals.py new file mode 100644 index 0000000..48eb45b --- /dev/null +++ b/435 Non-overlapping Intervals.py @@ -0,0 +1,52 @@ +#!/usr/bin/python3 +""" +Given a collection of intervals, find the minimum number of intervals you need +to remove to make the rest of the intervals non-overlapping. + +Note: +You may assume the interval's end point is always bigger than its start point. +Intervals like [1,2] and [2,3] have borders "touching" but they don't overlap +each other. +""" + +# Definition for an interval. +class Interval: + def __init__(self, s=0, e=0): + self.start = s + self.end = e + + @classmethod + def new(cls, lst): + return [ + cls(s, e) + for s, e in lst + ] + + +class Solution: + def eraseOverlapIntervals(self, intervals): + """ + Greedy remove the large e when overlapping + :type intervals: List[Interval] + :rtype: int + """ + ret = 0 + if not intervals: + return ret + + intervals.sort(key=lambda x: x.start) + cur = intervals[0] + for itv in intervals[1:]: + if cur.end <= itv.start: + cur = itv + else: + ret += 1 + cur = cur if cur.end < itv.end else itv + + return ret + + +if __name__ == "__main__": + assert Solution().eraseOverlapIntervals(Interval.new([ [1,2], [2,3], [3,4], [1,3] ])) == 1 + assert Solution().eraseOverlapIntervals(Interval.new([ [1,2], [1,2], [1,2] ])) == 2 + assert Solution().eraseOverlapIntervals(Interval.new([ [1,2], [2,3] ])) == 0 diff --git a/436 Find Right Interval.py b/436 Find Right Interval.py new file mode 100644 index 0000000..5145e30 --- /dev/null +++ b/436 Find Right Interval.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +Given a set of intervals, for each of the interval i, check if there exists an +interval j whose start point is bigger than or equal to the end point of the +interval i, which can be called that j is on the "right" of i. + +For any interval i, you need to store the minimum interval j's index, which +means that the interval j has the minimum start point to build the "right" +relationship for interval i. If the interval j doesn't exist, store -1 for the +interval i. Finally, you need output the stored value of each interval as an +array. + +Note: +You may assume the interval's end point is always bigger than its start point. +You may assume none of these intervals have the same start point. +""" +class Interval: + def __init__(self, s=0, e=0): + self.start = s + self.end = e + + @classmethod + def new(cls, lst): + return [ + cls(s, e) + for s, e in lst + ] + +from bisect import bisect_left + + +class Solution: + def findRightInterval(self, intervals): + """ + given e, find the right s - bisect + + :type intervals: List[Interval] + :rtype: List[int] + """ + indexes = { + itv.start: idx + for idx, itv in enumerate(intervals) + } + starts = list(sorted(indexes.keys())) + ret = [] + for itv in intervals: + idx = bisect_left(starts, itv.end) + if idx >= len(starts): + ret.append(-1) + else: + ret.append( + indexes[starts[idx]] + ) + + return ret + + +if __name__ == "__main__": + assert Solution().findRightInterval(Interval.new([ [3,4], [2,3], [1,2] ])) == [-1, 0, 1] + assert Solution().findRightInterval(Interval.new([ [1,2] ])) == [-1] + assert Solution().findRightInterval(Interval.new([ [1,4], [2,3], [3,4] ])) == [-1, 2, -1] diff --git a/437 Path Sum III.py b/437 Path Sum III.py new file mode 100644 index 0000000..c7ad316 --- /dev/null +++ b/437 Path Sum III.py @@ -0,0 +1,88 @@ +#!/usr/bin/python3 +""" +You are given a binary tree in which each node contains an integer value. + +Find the number of paths that sum to a given value. + +The path does not need to start or end at the root or a leaf, but it must go +downwards (traveling only from parent nodes to child nodes). + +The tree has no more than 1,000 nodes and the values are in the range -1,000,000 +to 1,000,000. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +from collections import defaultdict + + +class Solution: + def __init__(self): + self.count = 0 + + def pathSum(self, root: TreeNode, target: int) -> int: + """ + The path does not need to start or end at the root or a leaf, but it + must go downwards (traveling only from parent nodes to child nodes). + + Downward path + """ + self.dfs(root, target, 0, defaultdict(int)) + return self.count + + def dfs(self, node, target, cur_sum, prefix_sum_counter): + if not node: + return + + cur_sum += node.val + # delta = target - cur_sum # error + delta = cur_sum - target + self.count += prefix_sum_counter[delta] + if delta == 0: + self.count += 1 + + prefix_sum_counter[cur_sum] += 1 + self.dfs(node.left, target, cur_sum, prefix_sum_counter) + self.dfs(node.right, target, cur_sum, prefix_sum_counter) + prefix_sum_counter[cur_sum] -= 1 + + +class SolutionComplex: + def pathSum(self, root, sum): + """ + Brute force: two dfs, O(n^2) + + Prefix sum in Tree, starting from root - O(n) + :type root: TreeNode + :type sum: int + :rtype: int + """ + count = [0] # pass as a reference + self.dfs(root, sum, 0, {}, count) + return count[0] + + def dfs(self, root, sum, cur_sum, prefix_sum, count): + """ + Root to node sum + prefix_sum: Dict[int, int], sum -> count + """ + if not root: + return + + cur_sum += root.val + # ∃ prefix_sum: cur_sum - prefix_sum = sum + diff = cur_sum - sum + if diff in prefix_sum: + count[0] += prefix_sum[diff] + if diff == 0: # trivial case + count[0] += 1 + + prefix_sum[cur_sum] = prefix_sum.get(cur_sum, 0) + 1 + self.dfs(root.left, sum, cur_sum, prefix_sum, count) + self.dfs(root.right, sum, cur_sum, prefix_sum, count) + prefix_sum[cur_sum] -= 1 # pop to save space diff --git a/438 Find All Anagrams in a String.py b/438 Find All Anagrams in a String.py new file mode 100644 index 0000000..01f1939 --- /dev/null +++ b/438 Find All Anagrams in a String.py @@ -0,0 +1,43 @@ +#!/usr/bin/python3 +""" +Given a string s and a non-empty string p, find all the start indices of p's anagrams in s. + +Strings consists of lowercase English letters only and the length of both strings s and p will not be larger than 20,100. + +The order of output does not matter. +""" +from collections import Counter + + +class Solution: + def findAnagrams(self, s, target): + """ + Brute force: O(|target|) * O(cmp) * O(|s|) + Counter: O(cmp) * O(|s|) + where O(cmp) = 26, the length of alphabeta + :type s: str + :type p: str + :rtype: List[int] + """ + ret = [] + counter_target = Counter(target) + counter_cur = Counter(s[:len(target)]) + if counter_cur == counter_target: + ret.append(0) + + for idx in range(len(target), len(s)): + head = s[idx - len(target)] + tail = s[idx] + counter_cur[tail] += 1 + counter_cur[head] -= 1 + if counter_cur[head] == 0: + del counter_cur[head] # requried for comparison + if counter_cur == counter_target: + # idx is the ending index, find the starting + ret.append(idx - len(target) + 1) + + return ret + + +if __name__ == "__main__": + assert Solution().findAnagrams("cbaebabacd", "abc") == [0, 6] diff --git a/439 Ternary Expression Parser.py b/439 Ternary Expression Parser.py new file mode 100644 index 0000000..4f49bf1 --- /dev/null +++ b/439 Ternary Expression Parser.py @@ -0,0 +1,66 @@ +#!/usr/bin/python3 +""" +Premium question +""" + + +class Solution: + def parseTernary(self, expression: str) -> str: + """ + stk from right to left parsing, including the operand and operator + """ + stk = [] + for c in reversed(expression): + if stk and stk[-1] == "?": + stk.pop() # ? + first = stk.pop() + stk.pop() # : + second = stk.pop() + if c == "T": + stk.append(first) + else: + stk.append(second) + else: + stk.append(c) + + return stk[0] + + def parseTernary_complex(self, expression: str) -> str: + """ + tokenize + recursive (dfs)? + + stk from right to left, only include the operand + + can handle multiple digit (not required) + """ + n = len(expression) + stk = [] + i = n - 1 + while i >= 0: + j = i + while j >= 0 and expression[j] not in (":", "?"): + j -= 1 + + if j < i: + stk.append(expression[j+1:i+1]) + + if expression[j] == ":": + i = j - 1 + else: # "?" + i = j - 1 + if expression[i] == "T": + a = stk.pop() + stk.pop() + stk.append(a) + i -= 1 + else: + stk.pop() + i -= 1 + + return stk[0] + + + +if __name__ == "__main__": + assert Solution().parseTernary("F?1:T?4:5") == "4" + assert Solution().parseTernary("T?T?F:5:3") == "F" diff --git a/441 Arranging Coins.py b/441 Arranging Coins.py new file mode 100644 index 0000000..a491ef6 --- /dev/null +++ b/441 Arranging Coins.py @@ -0,0 +1,26 @@ +#!/usr/bin/python3 +""" +You have a total of n coins that you want to form in a staircase shape, where every k-th row must have exactly k coins. + +Given n, find the total number of full staircase rows that can be formed. + +n is a non-negative integer and fits within the range of a 32-bit signed integer. +""" + + +class Solution: + def arrangeCoins(self, n): + """ + Solve a math equation + (1+r)r/2 <= n + :type n: int + :rtype: int + """ + return int( + (2*n + 1/4)**(1/2) - 1/2 + ) + + +if __name__ == "__main__": + assert Solution().arrangeCoins(5) == 2 + assert Solution().arrangeCoins(8) == 3 diff --git a/442 Find All Duplicates in an Array.py b/442 Find All Duplicates in an Array.py new file mode 100644 index 0000000..e2582bd --- /dev/null +++ b/442 Find All Duplicates in an Array.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +Given an array of integers, 1 ≤ a[i] ≤ n (n = size of array), some elements +appear twice and others appear once. + +Find all the elements that appear twice in this array. + +Could you do it without extra space and in O(n) runtime? + +Example: +Input: +[4,3,2,7,8,2,3,1] + +Output: +[2,3] +""" + + +class Solution: + def idx(self, a): + return a - 1 + + def findDuplicates(self, A): + """ + Normally: hashmap + Without extra space + Extra constraint: 1 ≤ a[i] ≤ n + + :type A: List[int] + :rtype: List[int] + """ + for i in range(len(A)): + t = self.idx(A[i]) + while i != t: + if A[i] == A[t]: + break + else: + A[i], A[t] = A[t], A[i] + t = self.idx(A[i]) + + ret = [] + for i in range(len(A)): + if self.idx(A[i]) != i: + ret.append(A[i]) + + return ret + + +if __name__ == "__main__": + assert set(Solution().findDuplicates([4,3,2,7,8,2,3,1])) == set([2,3]) diff --git a/443 String Compression.py b/443 String Compression.py new file mode 100644 index 0000000..74cc323 --- /dev/null +++ b/443 String Compression.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +Given an array of characters, compress it in-place. + +The length after compression must always be smaller than or equal to the original array. + +Every element of the array should be a character (not int) of length 1. + +After you are done modifying the input array in-place, return the new length of the array. + + +Follow up: +Could you solve it using only O(1) extra space? +""" + + +class Solution: + def compress(self, chars): + """ + tedious pointer manipulation + :type chars: List[str] + :rtype: int + """ + ret = 1 + s = 0 # start index of current char + for i in range(1, len(chars) + 1): + if i < len(chars) and chars[i] == chars[s]: + continue + l = i - s + if l > 1: + for digit in str(l): + chars[ret] = digit + ret += 1 + if i < len(chars): + chars[ret] = chars[i] + ret += 1 + s = i + + return ret + + def compress_error(self, chars): + """ + tedious pointer manipulation + :type chars: List[str] + :rtype: int + """ + s = 0 + for idx in range(1, len(chars) + 1): + if idx < len(chars) and chars[idx] == chars[s]: + continue + l = idx - s + if l == 1: + s = min(s + 1, len(chars) - 1) + else: + for digit in str(l): + s += 1 + chars[s] = digit + if idx < len(chars): + s += 1 + chars[s] = chars[idx] + return s + 1 + + +if __name__ == "__main__": + assert Solution().compress(["a"]) == 1 + assert Solution().compress(["a","a","b","b","c","c","c"]) == 6 + assert Solution().compress(["a","b","b","b","b","b","b","b","b","b","b","b","b"]) == 4 diff --git a/446 Arithmetic Slices II - Subsequence.py b/446 Arithmetic Slices II - Subsequence.py new file mode 100644 index 0000000..e66e08f --- /dev/null +++ b/446 Arithmetic Slices II - Subsequence.py @@ -0,0 +1,68 @@ +#!/usr/bin/python3 +""" +A sequence of number is called arithmetic if it consists of at least three +elements and if the difference between any two consecutive elements is the same. + +The function should return the number of arithmetic subsequence slices in the +array A. (Subsequence rather than slide) +""" +from collections import defaultdict + + +class Solution: + def numberOfArithmeticSlices(self, A): + """ + Subsequence, count the number, looks like dp + use defaultdict for easy dp array construction + + D[i][d] stores the number of arithmetic subsequence ending at A[i], with + delta d + + result would be + sum( + D[i][d] + if >= 3 consecutive subsequence A[i], A[j], A[k] ... + for some j, k + ) + + summing D[j][d] rather than D[i][d] since we need >= 3 subsequence and + D[i][d] contains the length 2. + + This approach cannot be extended to >= 4 subsequence + :type A: List[int] + :rtype: int + """ + ret = 0 + D = defaultdict(lambda: defaultdict(int)) + for i in range(len(A)): + for j in range(i): + d = A[i] - A[j] + D[i][d] += 1 + D[j][d] + if D[j][d] > 0: + # >= 3 subsequence with A[k], A[j], A[i] + ret += D[j][d] # not D[i][d] + + return ret + + def numberOfArithmeticSlices_error(self, A): + """ + :type A: List[int] + :rtype: int + """ + ret = 0 + D = defaultdict(lambda: defaultdict(int)) + for i in range(len(A)): + for j in range(i): + delta = A[i] - A[j] + D[i][delta] += 1 + D[j][delta] + + for j in range(i): + delta = A[i] - A[j] + if D[j][delta] > 0: + ret += D[i][delta] # counted the length 2 + + return ret + + +if __name__ == "__main__": + assert Solution().numberOfArithmeticSlices([2, 4, 6, 8, 10]) == 7 diff --git a/447 Number of Boomerangs.py b/447 Number of Boomerangs.py new file mode 100644 index 0000000..c38ae7d --- /dev/null +++ b/447 Number of Boomerangs.py @@ -0,0 +1,60 @@ +#!/usr/bin/python3 +""" +Given n points in the plane that are all pairwise distinct, a "boomerang" is a +tuple of points (i, j, k) such that the distance between i and j equals the +distance between i and k (the order of the tuple matters). + +Find the number of boomerangs. You may assume that n will be at most 500 and +coordinates of points are all in the range [-10000, 10000] (inclusive). +""" +from collections import Counter + + +class Solution: + def distance(self, a, b): + return (a[0] - b[0])**2 + (a[1] - b[1])**2 + + def numberOfBoomerangs(self, points): + """ + Reverse look up + :type points: List[List[int]] + :rtype: int + """ + ret = 0 + for i in range(len(points)): + dist_cnt = Counter() + for j in range(len(points)): + if i != j: + d = self.distance(points[i], points[j]) + dist_cnt[d] += 1 + + for v in dist_cnt.values(): + # Permutation: P v 2 + ret += v * (v - 1) + + return ret + + def numberOfBoomerangs_TLE(self, points): + """ + Reverse look up + :type points: List[List[int]] + :rtype: int + """ + ret = 0 + for i in range(len(points)): + dist_cnt = Counter() + dist_lst = [] + for j in range(len(points)): + if i != j: + d = self.distance(points[i], points[j]) + dist_lst.append(d) + dist_cnt[d] += 1 + + for d in dist_lst: + ret += (dist_cnt[d] - 1) + + return ret + + +if __name__ == "__main__": + assert Solution().numberOfBoomerangs([[0,0],[1,0],[2,0]]) == 2 diff --git a/448 Find All Numbers Disappeared in an Array.py b/448 Find All Numbers Disappeared in an Array.py new file mode 100644 index 0000000..cfc9c94 --- /dev/null +++ b/448 Find All Numbers Disappeared in an Array.py @@ -0,0 +1,37 @@ +#!/usr/bin/python3 +""" +Given an array of integers where 1 ≤ a[i] ≤ n (n = size of array), some elements appear twice and others appear once. + +Find all the elements of [1, n] inclusive that do not appear in this array. + +Could you do it without extra space and in O(n) runtime? You may assume the returned list does not count as extra space. +""" + + +class Solution: + def findDisappearedNumbers(self, A): + """ + You can use hash map with extra space O(n). + To use without extra space, notice the additional constraints that: + 1. 1 ≤ a[i] ≤ n + 2. appear twice or once + => use original array as storage with a[i] (- 1) as the index + :type A: List[int] + :rtype: List[int] + """ + for idx in range(len(A)): + while True: + target = A[idx] - 1 + if idx == target or A[idx] == A[target]: + break + A[idx], A[target] = A[target], A[idx] + + missing = [] + for idx, elm in enumerate(A): + if idx != elm - 1: + missing.append(idx + 1) + return missing + + +if __name__ == "__main__": + assert Solution().findDisappearedNumbers([4, 3, 2, 7, 8, 2, 3, 1]) == [5, 6] diff --git a/449 Serialize and Deserialize BST.py b/449 Serialize and Deserialize BST.py new file mode 100644 index 0000000..43d7a74 --- /dev/null +++ b/449 Serialize and Deserialize BST.py @@ -0,0 +1,88 @@ +""" +Serialization is the process of converting a data structure or object into a +sequence of bits so that it can be stored in a file or memory buffer, or +transmitted across a network connection link to be reconstructed later in the +same or another computer environment. + +Design an algorithm to serialize and deserialize a binary search tree. There is +no restriction on how your serialization/deserialization algorithm should work. +You just need to ensure that a binary search tree can be serialized to a string +and this string can be deserialized to the original tree structure. + +The encoded string should be as compact as possible. +""" + + +# Definition for a binary tree node. +class TreeNode(object): + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Codec: + DELIMITER = "," + + def serialize(self, root): + """Encodes a tree to a single string. + Basic binary tree serialize (BFS), see Serialize and Deserialize + Binary Tree + + The main difference is as compact as possible. No need "null", since + insertion order is specfied. + + 3 (1) + 2 (2) 5 (2) + 6 (3) # bracket () is the insertion order + + pre-order traversal keeps the insertion order + :type root: TreeNode + :rtype: str + """ + def traverse(root, ret): + if not root: + return + + ret.append(root.val) + traverse(root.left, ret) + traverse(root.right, ret) + + ret = [] + traverse(root, ret) + return self.DELIMITER.join(map(str, ret)) + + def deserialize(self, data): + """Decodes your encoded data to tree. + + Normal BST insert + :type data: str + :rtype: TreeNode + """ + if not data: + return + + lst = list(map(int, data.split(self.DELIMITER))) + root = TreeNode(lst[0]) + def insert(root, val): + # need to keep the parent + if val < root.val: + if not root.left: + root.left = TreeNode(val) + else: + insert(root.left, val) + else: + if not root.right: + root.right = TreeNode(val) + else: + insert(root.right, val) + + for a in lst[1:]: + insert(root, a) + + return root + + +# Your Codec object will be instantiated and called as such: +# codec = Codec() +# codec.deserialize(codec.serialize(root)) diff --git a/450 Delete Node in a BST.py b/450 Delete Node in a BST.py new file mode 100644 index 0000000..a87345d --- /dev/null +++ b/450 Delete Node in a BST.py @@ -0,0 +1,107 @@ +#!/usr/bin/python3 +""" +Given a root node reference of a BST and a key, delete the node with the given +key in the BST. Return the root node reference (possibly updated) of the BST. + +Basically, the deletion can be divided into two stages: + +Search for a node to remove. +If the node is found, delete the node. + +Note: Time complexity should be O(height of tree). +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def deleteNode(self, root, key): + """ + :type root: TreeNode + :type key: int + :rtype: TreeNode + """ + return self._delete(root, key) + + def _delete(self, root, key): + """ + Pop the left max or right min + Return the root to keep the parent child relationship + """ + if not root: + return + + # check before recursion because need to know parent + if key < root.val: + root.left = self._delete(root.left, key) + return root + elif key > root.val: + root.right = self._delete(root.right, key) + return root + else: + if root.left: + maxa, left = self._pop_max(root.left) + root.left = left + root.val = maxa + return root + elif root.right: + mini, right = self._pop_min(root.right) + root.right = right + root.val = mini + return root + else: + return + + def _pop_max(self, root): + if root.right: + maxa, right = self._pop_max(root.right) + root.right = right + return maxa, root + # irrevelant with root.left, BST property + else: + return root.val, root.left + + def _pop_min(self, root): + if root.left: + mini, left = self._pop_min(root.left) + root.left = left + return mini, root + # irrevelant with root.right, BST property + else: + return root.val, root.right + + def _delete_error(self, root, key): + """ + need to know the parent, keep the reference + need to handle duplicate + + Error: need to find the max of the left subtree rather than the root + """ + if not root: + return + + # check before recursion because need to know parent + if key < root.val: + root.left = self._delete(root.left, key) + return root + elif key > root.val: + root.right = self._delete(root.right, key) + return root + else: + if root.left: + root.val = root.left.val + left = self._delete(root.left, root.left.val) + root.left = left + return root + elif root.right: + root.val = root.right.val + right = self._delete(root.right, root.right.val) + root.right = right + return root + else: + return diff --git a/451 Sort Characters By Frequency.py b/451 Sort Characters By Frequency.py new file mode 100644 index 0000000..8f71318 --- /dev/null +++ b/451 Sort Characters By Frequency.py @@ -0,0 +1,35 @@ +#!/usr/bin/python3 +""" +Given a string, sort it in decreasing order based on the frequency of characters. +""" +from collections import defaultdict + + +class Solution(object): + def frequencySort(self, s): + """ + Brute force: counter, sort O(n log n) + + There is a uppper limit of the counter, thus bucket sort possible + :type s: str + :rtype: str + """ + counter = defaultdict(int) + for c in s: + counter[c] += 1 + + bucket = {count: [] for count in range(1, len(s)+1)} + for k, v in counter.items(): + bucket[v].append(k) + + ret = [] + for count in reversed(range(1, len(s) + 1)): + if bucket[count]: + for c in bucket[count]: + ret.append(c * count) + + return "".join(ret) + + +if __name__ == "__main__": + assert Solution().frequencySort("tree") == "eetr" diff --git a/452 Minimum Number of Arrows to Burst Balloons.py b/452 Minimum Number of Arrows to Burst Balloons.py new file mode 100644 index 0000000..fee91d0 --- /dev/null +++ b/452 Minimum Number of Arrows to Burst Balloons.py @@ -0,0 +1,69 @@ +#!/usr/bin/python3 +""" +There are a number of spherical balloons spread in two-dimensional space. For +each balloon, provided input is the start and end coordinates of the horizontal +diameter. Since it's horizontal, y-coordinates don't matter and hence the +x-coordinates of start and end of the diameter suffice. Start is always smaller +than end. There will be at most 104 balloons. + +An arrow can be shot up exactly vertically from different points along the +x-axis. A balloon with xstart and xend bursts by an arrow shot at x if +x_start ≤ x ≤ x_end. There is no limit to the number of arrows that can be shot. +An arrow once shot keeps travelling up infinitely. The problem is to find the +minimum number of arrows that must be shot to burst all balloons. + +Example: + +Input: +[[10,16], [2,8], [1,6], [7,12]] + +Output: +2 + +Explanation: +One way is to shoot one arrow for example at x = 6 (bursting the balloons [2,8] +and [1,6]) and another arrow at x = 11 (bursting the other two balloons). +""" +import heapq + + +class Balloon: + def __init__(self, s, e): + self.s = s + self.e = e + + def __lt__(self, other): + # __cmp__ removed in py3 + return self.e < other.e + + +class Solution: + def findMinArrowShots(self, points): + """ + greedy shot since if two balloon no overlap, then must shot separately + + heap: min, insert by s, pop by e + Like the maximum overlapping interval + + :type points: List[List[int]] + :rtype: int + """ + ret = 0 + points.sort(key=lambda x: x[0]) + heap = [] + for point in points: + s, e = point + if heap and heap[0].e < s: + ret += 1 + heap = [] + + heapq.heappush(heap, Balloon(s, e)) + + if heap: + ret += 1 + + return ret + + +if __name__ == "__main__": + assert Solution().findMinArrowShots([[10,16], [2,8], [1,6], [7,12]]) == 2 diff --git a/453 Minimum Moves to Equal Array Elements.py b/453 Minimum Moves to Equal Array Elements.py new file mode 100644 index 0000000..a15ca5e --- /dev/null +++ b/453 Minimum Moves to Equal Array Elements.py @@ -0,0 +1,24 @@ +#!/usr/bin/python3 +""" +Given a non-empty integer array of size n, find the minimum number of moves +required to make all array elements equal, where a move is incrementing n - 1 +elements by 1. +""" + + +class Solution: + def minMoves(self, nums): + """ + List out, find the pattern + for every operation, the max number does not change, then bring the min + number 1 step closer to the max. + + :type nums: List[int] + :rtype: int + """ + mini = min(nums) + return sum(map(lambda e: e - mini, nums)) + + +if __name__ == "__main__": + assert Solution().minMoves([1, 2, 3]) == 3 diff --git a/454 4Sum II.py b/454 4Sum II.py new file mode 100644 index 0000000..307190f --- /dev/null +++ b/454 4Sum II.py @@ -0,0 +1,68 @@ +#!/usr/bin/python3 +""" +Given four lists A, B, C, D of integer values, compute how many tuples (i, j, +k, l) there are such that A[i] + B[j] + C[k] + D[l] is zero. + +To make problem a bit easier, all A, B, C, D have same length of N where +0 ≤ N ≤ 500. All integers are in the range of -2^28 to 2^28 - 1 and the result +is guaranteed to be at most 2^31 - 1. + +Example: + +Input: +A = [ 1, 2] +B = [-2,-1] +C = [-1, 2] +D = [ 0, 2] + +Output: +2 + +Explanation: +The two tuples are: +1. (0, 0, 0, 1) -> A[0] + B[0] + C[0] + D[1] = 1 + (-2) + (-1) + 2 = 0 +2. (1, 1, 0, 0) -> A[1] + B[1] + C[0] + D[0] = 2 + (-1) + (-1) + 0 = 0 +""" +from collections import defaultdict + + +class Solution: + def fourSumCount(self, A, B, C, D): + """ + Brute force with map: O(N^3) + + O(N^3) is pretty large, O(N^2) or O(N log N)? + + O(N^2) to sum cartesian product (A, B) to construct index + similar to C, D. + + Then index loop up + :type A: List[int] + :type B: List[int] + :type C: List[int] + :type D: List[int] + :rtype: int + """ + N = len(A) + AB = defaultdict(int) + CD = defaultdict(int) + for i in range(N): + for j in range(N): + AB[A[i] + B[j]] += 1 + CD[C[i] + D[j]] += 1 + + ret = 0 + # O(N^2) + for gross, count in AB.items(): + target = 0 - gross + ret += count * CD[target] + + return ret + + +if __name__ == "__main__": + A = [ 1, 2] + B = [-2,-1] + C = [-1, 2] + D = [ 0, 2] + assert Solution().fourSumCount(A, B, C, D) == 2 diff --git a/455 Assign Cookies.py b/455 Assign Cookies.py new file mode 100644 index 0000000..39f9908 --- /dev/null +++ b/455 Assign Cookies.py @@ -0,0 +1,42 @@ +#!/usr/bin/python3 +""" +Assume you are an awesome parent and want to give your children some cookies. +But, you should give each child at most one cookie. Each child i has a greed +factor gi, which is the minimum size of a cookie that the child will be content +with; and each cookie j has a size sj. If sj >= gi, we can assign the cookie j +to the child i, and the child i will be content. Your goal is to maximize the +number of your content children and output the maximum number. + +Note: +You may assume the greed factor is always positive. +You cannot assign more than one cookie to one child. +""" + + +class Solution: + def findContentChildren(self, g, s): + """ + Greedy + + :type g: List[int] + :type s: List[int] + :rtype: int + """ + g.sort() + s.sort() + ret = 0 + i = 0 + j = 0 + while i < len(g) and j < len(s): + if g[i] <= s[j]: + ret += 1 + i += 1 + j += 1 + else: + j += 1 + + return ret + + +if __name__ == "__main__": + assert Solution().findContentChildren([10,9,8,7], [5,6,7,8]) == 2 diff --git a/456 132 Pattern.py b/456 132 Pattern.py new file mode 100644 index 0000000..842d52f --- /dev/null +++ b/456 132 Pattern.py @@ -0,0 +1,72 @@ +#!/usr/bin/python3 +""" +Given a sequence of n integers a1, a2, ..., an, a 132 pattern is a subsequence +ai, aj, ak such that i < j < k and ai < ak < aj. Design an algorithm that takes +a list of n numbers as input and checks whether there is a 132 pattern in the +list. + +Note: n will be less than 15,000. +""" + + +class Solution: + def find132pattern(self, nums): + """ + Brute force i, j, k O(n^3) + + Optimize: I only need to keep the max number for the middle. O(N^2) + + Need better optimization? + I need to keep both the min and max number for A[:i] when scanning A[i] + min must be at left of max + + When scanning A[i], we need a list to keep both the min and max interval + [min, max]. The list maintains intervals that end at A[i-1] and start at + the min(A[:i-1]) + 0. The max is not increasing, thus can only keep A[i-1] + 1. F(i) = min(A[:i-1]) is strictly non-increasing (softly decreasing) + 2. We don't need to keep any internal that interval.end <= A[i] + 3. The list can be replaced with stack + + O(N) since every number enters and pops the stack once + + :type nums: List[int] + :rtype: bool + """ + stack = [] # List[Interval] + mini = float('Inf') + for v in nums: + while stack and stack[-1][1] <= v: # error when < (e.g. [-2, 1, 1]) + stack.pop() + if stack and stack[-1][0] < v: + return True + mini = min(mini, v) + stack.append((mini, v)) + + return False + + + def find132pattern_TLE(self, nums): + """ + Brute force i, j, k O(n^3) + + Optimize: you only need to keep the max number for the middle. O(N^2) + :type nums: List[int] + :rtype: bool + """ + for i in range(len(nums)): + maxa = nums[i] + for j in range(i + 1, len(nums)): + if nums[j] > nums[i]: + if nums[j] < maxa: + return True + maxa = max(maxa, nums[j]) + + return False + + +if __name__ == "__main__": + assert Solution().find132pattern([1, 2, 3, 4]) == False + assert Solution().find132pattern([3, 1, 4, 2]) == True + assert Solution().find132pattern([-1, 3, 2, 0]) == True + assert Solution().find132pattern([-2, 1, 1]) == True diff --git a/459 Repeated Substring Pattern.py b/459 Repeated Substring Pattern.py new file mode 100644 index 0000000..6b0bde1 --- /dev/null +++ b/459 Repeated Substring Pattern.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +Given a non-empty string check if it can be constructed by taking a substring +of it and appending multiple copies of the substring together. You may assume +the given string consists of lowercase English letters only and its length will +not exceed 10000. +""" + + +class Solution: + def repeatedSubstringPattern(self, s): + """ + The start of the substring is always 0, then incr the ending index e + until n/2 where n = len(s) + Brute force: O(n/2) * O(n) + + test substring using KMP is O(|target|) + + if s is composed of n substrings p, then s2 = s + s should contain + 2n * p. + + Destroying the first and the last character leads to at + least (2n - 2) * p left. + + n >= 2 + 2n - 2 >= n + S1[1:-1] should still contain S + :type s: str + :rtype: bool + """ + return s in (s + s)[1:-1] + + def repeatedSubstringPattern_error(self, s): + """ + Two pointers algorithm. The start of the substring is always 0 + :type s: str + :rtype: bool + """ + if not s: + return False + p1 = 0 + e = 1 # ending s[0:e] is the substring + p2 = 1 + while p2 < len(s): + if s[p1] == s[p2]: + p1 += 1 + if p1 == e: + p1 = 0 + else: + p1 = 0 + e = p2 + 1 + + p2 += 1 + + return p2 == len(s) and p1 == 0 and e != len(s) + + +if __name__ == "__main__": + assert Solution().repeatedSubstringPattern("abab") == True + assert Solution().repeatedSubstringPattern("abcd") == False + assert Solution().repeatedSubstringPattern("abacababacab") == True diff --git a/460 LFU Cache.py b/460 LFU Cache.py new file mode 100644 index 0000000..02bca02 --- /dev/null +++ b/460 LFU Cache.py @@ -0,0 +1,96 @@ +#!/usr/bin/python3 +""" +Design and implement a data structure for Least Frequently Used (LFU) cache. It +should support the following operations: get and put. + +get(key) - Get the value (will always be positive) of the key if the key exists +in the cache, otherwise return -1. +put(key, value) - Set or insert the value if the key is not already present. +When the cache reaches its capacity, it should invalidate the least frequently +used item before inserting a new item. For the purpose of this problem, when +there is a tie (i.e., two or more keys that have the same frequency), the least +recently used key would be evicted. + +Follow up: +Could you do both operations in O(1) time complexity? + +Example: + +LFUCache cache = new LFUCache( 2 /* capacity */ ); + +cache.put(1, 1); +cache.put(2, 2); +cache.get(1); // returns 1 +cache.put(3, 3); // evicts key 2 +cache.get(2); // returns -1 (not found) +cache.get(3); // returns 3. +cache.put(4, 4); // evicts key 1. +cache.get(1); // returns -1 (not found) +cache.get(3); // returns 3 +cache.get(4); // returns 4 +""" +from collections import defaultdict, OrderedDict +DUMMY = None + + +class LFUCache: + + def __init__(self, capacity: int): + """ + Need priority queue (pq) to keep contract of frequency + + LRU: doubly linked list and map + Sift up and sift down? + + Ordereded Dict + map: key -> value + map: key -> frequency + map: frequency -> OrderededDict[keys] + + min count is +1 + """ + self.cap = capacity + self.values = {} + self.freqs = defaultdict(int) + self.keys = defaultdict(OrderedDict) + self.mini = -1 # mini frequency + + def get(self, key: int) -> int: + if key in self.values: + val = self.values[key] + freq_org = self.freqs[key] + self.freqs[key] += 1 + del self.keys[freq_org][key] + self.keys[freq_org + 1][key] = DUMMY # dummy + + if freq_org == self.mini and len(self.keys[self.mini]) == 0: + self.mini = freq_org + 1 + + return val + else: + return - 1 + + def put(self, key: int, value: int) -> None: + if self.cap == 0: # trivial + return + + if key in self.values: + self.values[key] = value + self.get(key) # update + else: + if len(self.values) >= self.cap: + evit_key, _ = self.keys[self.mini].popitem(last=False) # least recent is at head + del self.values[evit_key] + del self.freqs[evit_key] + + self.values[key] = value + self.freqs[key] = 0 + self.keys[0][key] = DUMMY + self.get(key) # update + self.mini = 1 + + +# Your LFUCache object will be instantiated and called as such: +# obj = LFUCache(capacity) +# param_1 = obj.get(key) +# obj.put(key,value) diff --git a/461 Hamming Distance.py b/461 Hamming Distance.py new file mode 100644 index 0000000..98ec967 --- /dev/null +++ b/461 Hamming Distance.py @@ -0,0 +1,31 @@ +#!/usr/bin/python3 +""" +The Hamming distance between two integers is the number of positions at which +the corresponding bits are different. + +Given two integers x and y, calculate the Hamming distance. + +Note: +0 ≤ x, y < 2^31. +""" + + +class Solution: + def hammingDistance(self, x, y): + """ + :type x: int + :type y: int + :rtype: int + """ + diff = x ^ y + ret = 0 + while diff: + ret += diff & 1 + diff >>= 1 + + return ret + + +if __name__ == "__main__": + assert Solution().hammingDistance(3, 1) == 1 + assert Solution().hammingDistance(1, 4) == 2 diff --git a/462 Minimum Moves to Equal Array Elements II.py b/462 Minimum Moves to Equal Array Elements II.py new file mode 100644 index 0000000..5218159 --- /dev/null +++ b/462 Minimum Moves to Equal Array Elements II.py @@ -0,0 +1,85 @@ +#!/usr/bin/python3 +""" +Given a non-empty integer array, find the minimum number of moves required to +make all array elements equal, where a move is incrementing a selected element +by 1 or decrementing a selected element by 1. + +You may assume the array's length is at most 10,000. + +Example: + +Input: +[1,2,3] + +Output: +2 + +Explanation: +Only two moves are needed (remember each move increments or decrements one +element): + +[1,2,3] => [2,2,3] => [2,2,2] +""" + + +class Solution: + def pivot(self, A, lo, hi): + pivot = lo + closed = pivot # closed == pivot, means no closed set + for i in range(lo + 1, hi): + if A[i] < A[pivot]: + closed += 1 + A[closed], A[i] = A[i], A[closed] + + A[closed], A[pivot] = A[pivot], A[closed] + return closed # the pivot index + + def quick_select(self, nums, lo, hi, k): + """find k-th (0-indexed)""" + pivot = self.pivot(nums, lo, hi) + if pivot == k: + return nums[pivot] + elif pivot > k: + return self.quick_select(nums, lo, pivot, k) + else: + return self.quick_select(nums, pivot + 1, hi, k) + + + def minMoves2(self, nums): + """ + find the median rather than the average + + No matter which middle point you pick, the total running length for min + and max is the same. |-------|-----| + + So, we can effectively reduce the problem size from n to n-2 by + discarding min and max points. + :type nums: List[int] + :rtype: int + """ + n = len(nums) + median = self.quick_select(nums, 0, n, n//2) + return sum(map(lambda x: abs(x - median), nums)) + + def find_median(self, nums): + n = len(nums) + nums.sort() + return nums[n//2] + + def minMoves2_error(self, nums): + """ + move to the average, since incr and decr cost is 1 + + error at [1, 0, 0, 8, 6] + + :type nums: List[int] + :rtype: int + """ + n = len(nums) + avg = round(sum(nums) / n) + return sum(map(lambda x: abs(x - avg), nums)) + + +if __name__ == "__main__": + assert Solution().minMoves2([1,2,3]) == 2 + assert Solution().minMoves2([1,0,0,8,6]) == 14 diff --git a/463 Island Perimeter.py b/463 Island Perimeter.py new file mode 100644 index 0000000..903dee0 --- /dev/null +++ b/463 Island Perimeter.py @@ -0,0 +1,52 @@ +#!/usr/bin/python3 +""" +You are given a map in form of a two-dimensional integer grid where 1 represents +land and 0 represents water. + +Grid cells are connected horizontally/vertically (not diagonally). The grid is +completely surrounded by water, and there is exactly one island (i.e., one or +more connected land cells). + +The island doesn't have "lakes" (water inside that isn't connected to the water +around the island). One cell is a square with side length 1. The grid is +rectangular, width and height don't exceed 100. Determine the perimeter of the island. +""" +class Solution: + dirs = [(0, -1), (-1, 0), (0, 1), (1, 0)] + + def islandPerimeter(self, grid): + """ + There is constraint that one concrete island + + check surrounding: O(4) * O(n) = O(n) + count side for land + :type grid: List[List[int]] + :rtype: int + """ + ret = 0 + if not grid: + return ret + R = len(grid) + C = len(grid[0]) + for r0 in range(R): + for c0 in range(C): + if grid[r0][c0] == 1: + for dr, dc in self.dirs: + r = r0 + dr + c = c0 + dc + if r < 0 or r >= R or c < 0 or c >= C: + ret += 1 + elif grid[r][c] == 0: + ret += 1 + + return ret + + +if __name__ == "__main__": + grid = [ + [0,1,0,0], + [1,1,1,0], + [0,1,0,0], + [1,1,0,0], + ] + assert Solution().islandPerimeter(grid) == 16 diff --git a/464 Can I Win.py b/464 Can I Win.py new file mode 100644 index 0000000..6f612ee --- /dev/null +++ b/464 Can I Win.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +In the "100 game," two players take turns adding, to a running total, any +integer from 1..10. The player who first causes the running total to reach or +exceed 100 wins. + +What if we change the game so that players cannot re-use integers? + +For example, two players might take turns drawing from a common pool of numbers +of 1..15 without replacement until they reach a total >= 100. + +Given an integer maxChoosableInteger and another integer desiredTotal, determine +if the first player to move can force a win, assuming both players play +optimally. + +You can always assume that maxChoosableInteger will not be larger than 20 and +desiredTotal will not be larger than 300. +""" + + +class Solution: + def canIWin(self, maxChoosableInteger, desiredTotal): + """ + can p win? + F^p_{total, choice_set - i} = not any( + F^p'_{total - A[j] - A[i], choice_set - j - i} + for j + ) + + :type maxChoosableInteger: int + :type desiredTotal: int + :rtype: bool + """ + cache = {} + # set is not hashable while frozenset is + choices = frozenset([choice for choice in range(1, maxChoosableInteger + 1)]) + return self._can_win(desiredTotal, choices, sum(choices), cache) + + def _can_win(self, total, choices, gross,cache): + if (total, choices) in cache: + return cache[(total, choices)] + + ret = False + if max(choices) >= total: + ret = True + + elif gross < total: + ret = False + else: + for choice in choices: + if not self._can_win( + total - choice, + choices - set([choice]), + gross - choice, + cache + ): + ret = True + break + + cache[(total, choices)] = ret + return ret + + +if __name__ == "__main__": + assert Solution().canIWin(10, 11) == False + assert Solution().canIWin(10, 0) == True + assert Solution().canIWin(13, 11) == True diff --git a/467 Unique Substrings in Wraparound String.py b/467 Unique Substrings in Wraparound String.py new file mode 100644 index 0000000..537ef02 --- /dev/null +++ b/467 Unique Substrings in Wraparound String.py @@ -0,0 +1,93 @@ +#!/usr/bin/python3 +""" +Consider the string s to be the infinite wraparound string of +"abcdefghijklmnopqrstuvwxyz", so s will look like this: +"...zabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcd....". + +Now we have another string p. Your job is to find out how many unique non-empty +substrings of p are present in s. In particular, your input is the string p and +you need to output the number of different non-empty substrings of p in the +string s. + +Note: p consists of only lowercase English letters and the size of p might be +over 10000. + +Example 1: +Input: "a" +Output: 1 + +Explanation: Only the substring "a" of string "a" is in the string s. +Example 2: +Input: "cac" +Output: 2 +Explanation: There are two substrings "a", "c" of string "cac" in the string s. +Example 3: +Input: "zab" +Output: 6 +Explanation: There are six substrings "z", "a", "b", "za", "ab", "zab" of string +"zab" in the string s. +""" + + +class Solution: + def findSubstringInWraproundString(self, p): + """ + wrap around: +1 (delta=1) + "zab": 3 + 2 + 1 + "zabc": 4 + 3 + 2 + 1 + To de-dpulicate, change the way of counting - count backward at the + ending char. + "zabc": + "z": "z" : 1 + "a": "a", "za": 2 + "zab": "b", "ab", "zab": 3 + "zabc": "c", ...: 4 + + p.s. possible to count forward but tedious + :type p: str + :rtype: int + """ + counter = { + c: 1 + for c in p + } + l = 1 + for i in range(1, len(p)): + if (ord(p[i]) - ord(p[i-1])) % 26 == 1: # (0 - 25) % 26 == 1 + l += 1 + else: + l = 1 + counter[p[i]] = max(counter[p[i]], l) + + return sum(counter.values()) + + def findSubstringInWraproundString_error(self, p): + """ + wrap around: +1 (delta=1) + "zab": 3 + 2 + 1 + "zabc": 4 + 3 + 2 + 1 + :type p: str + :rtype: int + """ + if not p: + return 0 + + ret = set() + i = 0 + while i < len(p): + cur = [p[i]] + j = i + 1 + while j < len(p) and (ord(p[j]) - ord(cur[-1]) == 1 or p[j] == "a" and cur[-1] == "z"): + cur.append(p[j]) + j += 1 + ret.add("".join(cur)) + i = j + + return sum(map(lambda x: (len(x) + 1) * len(x) // 2, ret)) + + +if __name__ == "__main__": + assert Solution().findSubstringInWraproundString("a") == 1 + assert Solution().findSubstringInWraproundString("cac") == 2 + assert Solution().findSubstringInWraproundString("zab") == 6 + assert Solution().findSubstringInWraproundString("zaba") == 6 diff --git a/470 Implement Rand10() Using Rand7().py b/470 Implement Rand10() Using Rand7().py new file mode 100644 index 0000000..9b2f8fc --- /dev/null +++ b/470 Implement Rand10() Using Rand7().py @@ -0,0 +1,30 @@ +#!/usr/bin/python3 +""" +Given a function rand7 which generates a uniform random integer in the range 1 +to 7, write a function rand10 which generates a uniform random integer in the +range 1 to 10. + +Do NOT use system's Math.random(). +""" + + +# The rand7() API is already defined for you. +def rand7(): + return 0 + + +class Solution: + def rand10(self): + """ + generate 7 twice, (rv1, rv2), 49 combination + assign 40 combinations for the 1 to 10 respectively + + 7-ary system + :rtype: int + """ + while True: + rv1 = rand7() + rv2 = rand7() + s = (rv1 - 1) * 7 + (rv2 - 1) # make it start from 0 + if s < 40: # s \in [0, 40) + return s % 10 + 1 # since I make it start from 0 diff --git a/472 Concatenated Words.py b/472 Concatenated Words.py new file mode 100644 index 0000000..fe77022 --- /dev/null +++ b/472 Concatenated Words.py @@ -0,0 +1,112 @@ +#!/usr/bin/python3 +""" +Given a list of words (without duplicates), please write a program that returns +all concatenated words in the given list of words. +A concatenated word is defined as a string that is comprised entirely of at +least two shorter words in the given array. + +Example: +Input: ["cat","cats","catsdogcats","dog","dogcatsdog","hippopotamuses","rat", +"ratcatdogcat"] + +Output: ["catsdogcats","dogcatsdog","ratcatdogcat"] + +Explanation: "catsdogcats" can be concatenated by "cats", "dog" and "cats"; + "dogcatsdog" can be concatenated by "dog", "cats" and "dog"; +"ratcatdogcat" can be concatenated by "rat", "cat", "dog" and "cat". + +Note: +The number of elements of the given array will not exceed 10,000 +The length sum of elements in the given array will not exceed 600,000. +All the input string will only include lower case letters. +The returned elements order does not matter. +""" +from typing import List +from collections import defaultdict + + +class Solution: + def __init__(self): + TrieNode = lambda: defaultdict(TrieNode) # not defaultdict(lambda: TrieNode) + self.root = TrieNode() # root of tire + + def findAllConcatenatedWordsInADict(self, words: List[str]) -> List[str]: + """ + Trie + DFS + """ + words.sort(key=len) + ret = [] + for w in words: + if self.can_concat(w, 0): + ret.append(w) + + cur = self.root + for c in w: + cur = cur[c] + cur["end"] = True + + return ret + + def can_concat(self, word, lo): + if not word: + return False + + k = len(word) + if lo >= k: + return True + + cur = self.root + for i in range(lo, k): + cur = cur[word[i]] + if cur.get("end", False) and self.can_concat(word, i + 1): + return True + + return False + + +class SolutionTLE: + def findAllConcatenatedWordsInADict(self, words: List[str]) -> List[str]: + """ + Trie check cannot be greedy: cat sdog vs cats dog + + Sort + Trie dfs + What is the complexity? + + Word break DP + for a specific word + F[i] means word[:i] can be formed using shorter words + + complexity + O(n) * O(k^2) * O(k) + n words * get F * compare words + + Hard question is solving a collections of medium problems + """ + ret = [] + # words.sort() # sorting is unnecessary + visited = set(words) + for w in words: + if self.can_concat(w, visited): + ret.append(w) + + return ret + + def can_concat(self, w, visited): + if not w: + return False + + k = len(w) + F = [False for _ in range(k + 1)] + F[0] = True + for i in range(1, k + 1): + for j in range(i): + if j == 0 and i == k: + continue # word itself + if F[j] and w[j:i] in visited: + F[i] = True + + return F[k] + + +if __name__ == "__main__": + assert Solution().findAllConcatenatedWordsInADict(["cat","cats","catsdogcats","dog","dogcatsdog","hippopotamuses","rat","ratcatdogcat"]) == ["catsdogcats","dogcatsdog","ratcatdogcat"] diff --git a/473 Matchsticks to Square.py b/473 Matchsticks to Square.py new file mode 100644 index 0000000..792c5d5 --- /dev/null +++ b/473 Matchsticks to Square.py @@ -0,0 +1,63 @@ +#!/usr/bin/python3 +""" +Remember the story of Little Match Girl? By now, you know exactly what +matchsticks the little match girl has, please find out a way you can make one +square by using up all those matchsticks. You should not break any stick, but +you can link them up, and each matchstick must be used exactly one time. + +Your input will be several matchsticks the girl has, represented with their +stick length. Your output will either be true or false, to represent whether +you could make one square using all the matchsticks the little match girl has. + +Example 1: +Input: [1,1,2,2,2] +Output: true + +Explanation: You can form a square with length 2, one side of the square came +two sticks with length 1. +Example 2: +Input: [3,3,3,3,4] +Output: false + +Explanation: You cannot find a way to form a square with all the matchsticks. +""" + + +class Solution: + def makesquare(self, nums): + """ + need to use up all the stics + greedily fit the largest first - error, consider [5, 4, 2, 2, 2, 2, 3] + need to dfs + + :type nums: List[int] + :rtype: bool + """ + if not nums: + return False + + square = [0 for _ in range(4)] + l = sum(nums) // 4 + if sum(nums) % 4 != 0: + return False + + nums.sort(reverse=True) + return self.dfs(nums, 0, l, square) + + def dfs(self, nums, i, l, square): + if i >= len(nums): + return True + + for j in range(len(square)): + if nums[i] + square[j] <= l: + square[j] += nums[i] + if self.dfs(nums, i + 1, l, square): + return True + square[j] -= nums[i] + + return False + + +if __name__ == "__main__": + assert Solution().makesquare([1,1,2,2,2]) == True + assert Solution().makesquare([3,3,3,3,4]) == False diff --git a/474 Ones and Zeroes.py b/474 Ones and Zeroes.py new file mode 100644 index 0000000..a15a4bf --- /dev/null +++ b/474 Ones and Zeroes.py @@ -0,0 +1,177 @@ +#!/usr/bin/python3 +""" +In the computer world, use restricted resource you have to generate maximum +benefit is what we always want to pursue. + +For now, suppose you are a dominator of m 0s and n 1s respectively. On the other +hand, there is an array with strings consisting of only 0s and 1s. + +Now your task is to find the maximum number of strings that you can form with +given m 0s and n 1s. Each 0 and 1 can be used at most once. + +Note: +The given numbers of 0s and 1s will both not exceed 100 +The size of given string array won't exceed 600. +Example 1: +Input: Array = {"10", "0001", "111001", "1", "0"}, m = 5, n = 3 +Output: 4 + +Explanation: This are totally 4 strings can be formed by the using of 5 0s and +3 1s, which are “10,”0001”,”1”,”0” +Example 2: +Input: Array = {"10", "0", "1"}, m = 1, n = 1 +Output: 2 + +Explanation: You could form "10", but then you'd have nothing left. Better form +"0" and "1". +""" +from collections import Counter + + +class Solution: + def findMaxForm(self, strs, m, n): + """ + 0-1 knapsack + let F[p][q][i] be the max end at A[i], with p 0's and q 1's remaining + F[p][q][i] = max(F[p'][q'][i-1] + 1, F[p][q][i-1]) + + To save space, drop i + + :type strs: List[str] + :type m: int + :type n: int + :rtype: int + """ + if not strs: + return 0 + + F = [[0 for _ in range(n + 1)] for _ in range(m + 1)] + z, o = self.count(strs[0]) + for i in range(m+1): + for j in range(n+1): + if i + z<= m and j + o <= n: + F[i][j] = 1 + + for e in range(1, len(strs)): + z, o = self.count(strs[e]) + for i in range(m+1): + for j in range(n+1): + if i + z <= m and j + o <= n: + F[i][j] = max( + F[i][j], + F[i + z][j + o] + 1 + ) + + ret = max( + F[i][j] + for i in range(m + 1) + for j in range(n + 1) + ) + return ret + + def count(self, s): + z, o = 0, 0 + for e in s: + if e == "0": + z += 1 + else: + o += 1 + + return z, o + + def findMaxForm_TLE(self, strs, m, n): + """ + 0-1 knapsack + let F[p][q][i] be the max end at A[i], with p 0's and q 1's + F[p][q][i] = max(F[p'][q'][i-1] + 1, F[p][q][i-1]) + + :type strs: List[str] + :type m: int + :type n: int + :rtype: int + """ + if not strs: + return 0 + + F = [[[0 for _ in range(len(strs))] for _ in range(n + 1)] for _ in range(m + 1)] + count = Counter(strs[0]) + for i in range(m+1): + for j in range(n+1): + if i + count["0"] <= m and j + count["1"] <= n: + F[i][j][0] = 1 + + for e in range(1, len(strs)): + count = Counter(strs[e]) + for i in range(m+1): + for j in range(n+1): + if i + count["0"] <= m and j + count["1"] <= n: + F[i][j][e] = F[i + count["0"]][j + count["1"]][e-1] + 1 + F[i][j][e] = max(F[i][j][e], F[i][j][e-1]) + + ret = max( + F[i][j][-1] + for i in range(m + 1) + for j in range(n + 1) + ) + return ret + + def findMaxForm_error(self, strs, m, n): + """ + 0-1 knapsack + let F[p][q][i] be the max end at A[i], with p 0's and q 1's + F[p][q][i] = max(F[p'][q'][i-1] + 1, F[p][q][i-1]) + + :type strs: List[str] + :type m: int + :type n: int + :rtype: int + """ + if not strs: + return 0 + + F = [[[0 for _ in range(len(strs))] for _ in range(n + 1)] for _ in range(m + 1)] + count = Counter(strs[0]) + if count["0"] <= m and count["1"] <= n: + F[m - count["0"]][n - count["1"]][0] += 1 + + for e in range(1, len(strs)): + count = Counter(strs[e]) + for i in range(m+1): + for j in range(n+1): + if count["0"] <= i and count["1"] <= j: + F[i - count["0"]][j - count["1"]][e] = F[i][j][e-1] + 1 + else: + F[i][j][e] = F[i][j][e-1] + + ret = max( + F[i][j][-1] + for i in range(m + 1) + for j in range(n + 1) + ) + return ret + + def findMaxForm_error(self, strs, m, n): + """ + reward is 1 regarless of length, then greedy - error + + :type strs: List[str] + :type m: int + :type n: int + :rtype: int + """ + strs.sort(key=len) + ret = 0 + for a in strs: + count = Counter(a) + if count["0"] <= m and count["1"] <= n: + ret += 1 + m -= count["0"] + n -= count["1"] + + return ret + + +if __name__ == "__main__": + assert Solution().findMaxForm(["10", "0001", "111001", "1", "0"], 5, 3) == 4 + assert Solution().findMaxForm(["10", "0", "1"], 1, 1) == 2 + assert Solution().findMaxForm(["111", "1000", "1000", "1000"], 9, 3) == 3 diff --git a/475 Heaters.py b/475 Heaters.py new file mode 100644 index 0000000..12ed40d --- /dev/null +++ b/475 Heaters.py @@ -0,0 +1,68 @@ +#!/usr/bin/python3 +""" +Winter is coming! Your first job during the contest is to design a standard +heater with fixed warm radius to warm all the houses. + +Now, you are given positions of houses and heaters on a horizontal line, find +out minimum radius of heaters so that all houses could be covered by those +heaters. + +So, your input will be the positions of houses and heaters seperately, and your +expected output will be the minimum radius standard of heaters. + +Note: +Numbers of houses and heaters you are given are non-negative and will not exceed 25000. +Positions of houses and heaters you are given are non-negative and will not exceed 10^9. +As long as a house is in the heaters' warm radius range, it can be warmed. +All the heaters follow your radius standard and the warm radius will the same. +""" +import bisect + + +class Solution: + def findRadius(self, houses, heaters): + """ + check the responsibility + use bisect + :type houses: List[int] + :type heaters: List[int] + :rtype: int + """ + houses.sort() + heaters.sort() + r = 0 + i = 0 + for h in houses: + i = bisect.bisect(heaters, h) # insertion point + left = max(0, i - 1) + right = min(len(heaters) - 1, i) + r_cur = min(abs(heaters[left] - h), abs(heaters[right] - h)) + r = max(r, r_cur) + + return r + + def findRadius_naive(self, houses, heaters): + """ + check the responsibility + :type houses: List[int] + :type heaters: List[int] + :rtype: int + """ + houses.sort() + heaters.sort() + heaters.append(float('inf')) + r = 0 + i = 0 + for h in houses: + # possible bisect + while h > (heaters[i] + heaters[i+1]) / 2: + # find which heater is responsible for the house + i += 1 + + r = max(r, abs(heaters[i] - h)) + + return r + + +if __name__ == "__main__": + assert Solution().findRadius([1,2,3,4], [1,4]) == 1 diff --git a/476 Number Complement.py b/476 Number Complement.py new file mode 100644 index 0000000..5e0db3f --- /dev/null +++ b/476 Number Complement.py @@ -0,0 +1,27 @@ +#!/usr/bin/python3 +""" +Given a positive integer, output its complement number. The complement strategy +is to flip the bits of its binary representation. + +Note: +The given integer is guaranteed to fit within the range of a 32-bit signed integer. +You could assume no leading zero bit in the integer’s binary representation. +""" + + +class Solution: + def findComplement(self, num): + """ + :type num: int + :rtype: int + """ + msb = 0 + while num >> msb: + msb += 1 + + mask = (1 << msb) - 1 + return mask & ~num + + +if __name__ == "__main__": + assert Solution().findComplement(5) == 2 diff --git a/477 Total Hamming Distance.py b/477 Total Hamming Distance.py new file mode 100644 index 0000000..371938e --- /dev/null +++ b/477 Total Hamming Distance.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +The Hamming distance between two integers is the number of positions at which +the corresponding bits are different. + +Now your job is to find the total Hamming distance between all pairs of the +given numbers. + +Example: +Input: 4, 14, 2 + +Output: 6 + +Explanation: In binary representation, the 4 is 0100, 14 is 1110, and 2 is 0010 +(just +showing the four bits relevant in this case). So the answer will be: +HammingDistance(4, 14) + HammingDistance(4, 2) + HammingDistance(14, 2) += 2 + 2 + 2 = 6. +Note: +Elements of the given array are in the range of 0 to 10^9 +Length of the array will not exceed 10^4. +""" + + +class Solution: + def totalHammingDistance(self, nums): + """ + Brute force, check every combination O(n^2 * b) + + check bit by bit + For each bit, the distance for all is #0 * #1 + O(n * b) + + :type nums: List[int] + :rtype: int + """ + ret = 0 + while any(nums): # any not 0 + z, o = 0, 0 + for i in range(len(nums)): + if nums[i] & 1 == 0: + o += 1 + else: + z += 1 + nums[i] >>= 1 + + ret += z * o + + return ret + + +if __name__ == "__main__": + assert Solution().totalHammingDistance([4, 14, 2]) == 6 diff --git a/480 Sliding Window Median.py b/480 Sliding Window Median.py new file mode 100644 index 0000000..1a05d0e --- /dev/null +++ b/480 Sliding Window Median.py @@ -0,0 +1,135 @@ +#!/usr/bin/python3 +""" +Median is the middle value in an ordered integer list. If the size of the list +is even, there is no middle value. So the median is the mean of the two middle +value. + +Examples: +[2,3,4] , the median is 3 + +[2,3], the median is (2 + 3) / 2 = 2.5 + +Given an array nums, there is a sliding window of size k which is moving from +the very left of the array to the very right. You can only see the k numbers in +the window. Each time the sliding window moves right by one position. Your job +is to output the median array for each window in the original array. + +For example, +Given nums = [1,3,-1,-3,5,3,6,7], and k = 3. + +Window position Median +--------------- ----- +[1 3 -1] -3 5 3 6 7 1 + 1 [3 -1 -3] 5 3 6 7 -1 + 1 3 [-1 -3 5] 3 6 7 -1 + 1 3 -1 [-3 5 3] 6 7 3 + 1 3 -1 -3 [5 3 6] 7 5 + 1 3 -1 -3 5 [3 6 7] 6 +Therefore, return the median sliding window as [1,-1,-1,3,5,6]. + +Note: +You may assume k is always valid, ie: k is always smaller than input array's +size for non-empty array. +""" +from typing import List +import heapq + + +class DualHeap: + def __init__(self): + """ + ---- number line ---> + --- max heap --- | --- min heap --- + """ + self.max_h = [] # List[Tuple[comparator, num]] + self.min_h = [] + self.max_sz = 0 + self.min_sz = 0 + self.to_remove = set() # value, error mapping index in nums + + def insert(self, num): + if self.max_h and num > self.max_h[0][1]: + heapq.heappush(self.min_h, (num, num)) + self.min_sz += 1 + else: + heapq.heappush(self.max_h, (-num, num)) + self.max_sz += 1 + self.balance() + + def pop(self, num): + self.to_remove.add(num) + if self.max_h and num > self.max_h[0][1]: + self.min_sz -= 1 + else: + self.max_sz -= 1 + self.balance() + + def clean_top(self): + while self.max_h and self.max_h[0][1] in self.to_remove: + _, num = heapq.heappop(self.max_h) + self.to_remove.remove(num) + while self.min_h and self.min_h[0][1] in self.to_remove: + _, num = heapq.heappop(self.min_h) + self.to_remove.remove(num) + + def balance(self): + # keep skew in max sz + while self.max_sz < self.min_sz : + self.clean_top() + _, num =heapq.heappop(self.min_h) + heapq.heappush(self.max_h, (-num, num)) + self.min_sz -= 1 + self.max_sz += 1 + while self.max_sz > self.min_sz + 1: + self.clean_top() + _, num = heapq.heappop(self.max_h) + heapq.heappush(self.min_h, (num, num)) + self.min_sz += 1 + self.max_sz -= 1 + + self.clean_top() + + def get_median(self, k): + self.clean_top() + if k % 2 == 1: + return self.max_h[0][1] + else: + return 0.5 * (self.max_h[0][1] + self.min_h[0][1]) + + +class Solution: + def medianSlidingWindow(self, nums: List[int], k: int) -> List[float]: + """ + 1. BST, proxied by bisect + dual heap + lazy removal + balance the valid element + + --- max heap --- | --- min heap --- + but need to delete the start of the window + + Lazy Removal with the help of hash table of idx -> remove? + Hash table mapping idx will fail + Remove by index will introduce bug for test case [1,1,1,1], 2: when poping, + we cannot know which heap to go to by index since decision of which heap to pop + is only about value. + + Calculating median also doesn't care about index, it only cares about value + """ + ret = [] + dh = DualHeap() + for i in range(k): + dh.insert(nums[i]) + + ret.append(dh.get_median(k)) + + for i in range(k, len(nums)): + dh.insert(nums[i]) + dh.pop(nums[i-k]) + ret.append(dh.get_median(k)) + + return ret + + +if __name__ == "__main__": + assert Solution().medianSlidingWindow([-2147483648,-2147483648,2147483647,-2147483648,-2147483648,-2147483648,2147483647,2147483647,2147483647,2147483647,-2147483648,2147483647,-2147483648], 2) + assert Solution().medianSlidingWindow([1,1,1,1], 2) == [1, 1, 1] + assert Solution().medianSlidingWindow([1,3,-1,-3,5,3,6,7], 3) == [1,-1,-1,3,5,6] diff --git a/485 Max Consecutive Ones.py b/485 Max Consecutive Ones.py new file mode 100644 index 0000000..21c2333 --- /dev/null +++ b/485 Max Consecutive Ones.py @@ -0,0 +1,31 @@ +#!/usr/bin/python3 +""" +Given a binary array, find the maximum number of consecutive 1s in this array. +""" + + +class Solution: + def findMaxConsecutiveOnes(self, nums): + """ + two pointers + :type nums: List[int] + :rtype: int + """ + s = 0 + e = 0 + ret = 0 + while s < len(nums): + if nums[s] == 1: + while e < len(nums) and nums[e] == 1: + e += 1 + ret = max(ret, e - s) + else: + e += 1 + + s = e + + return ret + + +if __name__ == "__main__": + assert Solution().findMaxConsecutiveOnes([1,1,0,1,1,1]) == 3 diff --git a/486 Predict the Winner.py b/486 Predict the Winner.py new file mode 100644 index 0000000..1037d93 --- /dev/null +++ b/486 Predict the Winner.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +Given an array of scores that are non-negative integers. Player 1 picks one of +the numbers from either end of the array followed by the player 2 and then +player 1 and so on. Each time a player picks a number, that number will not be +available for the next player. This continues until all the scores have been +chosen. The player with the maximum score wins. + +Given an array of scores, predict whether player 1 is the winner. You can assume +each player plays to maximize his score. + +Example 1: +Input: [1, 5, 2] +Output: False +Explanation: Initially, player 1 can choose between 1 and 2. +If he chooses 2 (or 1), then player 2 can choose from 1 (or 2) and 5. If player +2 chooses 5, then player 1 will be left with 1 (or 2). +So, final score of player 1 is 1 + 2 = 3, and player 2 is 5. +Hence, player 1 will never be the winner and you need to return False. +Example 2: +Input: [1, 5, 233, 7] +Output: True +Explanation: Player 1 first chooses 1. Then player 2 have to choose between 5 +and 7. No matter which number player 2 choose, player 1 can choose 233. +Finally, player 1 has more score (234) than player 2 (12), so you need to return +True representing player1 can win. +Note: +1 <= length of the array <= 20. +Any scores in the given array are non-negative integers and will not exceed +10,000,000. +If the scores of both players are equal, then player 1 is still the winner. +""" +from collections import defaultdict + + +class Solution: + def PredictTheWinner(self, nums): + """ + Let F[i][j] be the max score choose from A[i:j]. The player has two + options + F[i][j] = max( + A[i] + sum(A[i+1:j]) - F[i+1][j], + A[j-1] + sum(A[i:j-1]) - F[i][j-1] + ) + Compare F[0][n] and sum(A) - F[0][n] t0 determine the winner + + :type nums: List[int] + :rtype: bool + """ + l = len(nums) + gross = [0] # sum [0:i] + for e in nums: + gross.append(gross[-1] + e) + + F = defaultdict(lambda: defaultdict(int)) + for i in range(l-1, -1, -1): + for j in range(i+1, l+1): + F[i][j] = max( + gross[j] - gross[i] - F[i+1][j], + gross[j] - gross[i] - F[i][j-1] + ) + return F[0][l] >= (gross[-1] - F[0][l]) + + +if __name__ == "__main__": + assert Solution().PredictTheWinner([1, 5, 2]) == False + assert Solution().PredictTheWinner([1, 5, 233, 7]) == True diff --git a/491 Increasing Subsequences.py b/491 Increasing Subsequences.py new file mode 100644 index 0000000..e48f3c8 --- /dev/null +++ b/491 Increasing Subsequences.py @@ -0,0 +1,70 @@ +#!/usr/bin/python3 +""" +Given an integer array, your task is to find all the different possible +increasing subsequences of the given array, and the length of an increasing +subsequence should be at least 2 . + +Example: +Input: [4, 6, 7, 7] +Output: [[4, 6], [4, 7], [4, 6, 7], [4, 6, 7, 7], [6, 7], [6, 7, 7], [7,7], +[4,7,7]] +Note: +The length of the given array will not exceed 15. +The range of integer in the given array is [-100,100]. +The given array may contain duplicates, and two equal integers should also be +considered as a special case of increasing sequence. +""" + + +class Solution: + def findSubsequences(self, nums): + """ + 2nd approach + Maintain the current increasing subsequence and iterate them to grow it + Same complexity as the 1st approach since both needs to iterate the + subsequences + + :type nums: List[int] + :rtype: List[List[int]] + """ + subs = set() + for n in nums: + subs |= set([ + sub + (n,) + for sub in subs + if n >= sub[-1] + ]) + subs.add((n,)) + + return [ + list(sub) + for sub in subs + if len(sub) >= 2 + ] + + + def findSubsequences(self, nums): + """ + 1st approach. + F[i] records the increasing subsequence ends at A[i] + F[i] = F[j] + A[i]. + iterating F[j] is exponential + + :type nums: List[int] + :rtype: List[List[int]] + """ + l = len(nums) + F = [ + [(nums[i],)] + for i in range(l) + ] + ret = set() + for i in range(1, l): + for j in range(i): + if nums[i] >= nums[j]: + for t in F[j]: + cur = t + (nums[i],) + ret.add(cur) + F[i].append(cur) + + return list(map(list, ret)) diff --git a/494 Target Sum.py b/494 Target Sum.py new file mode 100644 index 0000000..cb10d80 --- /dev/null +++ b/494 Target Sum.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +You are given a list of non-negative integers, a1, a2, ..., an, and a target, S. +Now you have 2 symbols + and -. For each integer, you should choose one from + +and - as its new symbol. + +Find out how many ways to assign symbols to make sum of integers equal to target +S. + +Example 1: +Input: nums is [1, 1, 1, 1, 1], S is 3. +Output: 5 +Explanation: + +-1+1+1+1+1 = 3 ++1-1+1+1+1 = 3 ++1+1-1+1+1 = 3 ++1+1+1-1+1 = 3 ++1+1+1+1-1 = 3 + +There are 5 ways to assign symbols to make the sum of nums be target 3. +Note: +The length of the given array is positive and will not exceed 20. +The sum of elements in the given array will not exceed 1000. +Your output answer is guaranteed to be fitted in a 32-bit integer. +""" +from collections import defaultdict + + +class Solution: + def findTargetSumWays(self, A, S): + """ + Let F[i][k] be number of ways for A[:i] sum to k + F[i][k] = F[i-1][k-A[i-1]] + F[i-1][k+A[i-1]] + + :type A: List[int] + :type S: int + :rtype: int + """ + if not A: + return + F = defaultdict(lambda: defaultdict(int)) + F[0][0] = 1 + for i in range(len(A)): + for k in F[i].keys(): # F[i] for A[:i] + F[i+1][k-A[i]] += F[i][k] + F[i+1][k+A[i]] += F[i][k] + + return F[len(A)][S] + + +if __name__ == "__main__": + assert Solution().findTargetSumWays([1, 1, 1, 1, 1], 3) == 5 diff --git a/496 Next Greater Element I.py b/496 Next Greater Element I.py new file mode 100644 index 0000000..36760da --- /dev/null +++ b/496 Next Greater Element I.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +You are given two arrays (without duplicates) nums1 and nums2 where nums1’s +enclements are subset of nums2. Find all the next greater numbers for nums1's +elements in the corresponding places of nums2. + +The Next Greater Number of a number x in nums1 is the first greater number to +its right in nums2. If it does not exist, output -1 for this number. + +Example 1: +Input: nums1 = [4,1,2], nums2 = [1,3,4,2]. +Output: [-1,3,-1] +Explanation: + For number 4 in the first array, you cannot find the next greater number for it in the second array, so output -1. + For number 1 in the first array, the next greater number for it in the second array is 3. + For number 2 in the first array, there is no next greater number for it in the second array, so output -1. +Example 2: +Input: nums1 = [2,4], nums2 = [1,2,3,4]. +Output: [3,-1] +Explanation: + For number 2 in the first array, the next greater number for it in the second array is 3. + For number 4 in the first array, there is no next greater number for it in the second array, so output -1. +Note: +All elements in nums1 and nums2 are unique. +The length of both nums1 and nums2 would not exceed 1000. +""" + + +class Solution: + def nextGreaterElement(self, nums1, nums2): + """ + Brute force O(mn) + + Need to understand the problem first. + nums1 is just query + nums2 is the target look up + + When look at A[i], need the information of increasing subsequence + from A[i+1:] + + Use a stack to maintain the increasing subsequence with top with min, + bottom max + + :type nums1: List[int] + :type nums2: List[int] + :rtype: List[int] + """ + h = {} # num -> next greater element + stk = [] + for e in nums2[::-1]: + while stk and stk[-1] <= e: + # until stk[-1] > e + stk.pop() + + h[e] = stk[-1] if stk else -1 + stk.append(e) + + return [ + h[q] + for q in nums1 + ] diff --git a/498 Diagonal Traverse.py b/498 Diagonal Traverse.py new file mode 100644 index 0000000..5378b70 --- /dev/null +++ b/498 Diagonal Traverse.py @@ -0,0 +1,95 @@ +#!/usr/bin/python3 +""" +Given a matrix of M x N elements (M rows, N columns), return all elements of the +matrix in diagonal order as shown in the below image. + +Example: + +Input: +[ + [ 1, 2, 3 ], + [ 4, 5, 6 ], + [ 7, 8, 9 ] +] + +Output: [1,2,4,7,5,3,6,8,9] +""" + + +class Solution: + def findDiagonalOrder(self, matrix): + """ + 2nd approach + diagonal - i + j is constant + let F[i + j] maintain a list of number with subscript (i, j) + + :type matrix: List[List[int]] + :rtype: List[int] + """ + if not matrix: + return [] + + R, C = len(matrix), len(matrix[0]) + F = [[] for _ in range(R+C-1)] + for r in range(R): + for c in range(C): + F[r+c].append(matrix[r][c]) + + ret = [] + for i in range(R+C-1): + if i % 2 == 1: + ret.extend(F[i]) + else: + ret.extend(F[i][::-1]) + + return ret + + def findDiagonalOrder_2(self, matrix): + """ + 1st approach + try 2 * 4 and 4 * 2 and 3 * 3 matrix to find the pattern + + :type matrix: List[List[int]] + :rtype: List[int] + """ + if not matrix: + return [] + i = 0 + j = 0 + inc = True + ret = [] + R, C = len(matrix), len(matrix[0]) + while True: + ret.append(matrix[i][j]) + if i == R - 1 and j == C - 1: + break + if inc: + i -= 1 + j += 1 + if i < 0 or j >= C: + inc = False + if i < 0 and j < C: + i = 0 + else: + i += 2 + j = C - 1 + else: + i += 1 + j -= 1 + if i >= R or j < 0: + inc = True + if j < 0 and i < R: + j = 0 + else: + i = R - 1 + j += 2 + + return ret + + +if __name__ == "__main__": + assert Solution().findDiagonalOrder([ + [ 1, 2, 3 ], + [ 4, 5, 6 ], + [ 7, 8, 9 ] + ]) == [1,2,4,7,5,3,6,8,9] diff --git a/500 Keyboard Row.py b/500 Keyboard Row.py new file mode 100644 index 0000000..2d25027 --- /dev/null +++ b/500 Keyboard Row.py @@ -0,0 +1,32 @@ +#!/usr/bin/python3 +""" +Given a List of words, return the words that can be typed using letters of +alphabet on only one row's of American keyboard like the image below. +""" + + +class Solution: + def findWords(self, words): + """ + :type words: List[str] + :rtype: List[str] + """ + rows = [ + "qwertyuiop", + "asdfghjkl", + "zxcvbnm", + ] + d = { + e: i + for i, v in enumerate(rows) + for e in v + } + return [ + w + for w in words + if all(d[w[0].lower()] == d[l.lower()] for l in w) + ] + + +if __name__ == "__main__": + assert Solution().findWords(["Hello", "Alaska", "Dad", "Peace"]) == ["Alaska", "Dad"] diff --git a/501 Find Mode in Binary Search Tree.py b/501 Find Mode in Binary Search Tree.py new file mode 100644 index 0000000..0498925 --- /dev/null +++ b/501 Find Mode in Binary Search Tree.py @@ -0,0 +1,112 @@ +#!/usr/bin/python3 +""" +Given a binary search tree (BST) with duplicates, find all the mode(s) (the most +frequently occurred element) in the given BST. + +Assume a BST is defined as follows: + +The left subtree of a node contains only nodes with keys less than or equal to +the node's key. +The right subtree of a node contains only nodes with keys greater than or equal +to the node's key. +Both the left and right subtrees must also be binary search trees. + + +For example: +Given BST [1,null,2,2], + + 1 + \ + 2 + / + 2 + + +return [2]. + +Note: If a tree has more than one mode, you can return them in any order. + +Follow up: Could you do that without using any extra space? (Assume that the +implicit stack space incurred due to recursion does not count). +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def findMode(self, root): + """ + In-order traversal + O(1) space thus cannot keep a set of current modes + need two passes - 1st pass to find the mode count, 2nd pass to find all + modes equal to the mode count + + :type root: TreeNode + :rtype: List[int] + """ + ret = [[], 0] # [results, length] + self.find_mode(root, [None, 0], ret, False) + self.find_mode(root, [None, 0], ret, True) + return ret[0] + + def find_mode(self, root, prev, ret, collect): + """ + prev: [previous_value, count]. Need to survice the call stack + """ + if not root: + return + + self.find_mode(root.left, prev, ret, collect) + + if prev[0] == root.val: + prev[1] += 1 + else: + prev[1] = 1 + prev[0] = root.val + + if not collect: + ret[1] = max(ret[1], prev[1]) + else: + if prev[1] == ret[1]: + ret[0].append(root.val) + + self.find_mode(root.right, prev, ret, collect) + + def findMode_error(self, root): + """ + counter (extra space) for any tree + use recursion + + :type root: TreeNode + :rtype: List[int] + """ + if not root: + return [] + + ret = [0, []] + self.find_mode_error(root, root.val, ret) + return ret[1] + + def find_mode_error(self, root, target, ret): + cur = 0 + if not root: + return cur + + if root.val == target: + cur += 1 + cur += self.find_mode_error(root.left, root.val, ret) + cur += self.find_mode_error(root.right, root.val, ret) + if cur > ret[0]: + ret[0], ret[1] = cur, [target] + elif cur == ret[0]: + ret[1].append(target) + else: + self.find_mode_error(root, root.val, ret) + + return cur diff --git a/502 IPO.py b/502 IPO.py new file mode 100644 index 0000000..f8dcf67 --- /dev/null +++ b/502 IPO.py @@ -0,0 +1,94 @@ +#!/usr/bin/python3 +""" +Suppose LeetCode will start its IPO soon. In order to sell a good price of its +shares to Venture Capital, LeetCode would like to work on some projects to + increase its capital before the IPO. Since it has limited resources, it can + only finish at most k distinct projects before the IPO. Help LeetCode design + the best way to maximize its total capital after finishing at most k distinct + projects. + +You are given several projects. For each project i, it has a pure profit Pi and +a minimum capital of Ci is needed to start the corresponding project. +Initially, you have W capital. When you finish a project, you will obtain its +pure profit and the profit will be added to your total capital. + +To sum up, pick a list of at most k distinct projects from given projects to +maximize your final capital, and output your final maximized capital. + +Example 1: +Input: k=2, W=0, Profits=[1,2,3], Capital=[0,1,1]. + +Output: 4 + +Explanation: Since your initial capital is 0, you can only start the project indexed 0. + After finishing it you will obtain profit 1 and your capital becomes 1. + With capital 1, you can either start the project indexed 1 or the project indexed 2. + Since you can choose at most 2 projects, you need to finish the project indexed 2 to get the maximum capital. + Therefore, output the final maximized capital, which is 0 + 1 + 3 = 4. +Note: +You may assume all numbers in the input are non-negative integers. +The length of Profits array and Capital array will not exceed 50,000. +The answer is guaranteed to fit in a 32-bit signed integer. +""" +from typing import List +import heapq + + +class Solution: + def findMaximizedCapital(self, k: int, W: int, Profits: List[int], Capital: List[int]) -> int: + """ + Greedy + dual PQ + Greedy: need max profit meeting the current capital requirement + 1st pq sort by min capital + 2nd pq sort by max profit + + O(N logN) + O(N log N) + """ + capital_q = list(zip(Capital, Profits)) + profit_q = [] + heapq.heapify(capital_q) + capital = W + for _ in range(k): + while capital_q and capital_q[0][0] <= capital: + _, pro = heapq.heappop(capital_q) + heapq.heappush(profit_q, (-pro, pro)) + + if profit_q: + _, pro = heapq.heappop(profit_q) + capital += pro + else: + break + + return capital + + def findMaximizedCapital_TLE(self, k: int, W: int, Profits: List[int], Capital: List[int]) -> int: + """ + Knapsack problem + + Difference from original knapsack: weight vs. capitcal + profit + Doing a project has profit and open new project opportunities. + + F[m][c] = F[m-1][] + profit[i] + final F[k][W] + + Greedy, always do the max profits given the capital requirement fullfilled + + O(k * N) + """ + capital = W + n = len(Profits) + visited = [False for _ in range(n)] + for _ in range(k): + maxa = 0 + maxa_i = 0 + for i in range(n): + if not visited[i] and Profits[i] >= maxa and Capital[i] <= capital: + maxa = Profits[i] + maxa_i = i + if maxa > 0: + capital += maxa + visited[maxa_i] = True + else: + break + + return capital diff --git a/503 Next Greater Element II.py b/503 Next Greater Element II.py new file mode 100644 index 0000000..ee175a0 --- /dev/null +++ b/503 Next Greater Element II.py @@ -0,0 +1,70 @@ +#!/usr/bin/python3 +""" +Given a circular array (the next element of the last element is the first +element of the array), print the Next Greater Number for every element. The Next +Greater Number of a number x is the first greater number to its traversing-order +next in the array, which means you could search circularly to find its next +greater number. If it doesn't exist, output -1 for this number. + +Example 1: +Input: [1,2,1] +Output: [2,-1,2] +Explanation: The first 1's next greater number is 2; +The number 2 can't find next greater number; +The second 1's next greater number needs to search circularly, which is also 2. +Note: The length of given array won't exceed 10000. +""" +from bisect import bisect + + +class Solution: + def nextGreaterElements(self, nums): + """ + scan the nums from right to left, since next largest number, you can + drop certain information about the A[i:]. Use stack to keep a increasing + numbers. if A[i] > any A[i+1: j] but A[i] < A[j], we can safely drop + the numbers A[i+1:j] since they won't be useful. + + :type nums: List[int] + :rtype: List[int] + """ + # initalize the stack + stk = [] + for n in nums[::-1]: + while stk and stk[-1] <= n: + stk.pop() + stk.append(n) + + ret = [] + for n in nums[::-1]: + while stk and stk[-1] <= n: + stk.pop() + ret.append(stk[-1] if stk else -1) + stk.append(n) + + return ret[::-1] + + def nextGreaterElements_error(self, nums): + """ + brute force O(n^2) + + bisect O(n lgn) - error cannot binary search + :type nums: List[int] + :rtype: List[int] + """ + A = nums + nums + print(A) + ret = [] + for e in nums: + t = bisect(A, e) + if t == len(A): + ret.append(-1) + else: + ret.append(A[t]) + + print(ret) + return ret + + +if __name__ == "__main__": + assert Solution().nextGreaterElements([1,2,1]) == [2, -1, 2] diff --git a/504 Base 7.py b/504 Base 7.py new file mode 100644 index 0000000..16572b3 --- /dev/null +++ b/504 Base 7.py @@ -0,0 +1,40 @@ +#!/usr/bin/python3 +""" +Given an integer, return its base 7 string representation. + +Example 1: +Input: 100 +Output: "202" +Example 2: +Input: -7 +Output: "-10" + +Note: The input will be in range of [-1e7, 1e7]. +""" + + +class Solution: + def convertToBase7(self, num): + """ + simplfied for negative number + :type num: int + :rtype: str + """ + if num == 0: + return "0" + ret = [] + n = abs(num) + while n: + ret.append(n % 7) + n //= 7 + + ret = "".join(map(str, ret[::-1])) + if num < 0: + ret = "-" + ret + + return ret + + +if __name__ == "__main__": + assert Solution().convertToBase7(100) == "202" + assert Solution().convertToBase7(-7) == "-10" diff --git a/505 The Maze II.py b/505 The Maze II.py new file mode 100644 index 0000000..f7247b7 --- /dev/null +++ b/505 The Maze II.py @@ -0,0 +1,48 @@ +#!/usr/bin/python3 +""" +premium question +""" +from typing import List +import heapq + + +dirs = [(0, -1), (0, 1), (-1, 0), (1, 0)] + + +class Solution: + def shortestDistance(self, maze: List[List[int]], start: List[int], destination: List[int]) -> int: + """ + No friction rolling ball + + F[i][j][dir] = min distance given direction + S[i][j] = whether stoppable + + Dijkstra's algorith, reduce to a graph problem + """ + m, n = len(maze), len(maze[0]) + D = [[float("inf") for _ in range(n)] for _ in range(m)] # distance matrix + i, j = start + D[i][j] = 0 + q = [(0, i, j)] + while q: + dist, i, j = heapq.heappop(q) + for di, dj in dirs: + cur_dist = 0 + I = i + J = j + # look ahead + while 0 <= I + di < m and 0 <= J + dj < n and maze[I + di][J + dj] == 0: + I += di + J += dj + cur_dist += 1 + + if dist + cur_dist < D[I][J]: + D[I][J] = dist + cur_dist + heapq.heappush(q, (D[I][J], I, J)) + + i, j = destination + return D[i][j] if D[i][j] != float("inf") else -1 + + +if __name__ == "__main__": + assert Solution().shortestDistance([[0,0,1,0,0],[0,0,0,0,0],[0,0,0,1,0],[1,1,0,1,1],[0,0,0,0,0]], [0,4], [4,4]) == 12 diff --git a/508 Most Frequent Subtree Sum.py b/508 Most Frequent Subtree Sum.py new file mode 100644 index 0000000..910fd94 --- /dev/null +++ b/508 Most Frequent Subtree Sum.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +Given the root of a tree, you are asked to find the most frequent subtree sum. +The subtree sum of a node is defined as the sum of all the node values formed by +the subtree rooted at that node (including the node itself). So what is the most +frequent subtree sum value? If there is a tie, return all the values with the +highest frequency in any order. + +Examples 1 +Input: + + 5 + / \ +2 -3 +return [2, -3, 4], since all the values happen only once, return all of them in +any order. +Examples 2 +Input: + + 5 + / \ +2 -5 +return [2], since 2 happens twice, however -5 only occur once. +Note: You may assume the sum of values in any subtree is in the range of 32-bit +signed integer. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +from collections import defaultdict + + +class Solution: + def findFrequentTreeSum(self, root): + """ + traverse with counter + :type root: TreeNode + :rtype: List[int] + """ + counter = defaultdict(int) + self.traverse(root, counter) + ret = [[], 0] + for k, v in counter.items(): + if v > ret[1]: + ret[0] = [k] + ret[1] = v + elif v == ret[1]: + ret[0].append(k) + + return ret[0] + + def traverse(self, root, counter): + if not root: + return 0 + + cur = root.val + cur += self.traverse(root.left, counter) + cur += self.traverse(root.right, counter) + counter[cur] += 1 + return cur diff --git a/513 Find Bottom Left Tree Value.py b/513 Find Bottom Left Tree Value.py new file mode 100644 index 0000000..1e48ee5 --- /dev/null +++ b/513 Find Bottom Left Tree Value.py @@ -0,0 +1,57 @@ +#!/usr/bin/python3 +""" +Given a binary tree, find the leftmost value in the last row of the tree. + +Example 1: +Input: + + 2 + / \ + 1 3 + +Output: +1 +Example 2: +Input: + + 1 + / \ + 2 3 + / / \ + 4 5 6 + / + 7 + +Output: +7 +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def findBottomLeftValue(self, root): + """ + BFS + + :type root: TreeNode + :rtype: int + """ + q = [root] + while q: + ret = q[0].val + cur_q = [] + for e in q: + if e.left: + cur_q.append(e.left) + if e.right: + cur_q.append(e.right) + q = cur_q + + return ret diff --git a/515 Find Largest Value in Each Tree Row.py b/515 Find Largest Value in Each Tree Row.py new file mode 100644 index 0000000..e2bd561 --- /dev/null +++ b/515 Find Largest Value in Each Tree Row.py @@ -0,0 +1,49 @@ +#!/usr/bin/python3 +""" +You need to find the largest value in each row of a binary tree. + +Example: +Input: + + 1 + / \ + 3 2 + / \ \ + 5 3 9 + +Output: [1, 3, 9] +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def largestValues(self, root): + """ + BFS + :type root: TreeNode + :rtype: List[int] + """ + ret = [] + if not root: + return ret + + q = [root] + while q: + ret.append(max(map(lambda e: e.val, q))) + cur_q = [] + for e in q: + if e.left: + cur_q.append(e.left) + if e.right: + cur_q.append(e.right) + + q = cur_q + + return ret diff --git a/516 Longest Palindromic Subsequence.py b/516 Longest Palindromic Subsequence.py new file mode 100644 index 0000000..0964b59 --- /dev/null +++ b/516 Longest Palindromic Subsequence.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +Given a string s, find the longest palindromic subsequence's length in s. You +may assume that the maximum length of s is 1000. + +Example 1: +Input: + +"bbbab" +Output: +4 +One possible longest palindromic subsequence is "bbbb". +Example 2: +Input: + +"cbbd" +Output: +2 +One possible longest palindromic subsequence is "bb". +""" +from collections import defaultdict + + +class Solution: + def longestPalindromeSubseq(self, s): + """ + Brute force 0-1, exponential + + F[i][j] be the longest palindrom subseuence (not necessarily ending at + A[i] A[j]) + + F[i-1]F[j+1] = F[i][j] + 2 or F[i][j] # error + The transition function shoud be + F[i][j] = F[i+1][j-1] + 2 or F[i+1][j] or F[i][j-1] + :type s: str + :rtype: int + """ + n = len(s) + F = defaultdict(lambda: defaultdict(int)) + for i in range(n): + F[i][i] = 1 + + for i in range(n-1, -1, -1): + for j in range(i+1, n): + F[i][j] = max(F[i+1][j], F[i][j-1]) + if s[i] == s[j]: + F[i][j] = max(F[i][j], F[i+1][j-1] + 2) + + return F[0][n-1] + + +if __name__ == "__main__": + assert Solution().longestPalindromeSubseq("bbbab") == 4 diff --git a/518 Coin Change 2.py b/518 Coin Change 2.py new file mode 100644 index 0000000..b50a457 --- /dev/null +++ b/518 Coin Change 2.py @@ -0,0 +1,109 @@ +#!/usr/bin/python3 +""" +You are given coins of different denominations and a total amount of money. +Write a function to compute the number of combinations that make up that amount. +You may assume that you have infinite number of each kind of coin. + + + +Example 1: + +Input: amount = 5, coins = [1, 2, 5] +Output: 4 +Explanation: there are four ways to make up the amount: +5=5 +5=2+2+1 +5=2+1+1+1 +5=1+1+1+1+1 +Example 2: + +Input: amount = 3, coins = [2] +Output: 0 +Explanation: the amount of 3 cannot be made up just with coins of 2. +Example 3: + +Input: amount = 10, coins = [10] +Output: 1 +""" +from collections import defaultdict + + +class Solution: + def change(self, amount, coins): + """ + let F[amount][l] = # ways ending (but not necesserily) using coins[l-1] + (i.e. coins[:l]) + Two options: use coin[l-1] or not + F[amount][l] = F[amount][l-1] + F[amount - coin[l-1]][l] + + Similar to 0-1 knapsack + + :type amount: int + :type coins: List[int] + :rtype: int + """ + F = defaultdict(lambda: defaultdict(int)) + n = len(coins) + for l in range(n + 1): + F[0][l] = 1 # trivial case + # why not start from 0, because we need to handle trivial case F[0][0] + + for a in range(1, amount + 1): + for l in range(1, n + 1): + F[a][l] = F[a][l-1] + F[a - coins[l-1]][l] + + return F[amount][n] + + + def change_TLE(self, amount, coins): + """ + Like the take the step for the stairs dp + + let F[amount][i] = # ways ending using coin[i] + F[amount][i] += F[amount - coin[i]][j] for j in range(i) + + O(n^3) + :type amount: int + :type coins: List[int] + :rtype: int + """ + if amount == 0: + return 1 + + coins.sort() + n = len(coins) + F = defaultdict(lambda: defaultdict(int)) + for i in range(n): + F[coins[i]][i] = 1 + + for a in range(1, amount + 1): + for i in range(n): + for j in range(i + 1): + F[a][i] += F[a - coins[i]][j] + + return sum(F[amount].values()) + + def change_error(self, amount, coins): + """ + Like the take the step for the stairs dp + + let F[amount] = # ways + F[amount] += F[amount - v] for v in coins + error: count repeated: 1 + 2, 2 + 1 + + :type amount: int + :type coins: List[int] + :rtype: int + """ + F = {0: 1} + for a in range(1, amount + 1): + F[a] = 0 + for c in coins: + if a - c in F: + F[a] += F[a - c] + + return F[amount] + + +if __name__ == "__main__": + assert Solution().change(5, [1, 2, 5]) == 4 diff --git a/520 Detect Capital.py b/520 Detect Capital.py new file mode 100644 index 0000000..59f5077 --- /dev/null +++ b/520 Detect Capital.py @@ -0,0 +1,48 @@ +#!/usr/bin/python3 +""" +Given a word, you need to judge whether the usage of capitals in it is right or +not. + +We define the usage of capitals in a word to be right when one of the following +cases holds: + +All letters in this word are capitals, like "USA". +All letters in this word are not capitals, like "leetcode". +Only the first letter in this word is capital if it has more than one letter, +like "Google". +Otherwise, we define that this word doesn't use capitals in a right way. +Example 1: +Input: "USA" +Output: True +Example 2: +Input: "FlaG" +Output: False +Note: The input will be a non-empty word consisting of uppercase and lowercase +latin letters. +""" + + +class Solution: + def detectCapitalUse(self, word: str) -> bool: + """ + Two passes is easy + How to do it in one pass + """ + if not word: + return True + + head_upper = word[0].isupper() + + # except for the head + has_lower = False + has_upper = False + for w in word[1:]: + if w.isupper(): + has_upper = True + if has_lower or not head_upper: + return False + else: + has_lower = True + if has_upper: + return False + return True diff --git a/523. Continuous Subarray Sum.py b/523. Continuous Subarray Sum.py new file mode 100644 index 0000000..346c7c3 --- /dev/null +++ b/523. Continuous Subarray Sum.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +Given a list of non-negative numbers and a target integer k, write a function to +check if the array has a continuous subarray of size at least 2 that sums up to +the multiple of k, that is, sums up to n*k where n is also an integer. + +Example 1: +Input: [23, 2, 4, 6, 7], k=6 +Output: True +Explanation: Because [2, 4] is a continuous subarray of size 2 and sums up to 6. +Example 2: +Input: [23, 2, 6, 4, 7], k=6 +Output: True +Explanation: Because [23, 2, 6, 4, 7] is an continuous subarray of size 5 and + sums up to 42. +Note: +The length of the array won't exceed 10,000. +You may assume the sum of all the numbers is in the range of a signed 32-bit +integer. +""" + + +class Solution: + def checkSubarraySum(self, nums, k): + """ + Two pointers algorithm won't work since it is multiple of k + + prefix sum + hashmap (look back) + mod k (Math) + :type nums: List[int] + :type k: int + :rtype: bool + """ + h = {0: 0} # [:l], half open, factor in trival case + s = 0 + for l in range(1, len(nums) + 1): + s += nums[l-1] + if k != 0: # edge case + s %= k + if s in h: + if l - h[s] >= 2: # size at least 2 + return True + else: + # only keep the lowest + h[s] = l + + return False + + +if __name__ == "__main__": + assert Solution().checkSubarraySum([23,2,4,6,7], 6) == True diff --git a/524 Longest Word in Dictionary through Deleting.py b/524 Longest Word in Dictionary through Deleting.py new file mode 100644 index 0000000..1e8b454 --- /dev/null +++ b/524 Longest Word in Dictionary through Deleting.py @@ -0,0 +1,64 @@ +#!/usr/bin/python3 +""" +Given a string and a string dictionary, find the longest string in the +dictionary that can be formed by deleting some characters of the given string. +If there are more than one possible results, return the longest word with the +smallest lexicographical order. If there is no possible result, return the empty +string. + +Example 1: +Input: +s = "abpcplea", d = ["ale","apple","monkey","plea"] + +Output: +"apple" +Example 2: +Input: +s = "abpcplea", d = ["a","b","c"] + +Output: +"a" +Note: +All the strings in the input will only contain lower-case letters. +The size of the dictionary won't exceed 1,000. +The length of all the strings in the input won't exceed 1,000. +""" +from collections import defaultdict + + +class Solution: + def findLongestWord(self, s, d): + """ + Compare subsequence: O(|S|) (two pointers) + Then iterate d, check subsequence: O(|S||d|) + + Generalize two pointers to n pointers + O(|S||d|) + + + :type s: str + :type d: List[str] + :rtype: str + """ + h = defaultdict(list) + for d_idx, w in enumerate(d): + w_idx = 0 + h[w[w_idx]].append((d_idx, w_idx)) + + ret = "" + for e in s: + lst = h.pop(e, []) + for d_idx, w_idx in lst: + w = d[d_idx] + w_idx += 1 + if w_idx >= len(w): + # if len(w) >= len(ret) and w < ret: # error + ret = min(ret, w, key=lambda x: (-len(x), x)) # compare with primary and secondary key + else: + h[w[w_idx]].append((d_idx, w_idx)) + + return ret + + +if __name__ == "__main__": + assert Solution().findLongestWord("abpcplea", ["ale","apple","monkey","plea"]) == "apple" diff --git a/525 Contiguous Array.py b/525 Contiguous Array.py new file mode 100644 index 0000000..7ca75e0 --- /dev/null +++ b/525 Contiguous Array.py @@ -0,0 +1,109 @@ +#!/usr/bin/python3 +""" +Given a binary array, find the maximum length of a contiguous subarray with +equal number of 0 and 1. + +Example 1: +Input: [0,1] +Output: 2 +Explanation: [0, 1] is the longest contiguous subarray with equal number of 0 +and 1. +Example 2: +Input: [0,1,0] +Output: 2 +Explanation: [0, 1] (or [1, 0]) is a longest contiguous subarray with equal +number of 0 and 1. +Note: The length of the given binary array will not exceed 50,000. +""" + + +class Solution: + def findMaxLength(self, nums): + """ + Look back with map + + key: map stores the difference of the 0, 1 count + Similar to contiguous sum to target + :type nums: List[int] + :rtype: int + """ + o = 0 + z = 0 + d = {0: 0} # diff for nums[:l] + ret = 0 + for i, e in enumerate(nums): + if e == 1: + o += 1 + else: + z += 1 + diff = o - z + if diff in d: + ret = max(ret, i + 1 - d[diff]) + else: + d[diff] = i + 1 + + return ret + + def findMaxLength_error(self, nums): + """ + starting from both sides, shrinking until equal + + :type nums: List[int] + :rtype: int + """ + n = len(nums) + F = [0 for _ in range(n+1)] + for i in range(n): + F[i+1] = F[i] + if nums[i] == 0: + F[i+1] += 1 + + i = 0 + j = n + while i < j: + count = F[j] - F[i] + l = j - i + if count * 2 == l: + print(l) + return l + elif count * 2 < l: + if nums[i] == 1: + i += 1 + else: + j -= 1 + else: + if nums[i] == 0: + i += 1 + else: + j -= 1 + return 0 + + + def findMaxLength_TLE(self, nums): + """ + scan nums[i:j], check number of 0 (pre-calculated) + O(n^2) + + :type nums: List[int] + :rtype: int + """ + F = [0] + n = len(nums) + for e in nums: + if e == 0: + F.append(F[-1] + 1) + else: + F.append(F[-1]) + + ret = 0 + for i in range(n): + for j in range(i+1, n+1): + if (F[j] - F[i]) * 2 == j - i: + ret = max(ret, j - i) + + return ret + + +if __name__ == "__main__": + assert Solution().findMaxLength([0, 1, 0]) == 2 + assert Solution().findMaxLength([0,1,0,1,1,1,0,0,1,1,0,1,1,1,1,1,1,0,1,1,0,1,1,0,0,0,1,0,1,0,0,1,0,1,1,1,1,1,1,0,0,0,0,1,0,0,0,1,1,1,0,1,0,0,1,1,1,1,1,0,0,1,1,1,1,0,0,1,0,1,1,0,0,0,0,0,0,1,0,1,0,1,1,0,0,1,1,0,1,1,1,1,0,1,1,0,0,0,1,1]) == 68 diff --git a/526 Beautiful Arrangement.py b/526 Beautiful Arrangement.py new file mode 100644 index 0000000..ef41c96 --- /dev/null +++ b/526 Beautiful Arrangement.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +Suppose you have N integers from 1 to N. We define a beautiful arrangement as an +array that is constructed by these N numbers successfully if one of the +following is true for the ith position (1 <= i <= N) in this array: + +The number at the ith position is divisible by i. +i is divisible by the number at the ith position. + + +Now given N, how many beautiful arrangements can you construct? + +Example 1: + +Input: 2 +Output: 2 +Explanation: + +The first beautiful arrangement is [1, 2]: + +Number at the 1st position (i=1) is 1, and 1 is divisible by i (i=1). + +Number at the 2nd position (i=2) is 2, and 2 is divisible by i (i=2). + +The second beautiful arrangement is [2, 1]: + +Number at the 1st position (i=1) is 2, and 2 is divisible by i (i=1). + +Number at the 2nd position (i=2) is 1, and i (i=2) is divisible by 1. + + +Note: + +N is a positive integer and will not exceed 15. +""" + + +class Solution: + def countArrangement(self, N: int) -> int: + """ + dfs + """ + candidates = set(range(1, N+1)) + ret = self.dfs(candidates, 1, N) + return ret + + def dfs(self, candidates, i, N): + if i > N: + return 1 + + ret = 0 + for c in candidates: + if c % i == 0 or i % c == 0: + candidates.remove(c) + ret += self.dfs(candidates, i+1, N) + candidates.add(c) + return ret + + +if __name__ == "__main__": + assert Solution().countArrangement(2) == 2 diff --git a/527 Word Abbreviation.py b/527 Word Abbreviation.py new file mode 100644 index 0000000..a06d876 --- /dev/null +++ b/527 Word Abbreviation.py @@ -0,0 +1,58 @@ +#!/usr/bin/python3 +""" +premium question +""" + +from typing import List +from collections import defaultdict + + +class Solution: + def wordsAbbreviation(self, words: List[str]) -> List[str]: + """ + Sort the word, check prefix and last word + + Group by first and last char, group by prefix and last char + then make a trie - hard to implement? TrieNode lambda + + Need to count the #appearances in the TrieNode + """ + hm = defaultdict(list) + ret = [None for _ in words] + for i, w in enumerate(words): + hm[w[0], w[-1], len(w)].append(i) + + TrieNode = lambda: defaultdict(TrieNode) + + for lst in hm.values(): + root = TrieNode() + for i in lst: + w = words[i] + cur = root + for c in w: + cur = cur[c] + cur["count"] = cur.get("count", 0) + 1 + + for i in lst: + w = words[i] + prefix_l = 0 + cur = root + for c in w: + prefix_l += 1 + cur = cur[c] + if cur["count"] == 1: + break + + ret[i] = self.abbrev(w, prefix_l) + + return ret + + def abbrev(self, w, prefix_l): + abbrev_l = len(w) - 2 - prefix_l + 1 + if abbrev_l > 1: + return w[:prefix_l] + str(abbrev_l) + w[-1] + return w + + +if __name__ == "__main__": + assert Solution().wordsAbbreviation(["like", "god", "internal", "me", "internet", "interval", "intension", "face", "intrusion"]) == ["l2e","god","internal","me","i6t","interval","inte4n","f2e","intr4n"] diff --git a/529 Minesweeper.py b/529 Minesweeper.py new file mode 100644 index 0000000..2eb2788 --- /dev/null +++ b/529 Minesweeper.py @@ -0,0 +1,3 @@ +""" + +""" \ No newline at end of file diff --git a/530 Minimum Absolute Difference in BST.py b/530 Minimum Absolute Difference in BST.py new file mode 100644 index 0000000..12a088e --- /dev/null +++ b/530 Minimum Absolute Difference in BST.py @@ -0,0 +1,58 @@ +#!/usr/bin/python3 +""" +Given a binary search tree with non-negative values, find the minimum absolute +difference between values of any two nodes. + +Example: + +Input: + + 1 + \ + 3 + / + 2 + +Output: +1 + +Explanation: +The minimum absolute difference is 1, which is the difference between 2 and 1 (or between 2 and 3). + + +Note: There are at least two nodes in this BST. +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def getMinimumDifference(self, root: 'TreeNode') -> int: + """ + For every node, find min and max in left or right substree. + O(n lgn) + + To optimize: + recursively pass the min and max, O(n) + """ + ret = [float('inf')] # keep reference + self.dfs(root, ret) + return ret[0] + + def dfs(self, node, ret): + if not node: + return None, None + left_min, left_max = self.dfs(node.left, ret) + right_min, right_max = self.dfs(node.right, ret) + if left_max: + ret[0] = min(ret[0], abs(node.val - left_max)) + if right_min: + ret[0] = min(ret[0], abs(node.val - right_min)) + left_min = left_min or node.val + right_max = right_max or node.val + return left_min, right_max diff --git a/538 Convert BST to Greater Tree.py b/538 Convert BST to Greater Tree.py new file mode 100644 index 0000000..8b4760f --- /dev/null +++ b/538 Convert BST to Greater Tree.py @@ -0,0 +1,42 @@ +#!/usr/bin/python3 +""" +Given a Binary Search Tree (BST), convert it to a Greater Tree such that every +key of the original BST is changed to the original key plus sum of all keys +greater than the original key in BST. + +Example: + +Input: The root of a Binary Search Tree like this: + 5 + / \ + 2 13 + +Output: The root of a Greater Tree like this: + 18 + / \ + 20 13 +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def convertBST(self, root: 'TreeNode') -> 'TreeNode': + """ + in-order traversal, right first + """ + self.walk(root, 0) + return root + + def walk(self, node, cur_sum): + """stateless walk""" + if not node: + return cur_sum + s = self.walk(node.right, cur_sum) + node.val += s + return self.walk(node.left, node.val) diff --git a/539 Minimum Time Difference.py b/539 Minimum Time Difference.py new file mode 100644 index 0000000..bbacc74 --- /dev/null +++ b/539 Minimum Time Difference.py @@ -0,0 +1,43 @@ +#!/usr/bin/python3 +""" +Given a list of 24-hour clock time points in "Hour:Minutes" format, find the +minimum minutes difference between any two time points in the list. +Example 1: +Input: ["23:59","00:00"] +Output: 1 +Note: +The number of time points in the given list is at least 2 and won't exceed 20000. +The input time is legal and ranges from 00:00 to 23:59. +""" +from typing import List + + +class Solution: + def findMinDifference(self, timePoints: List[str]) -> int: + """ + sort and minus + """ + ret = float("inf") + A = list(sorted(map(self.minutes, timePoints))) + n = len(A) + for i in range(n - 1): + ret = min(ret, self.diff(A[i+1], A[i])) + + ret = min(ret, self.diff(A[n-1], A[0])) + return ret + + def diff(self, b, a): + ret = b - a + if ret > 12 * 60: + ret = 24 * 60 - ret + + return ret + + def minutes(self, a): + h, m = a.split(":") + minutes = 60 * int(h) + int(m) + return minutes + + +if __name__ == "__main__": + assert Solution().findMinDifference(["23:59","00:00"]) == 1 diff --git a/540 Single Element in a Sorted Array.py b/540 Single Element in a Sorted Array.py new file mode 100644 index 0000000..c771512 --- /dev/null +++ b/540 Single Element in a Sorted Array.py @@ -0,0 +1,73 @@ +#!/usr/bin/python3 +""" +Given a sorted array consisting of only integers where every element appears +twice except for one element which appears once. Find this single element that +appears only once. + +Example 1: +Input: [1,1,2,3,3,4,4,8,8] +Output: 2 +Example 2: +Input: [3,3,7,7,10,11,11] +Output: 10 +Note: Your solution should run in O(log n) time and O(1) space. +""" +from typing import List +from bisect import bisect_right + + +class Solution: + def singleNonDuplicate(self, nums: List[int]) -> int: + """ + sorted array + + binary search with checking mid odd/even + """ + n = len(nums) + lo, hi = 0, n + while lo < hi: + mid = (lo + hi) // 2 + if ( + mid % 2 == 0 and mid + 1 < hi and nums[mid] == nums[mid + 1] + ) or ( + mid % 2 == 1 and mid - 1 >= lo and nums[mid] == nums[mid - 1] + ): + # to make the target is on the right + # when mid even, mid and mid + 1 form a pair; there are odd number of elements on the right + # when mid odd, mid and mid - 1 form a pair; there are odd number of elements on the right + lo = mid + 1 + else: + hi = mid + + return nums[lo] + + + def singleNonDuplicate_error(self, nums: List[int]) -> int: + """ + sorted array + + consider the expected arry with no exception. The index of each element + should be in the expected position + binary search, compare the searched index and expected index + """ + n = len(nums) + lo, hi = 0, n + while lo < hi: + mid = (lo + hi) // 2 + idx = bisect_right(nums, nums[mid], lo, hi) + if idx <= mid: + hi = mid - 1 + else: + lo = mid + + return nums[hi - 1] + + + def singleNonDuplicate_xor(self, nums: List[int]) -> int: + """ + XOR O(n) + """ + ret = nums[0] + for e in nums[1:]: + ret ^= e + return ret diff --git a/542 01 Matrix.py b/542 01 Matrix.py new file mode 100644 index 0000000..e26f15b --- /dev/null +++ b/542 01 Matrix.py @@ -0,0 +1,113 @@ +""" +Given an m x n binary matrix mat, return the distance of the nearest 0 for each cell. + +The distance between two cells sharing a common edge is 1. + + + +Example 1: + + +Input: mat = [[0,0,0],[0,1,0],[0,0,0]] +Output: [[0,0,0],[0,1,0],[0,0,0]] +Example 2: + + +Input: mat = [[0,0,0],[0,1,0],[1,1,1]] +Output: [[0,0,0],[0,1,0],[1,2,1]] + + +Constraints: + +m == mat.length +n == mat[i].length +1 <= m, n <= 104 +1 <= m * n <= 104 +mat[i][j] is either 0 or 1. +There is at least one 0 in mat. + +Note: This question is the same as 1765: https://leetcode.com/problems/map-of-highest-peak/ +""" +import sys +from collections import deque + + +class SolutionError: + def updateMatrix(self, mat: List[List[int]]) -> List[List[int]]: + """ + * dfs every cell + * with memoization + + dfs + visited + + dfs is wrong + """ + self.mat = mat + self.M = len(mat) + self.N = len(mat[0]) + self.dirs = [(0, -1), (0, 1), (1, 0), (-1, 0)] + visited = [ + [False for _ in range(self.N)] + for _ in range(self.M) + ] + ret = [ + [sys.maxsize for _ in range(self.N)] + for _ in range(self.M) + ] + for i in range(self.M): + for j in range(self.N): + self.nearest(i, j, visited, ret) + + return ret + + def nearest(self, i, j, visited, ret): + if visited[i][j]: + return ret[i][j] + + visited[i][j] = True + if self.mat[i][j] == 0: + ret[i][j] = 0 + return 0 + + for di, dj in self.dirs: + I = i + di + J = j + dj + if 0 <= I < self.M and 0 <= J < self.N: + nbr = self.nearest(I, J, visited, ret) + ret[i][j] = min(ret[i][j], nbr + 1) + + return ret[i][j] + + +class Solution: + def updateMatrix(self, mat: List[List[int]]) -> List[List[int]]: + """ + BFS + """ + q = deque() + M = len(mat) + N = len(mat[0]) + dirs = [(0, 1), (0, -1), (1, 0), (-1, 0)] + ret = [ + [sys.maxsize for _ in range(N)] + for _ in range(M) + ] + for i in range(M): + for j in range(N): + if mat[i][j] == 0: + ret[i][j] = 0 + q.append((i, j)) + + while q: + i, j = q.popleft() + for di, dj in dirs: + I = i + di + J = j + dj + # update nbr + if 0 <= I < M and 0 <= J < N: + cur = ret[i][j] + 1 + if ret[I][J] > cur: + ret[I][J] = cur + q.append((I, J)) # add to pending queue + + return ret diff --git a/543 Diameter of Binary Tree.py b/543 Diameter of Binary Tree.py new file mode 100644 index 0000000..f452773 --- /dev/null +++ b/543 Diameter of Binary Tree.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +Given a binary tree, you need to compute the length of the diameter of the tree. +The diameter of a binary tree is the length of the longest path between any two +nodes in a tree. This path may or may not pass through the root. + +Example: +Given a binary tree + 1 + / \ + 2 3 + / \ + 4 5 +Return 3, which is the length of the path [4,2,1,3] or [5,2,1,3]. + +Note: The length of path between two nodes is represented by the number of edges +between them. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + """ + dfs, return the longest path (#nodes) ended at the subroot/current node + """ + self.ret = 0 + + def diameterOfBinaryTree(self, root: TreeNode) -> int: + self.dfs(root) + return self.ret + + def dfs(self, node): + """ + return #nodes ended at node including itself + """ + if not node: + return 0 + + l = self.dfs(node.left) + r = self.dfs(node.right) + self.ret = max(self.ret, l + 1 + r - 1) # path length is the #nodes - 1 + return max(l, r) + 1 diff --git a/554 Brick Wall.py b/554 Brick Wall.py new file mode 100644 index 0000000..a1ba03a --- /dev/null +++ b/554 Brick Wall.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +There is a brick wall in front of you. The wall is rectangular and has several +rows of bricks. The bricks have the same height but different width. You want to +draw a vertical line from the top to the bottom and cross the least bricks. + +The brick wall is represented by a list of rows. Each row is a list of integers +representing the width of each brick in this row from left to right. + +If your line go through the edge of a brick, then the brick is not considered as +crossed. You need to find out how to draw the line to cross the least bricks and +return the number of crossed bricks. + +You cannot draw a line just along one of the two vertical edges of the wall, in +which case the line will obviously cross no bricks. + +Example: + +Input: [[1,2,2,1], + [3,1,2], + [1,3,2], + [2,4], + [3,1,2], + [1,3,1,1]] + +Output: 2 + +Explanation: +Note: + +The width sum of bricks in different rows are the same and won't exceed INT_MAX. +The number of bricks in each row is in range [1,10,000]. The height of wall is +in range [1,10,000]. Total number of bricks of the wall won't exceed 20,000. +""" +from typing import List +from collections import defaultdict + + +class Solution: + def leastBricks(self, wall: List[List[int]]) -> int: + """ + Iterate and count edge at a position + """ + h = defaultdict(int) + m = len(wall) + for i in range(m): + s = 0 + for j in range(len(wall[i]) - 1): + # don't count the two endings + s += wall[i][j] + h[s] += 1 + + return m - max(h.values() or [0]) diff --git a/556 Next Greater Element III.py b/556 Next Greater Element III.py new file mode 100644 index 0000000..df77185 --- /dev/null +++ b/556 Next Greater Element III.py @@ -0,0 +1,90 @@ +#!/usr/bin/python3 +""" +Given a positive 32-bit integer n, you need to find the smallest 32-bit integer +which has exactly the same digits existing in the integer n and is greater in +value than n. If no such positive 32-bit integer exists, you need to return -1. + +Example 1: + +Input: 12 +Output: 21 + + +Example 2: + +Input: 21 +Output: -1 +""" + + +class Solution: + def nextGreaterElement(self, n: int) -> int: + """ + next permutation + + http://fisherlei.blogspot.com/2012/12/leetcode-next-permutation.html + + why reverse? reverse the increasing from right to left to decreasing + from right to left (i.e. sorted) + """ + seq = list(str(n)) + N = len(seq) + if N < 2: + return -1 + + # from right to left + i = N - 2 + while seq[i] >= seq[i+1]: + i -= 1 + if i < 0: + return -1 + + j = N - 1 + while seq[i] >= seq[j]: + j -= 1 + + seq[i], seq[j] = seq[j], seq[i] + seq[i+1:] = reversed(seq[i+1:]) + ret = int("".join(seq)) + if ret <= 1 << 31 - 1: + return ret + else: + return -1 + + def nextGreaterElement_sort(self, n: int) -> int: + """ + Looking at the decimal digits rather than binary digits + + 2 8 4 1 + 4 1 2 8 + + 2 3 4 1 + 2 4 1 3 + + from right to left + find the first digit that has min larger, then sort the rest + """ + seq = [int(e) for e in str(n)] + stk = [] # record index + for i in range(len(seq) - 1, -1 , -1): + e = seq[i] + popped = None + while stk and seq[stk[-1]] > e: + popped = stk.pop() + + if popped: + seq[i], seq[popped] = seq[popped], seq[i] + seq[i+1:] = sorted(seq[i+1:]) # reversed also good + ret = int("".join(map(str, seq))) + if ret <= 1 << 31 - 1: + return ret + else: + return -1 + + stk.append(i) + + return -1 + + +if __name__ == "__main__": + assert Solution().nextGreaterElement(12) == 21 diff --git a/557 Reverse Words in a String III.py b/557 Reverse Words in a String III.py new file mode 100644 index 0000000..4e80186 --- /dev/null +++ b/557 Reverse Words in a String III.py @@ -0,0 +1,16 @@ +#!/usr/bin/python3 +""" +Given a string, you need to reverse the order of characters in each word within +a sentence while still preserving whitespace and initial word order. + +Example 1: +Input: "Let's take LeetCode contest" +Output: "s'teL ekat edoCteeL tsetnoc" +Note: In the string, each word is separated by single space and there will not +be any extra space in the string. +""" + + +class Solution: + def reverseWords(self, s: str) -> str: + return " ".join(map(lambda x: x[::-1], s.split(" "))) diff --git a/559 Maximum Depth of N-ary Tree.py b/559 Maximum Depth of N-ary Tree.py new file mode 100644 index 0000000..302f403 --- /dev/null +++ b/559 Maximum Depth of N-ary Tree.py @@ -0,0 +1,36 @@ +#!/usr/bin/python3 +""" +Given a n-ary tree, find its maximum depth. + +The maximum depth is the number of nodes along the longest path from the root +node down to the farthest leaf node. + +For example, given a 3-ary tree: + +We should return its max depth, which is 3. + +Note: + +The depth of the tree is at most 1000. +The total number of nodes is at most 5000. +""" + + +# Definition for a Node. +class Node: + def __init__(self, val, children): + self.val = val + self.children = children + + +class Solution: + def maxDepth(self, root: "Node") -> int: + if not root: + return 0 + + max_child_depth = max([ + self.maxDepth(child) + for child in root.children + ] or [0]) + + return max_child_depth + 1 diff --git a/560 Subarray Sum Equals K.py b/560 Subarray Sum Equals K.py new file mode 100644 index 0000000..3645a93 --- /dev/null +++ b/560 Subarray Sum Equals K.py @@ -0,0 +1,32 @@ +#!/usr/bin/python3 +""" +Given an array of integers and an integer k, you need to find the total +number of continuous subarrays whose sum equals to k. + +Example 1: +Input:nums = [1,1,1], k = 2 +Output: 2 +Note: +The length of the array is in range [1, 20,000]. +The range of numbers in the array is [-1000, 1000] and the range of the integer +k is [-1e7, 1e7]. +""" +from typing import List +from collections import defaultdict + + +class Solution: + def subarraySum(self, nums: List[int], k: int) -> int: + """ + prefix sum + """ + h = defaultdict(int) + ret = 0 + s = 0 + h[s] += 1 + for n in nums: + s += n + ret += h[s - k] + h[s] += 1 + + return ret diff --git a/561 Array Partition I.py b/561 Array Partition I.py new file mode 100644 index 0000000..b6de7c5 --- /dev/null +++ b/561 Array Partition I.py @@ -0,0 +1,22 @@ +#!/usr/bin/python3 +""" +Given an array of 2n integers, your task is to group these integers into n +pairs of integer, say (a1, b1), (a2, b2), ..., (an, bn) which makes sum of +min(ai, bi) for all i from 1 to n as large as possible. + +Example 1: +Input: [1,4,3,2] + +Output: 4 +Explanation: n is 2, and the maximum sum of pairs is 4 = min(1, 2) + min(3, 4). +Note: +n is a positive integer, which is in the range of [1, 10000]. +All the integers in the array will be in the range of [-10000, 10000]. +""" +from typing import List + + +class Solution: + def arrayPairSum(self, nums: List[int]) -> int: + nums.sort() + return sum(nums[::2]) diff --git a/563 Binary Tree Tilt.py b/563 Binary Tree Tilt.py new file mode 100644 index 0000000..1e47a99 --- /dev/null +++ b/563 Binary Tree Tilt.py @@ -0,0 +1,51 @@ +#!/usr/bin/python3 +""" +Given a binary tree, return the tilt of the whole tree. + +The tilt of a tree node is defined as the absolute difference between the sum of +all left subtree node values and the sum of all right subtree node values. Null +node has tilt 0. + +The tilt of the whole tree is defined as the sum of all nodes' tilt. + +Example: +Input: + 1 + / \ + 2 3 +Output: 1 +Explanation: +Tilt of node 2 : 0 +Tilt of node 3 : 0 +Tilt of node 1 : |2-3| = 1 +Tilt of binary tree : 0 + 0 + 1 = 1 +Note: + +The sum of node values in any subtree won't exceed the range of 32-bit integer. +All the tilt values won't exceed the range of 32-bit integer. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def findTilt(self, root: TreeNode) -> int: + ret = [0] + self.walk(root, ret) + return ret[0] + + def walk(self, node: TreeNode, ret) -> int: + """get the sum of the subtree and add the tilt""" + if not node: + return 0 + + l = self.walk(node.left, ret) + r = self.walk(node.right, ret) + ret[0] += abs(l - r) + return l + node.val + r diff --git a/565 Array Nesting.py b/565 Array Nesting.py new file mode 100644 index 0000000..c1a00e2 --- /dev/null +++ b/565 Array Nesting.py @@ -0,0 +1,58 @@ +#!/usr/bin/python3 +""" +A zero-indexed array A of length N contains all integers from 0 to N-1. Find and +return the longest length of set S, where S[i] = {A[i], A[A[i]], A[A[A[i]]], ... +} subjected to the rule below. + +Suppose the first element in S starts with the selection of element A[i] of +index = i, the next element in S should be A[A[i]], and then A[A[A[i]]]… By that +analogy, we stop adding right before a duplicate element occurs in S. + + + +Example 1: + +Input: A = [5,4,0,3,1,6,2] +Output: 4 +Explanation: +A[0] = 5, A[1] = 4, A[2] = 0, A[3] = 3, A[4] = 1, A[5] = 6, A[6] = 2. + +One of the longest S[K]: +S[0] = {A[0], A[5], A[6], A[2]} = {5, 6, 2, 0} + + +Note: + +N is an integer within the range [1, 20,000]. +The elements of A are all distinct. +Each element of A is an integer within the range [0, N-1]. +""" +from typing import List + + +class Solution: + def arrayNesting(self, nums: List[int]) -> int: + """ + You can think of it as graph. If circle, then you can start with any + node + """ + visited = set() + ret = 0 + for n in nums: + count = self.dfs(nums, n, set(), visited) + ret = max(ret, count) + + return ret + + def dfs(self, nums, num, path, visited): + if num in visited: + return 0 + + visited.add(num) + path.add(num) # path is subset of visited + self.dfs(nums, nums[num], path, visited) + return len(path) + + +if __name__ == "__main__": + assert Solution().arrayNesting([5,4,0,3,1,6,2]) == 4 diff --git a/566 Reshape the Matrix.py b/566 Reshape the Matrix.py new file mode 100644 index 0000000..794a058 --- /dev/null +++ b/566 Reshape the Matrix.py @@ -0,0 +1,31 @@ +#!/usr/bin/python3 +""" +In MATLAB, there is a very useful function called 'reshape', which can reshape a +matrix into a new one with different size but keep its original data. + +You're given a matrix represented by a two-dimensional array, and two positive +integers r and c representing the row number and column number of the wanted +reshaped matrix, respectively. + +The reshaped matrix need to be filled with all the elements of the original +matrix in the same row-traversing order as they were. + +If the 'reshape' operation with given parameters is possible and legal, output +the new reshaped matrix; Otherwise, output the original matrix. +""" +from typing import List + +class Solution: + def matrixReshape(self, nums: List[List[int]], r: int, c: int) -> List[List[int]]: + m, n = len(nums), len(nums[0]) + if m * n != r * c: + return nums + + ret = [] + for i in range(m): + for j in range(n): + if (i * n + j) % c == 0: + ret.append([]) + ret[-1].append(nums[i][j]) + + return ret diff --git a/567 Permutation in String.py b/567 Permutation in String.py new file mode 100644 index 0000000..3683442 --- /dev/null +++ b/567 Permutation in String.py @@ -0,0 +1,52 @@ +#!/usr/bin/python3 +""" +Given two strings s1 and s2, write a function to return true if s2 contains the +permutation of s1. In other words, one of the first string's permutations is the +substring of the second string. + +Example 1: +Input:s1 = "ab" s2 = "eidbaooo" +Output:True +Explanation: s2 contains one permutation of s1 ("ba"). +Example 2: +Input:s1= "ab" s2 = "eidboaoo" +Output: False +Note: +The input strings only contain lower case letters. +The length of both given strings is in range [1, 10,000]. +""" +from collections import defaultdict + + +class Solution: + def checkInclusion(self, s1: str, s2: str) -> bool: + """ + counter + two pointers + """ + counter = defaultdict(int) + s1_set = set(s1) + for c in s1: + counter[c] += 1 + + i = 0 + j = 0 + while j < len(s2): + if counter[s2[j]] > 0: + counter[s2[j]] -= 1 + if j - i + 1 == len(s1): + return True + j += 1 + else: + if s2[i] in s1_set: + # not check s2[i] in counter, dangerous to check defaultdict + counter[s2[i]] += 1 + i += 1 + if j < i: + j = i + + return False + + +if __name__ == "__main__": + assert Solution().checkInclusion("ab", "eidbaooo") == True + assert Solution().checkInclusion("ab", "eidboaoo") == False diff --git a/576 Out of Boundary Paths.py b/576 Out of Boundary Paths.py new file mode 100644 index 0000000..237baf7 --- /dev/null +++ b/576 Out of Boundary Paths.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +There is an m by n grid with a ball. Given the start coordinate (i,j) of the +ball, you can move the ball to adjacent cell or cross the grid boundary in four +directions (up, down, left, right). However, you can at most move N times. +Find out the number of paths to move the ball out of grid boundary. +The answer may be very large, return it after mod 109 + 7. + +Example 1: + +Input: m = 2, n = 2, N = 2, i = 0, j = 0 +Output: 6 +Explanation: + +Example 2: + +Input: m = 1, n = 3, N = 3, i = 0, j = 1 +Output: 12 +Explanation: + + +Note: + +Once you move the ball out of boundary, you cannot move it back. +The length and height of the grid is in range [1,50]. +N is in range [0,50]. +""" +MOD = 10 ** 9 + 7 +dirs = ((0, 1), (0, -1), (1, 0), (-1, 0)) + + +class Solution: + def findPaths(self, m: int, n: int, N: int, r: int, c: int) -> int: + """ + iterate N epoch + let F[i][j] be the number of paths to reach i, j + F_new[i][j] can be constructed + """ + ret = 0 + F = [[0 for _ in range(n)] for _ in range(m)] + F[r][c] = 1 + for _ in range(N): # epoch + F_new = [[0 for _ in range(n)] for _ in range(m)] + for i in range(m): + for j in range(n): + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n: + F_new[I][J] = (F_new[I][J] + F[i][j]) % MOD + else: + ret = (ret + F[i][j]) % MOD + + F = F_new + + return ret + + +if __name__ == "__main__": + assert Solution().findPaths(2, 2, 2, 0, 0) == 6 + assert Solution().findPaths(1, 3, 3, 0, 1) == 12 diff --git a/581 Shortest Unsorted Continuous Subarray.py b/581 Shortest Unsorted Continuous Subarray.py new file mode 100644 index 0000000..522ed11 --- /dev/null +++ b/581 Shortest Unsorted Continuous Subarray.py @@ -0,0 +1,76 @@ +#!/usr/bin/python3 +""" +Given an integer array, you need to find one continuous subarray that if you +only sort this subarray in ascending order, then the whole array will be sorted +in ascending order, too. + +You need to find the shortest such subarray and output its length. + +Example 1: +Input: [2, 6, 4, 8, 10, 9, 15] +Output: 5 +Explanation: You need to sort [6, 4, 8, 10, 9] in ascending order to make the +whole array sorted in ascending order. + +Note: +Then length of the input array is in range [1, 10,000]. +The input array may contain duplicates, so ascending order here means <=. +""" +from typing import List + + +class Solution: + def findUnsortedSubarray(self, nums: List[int]) -> int: + """ + Sorted at both ends + Then search for the two ends by nums[i+1] > nums[i] on the left side + (right side similar) + + Problem: may over-include, consider 1 2 5 9 4 6 ... + need to shrink from 1 2 5 9 to 1 2 according to min value + + nums[lo - 1] <= min && max <= nums[hi + 1] + """ + n = len(nums) + lo, hi = 0, n - 1 + while lo < hi and nums[lo] <= nums[lo + 1]: + lo += 1 + + while lo < hi and nums[hi - 1] <= nums[hi]: + hi -= 1 + + if hi <= lo: + return 0 + + mini = float('inf') + maxa = -float('inf') + for i in range(lo, hi + 1): + mini = min(mini, nums[i]) + maxa = max(maxa, nums[i]) + + while lo - 1 >= 0 and nums[lo - 1] > mini: + lo -= 1 + while hi + 1 < n and nums[hi + 1] < maxa: + hi += 1 + + return hi - lo + 1 + + def findUnsortedSubarray_sort(self, nums: List[int]) -> int: + """ + Brute force sort and compare O(n lgn) + """ + expected = list(sorted(nums)) + i = 0 + while i < len(nums) and nums[i] == expected[i]: + i += 1 + + j = len(nums) - 1 + while j >= i and nums[j] == expected[j]: + j -= 1 + + return j - i + 1 + + +if __name__ == "__main__": + assert Solution().findUnsortedSubarray([2, 1]) == 2 + assert Solution().findUnsortedSubarray([2, 6, 4, 8, 10, 9, 15]) == 5 diff --git a/583 Delete Operation for Two Strings.py b/583 Delete Operation for Two Strings.py new file mode 100644 index 0000000..1764248 --- /dev/null +++ b/583 Delete Operation for Two Strings.py @@ -0,0 +1,78 @@ +#!/usr/bin/python3 +""" +Given two words word1 and word2, find the minimum number of steps required to +make word1 and word2 the same, where in each step you can delete one character +in either string. + +Example 1: +Input: "sea", "eat" +Output: 2 +Explanation: You need one step to make "sea" to "ea" and another step to make "eat" to "ea". +Note: +The length of given words won't exceed 500. +Characters in given words can only be lower-case letters. +""" +from collections import defaultdict + + +class Solution: + def minDistance(self, word1: str, word2: str) -> int: + """ + Longest Common Subsequence (LCS) + Find the LCS, and delete the char in BOTH strings into LCS + + Let F[i][j] be length of LCS word1[:i] and word2[:j] + + F[i][j] = F[i-1][j-1] + 1 if word1[i-1] == word2[j-1] + F[i][j] = max(F[i-1][j], F[i][j-1]) + """ + F = defaultdict(lambda: defaultdict(int)) + m = len(word1) + n = len(word2) + + for i in range(1, m + 1): + for j in range(1, n + 1): + if word1[i-1] == word2[j-1]: + F[i][j] = F[i-1][j-1] + 1 + else: + F[i][j] = max( + F[i-1][j], + F[i][j-1], + ) + + return m - F[m][n] + n - F[m][n] + + def minDistance_edit_distance(self, word1: str, word2: str) -> int: + """ + Edit distance + + Let F[i][j] be # operations to make same for word1[:i] and word2[:j] + + F[i][j] = F[i-1][j-1] if word1[i-1] == word2[j-1] + F[i][j] = min(F[i-1][j] + 1, F[i][j-1] + 1) + """ + F = defaultdict(lambda: defaultdict(int)) + m = len(word1) + n = len(word2) + + # initialization is important + for i in range(1, m + 1): + F[i][0] = i + for j in range(1, n + 1): + F[0][j] = j + + for i in range(1, m + 1): + for j in range(1, n + 1): + if word1[i-1] == word2[j-1]: + F[i][j] = F[i-1][j-1] + else: + F[i][j] = min( + F[i-1][j] + 1, + F[i][j-1] + 1, + ) + + return F[m][n] + + +if __name__ == "__main__": + assert Solution().minDistance("sea", "eat") == 2 diff --git a/588 Design In-Memory File System.py b/588 Design In-Memory File System.py new file mode 100644 index 0000000..31b4fb0 --- /dev/null +++ b/588 Design In-Memory File System.py @@ -0,0 +1,74 @@ +#!/usr/bin/python3 +""" +Design an in-memory file system to simulate the following functions: + +ls: Given a path in string format. If it is a file path, return a list that only +contains this file's name. If it is a directory path, return the list of file +and directory names in this directory. Your output (file and directory names +together) should in lexicographic order. + +mkdir: Given a directory path that does not exist, you should make a new +directory according to the path. If the middle directories in the path don't +exist either, you should create them as well. This function has void return type. + +addContentToFile: Given a file path and file content in string format. If the +file doesn't exist, you need to create that file containing given content. If +the file already exists, you need to append given content to original content. +This function has void return type. + +readContentFromFile: Given a file path, return its content in string format. + + + +Example: + +Input: +["FileSystem","ls","mkdir","addContentToFile","ls","readContentFromFile"] +[[],["/"],["/a/b/c"],["/a/b/c/d","hello"],["/"],["/a/b/c/d"]] + +Output: +[null,[],null,null,["a"],"hello"] + +Explanation: +filesystem + + +Note: +You can assume all file or directory paths are absolute paths which begin with +/ and do not end with / except that the path is just "/". +You can assume that all operations will be passed valid parameters and users +will not attempt to retrieve file content or list a directory or file that does +not exist. +You can assume that all directory names and file names only contain lower-case +letters, and same names won't exist in the same directory. +""" +from typing import List + + +class FileSystem: + def __init__(self): + """ + n-ary tree (trie) + sort then sort every time + """ + + + def ls(self, path: str) -> List[str]: + + + def mkdir(self, path: str) -> None: + + + def addContentToFile(self, filePath: str, content: str) -> None: + + + def readContentFromFile(self, filePath: str) -> str: + + + +# Your FileSystem object will be instantiated and called as such: +# obj = FileSystem() +# param_1 = obj.ls(path) +# obj.mkdir(path) +# obj.addContentToFile(filePath,content) +# param_4 = obj.readContentFromFile(filePath) diff --git a/589 N-ary Tree Preorder Traversal.py b/589 N-ary Tree Preorder Traversal.py new file mode 100644 index 0000000..1659cb7 --- /dev/null +++ b/589 N-ary Tree Preorder Traversal.py @@ -0,0 +1,40 @@ +#!/usr/bin/python3 +""" +Given an n-ary tree, return the preorder traversal of its nodes' values. + +For example, given a 3-ary tree: + +Return its preorder traversal as: [1,3,5,6,2,4]. + +Note: +Recursive solution is trivial, could you do it iteratively? +""" + + +# Definition for a Node. +class Node: + def __init__(self, val, children): + self.val = val + self.children = children + + +from typing import List + + +class Solution: + def preorder(self, root: "Node") -> List[int]: + """ + reversely add the children to stk + """ + ret = [] + if not root: + return ret + + stk = [root] + while stk: + cur = stk.pop() + ret.append(cur.val) + for c in reversed(cur.children): + stk.append(c) + + return ret diff --git a/590 N-ary Tree Postorder Traversal.py b/590 N-ary Tree Postorder Traversal.py new file mode 100644 index 0000000..f75d850 --- /dev/null +++ b/590 N-ary Tree Postorder Traversal.py @@ -0,0 +1,64 @@ +#!/usr/bin/python3 +""" +Given an n-ary tree, return the postorder traversal of its nodes' values. + +For example, given a 3-ary tree: + +Return its postorder traversal as: [5,6,3,2,4,1]. + +Note: +Recursive solution is trivial, could you do it iteratively? +""" + + +# Definition for a Node. +class Node: + def __init__(self, val, children): + self.val = val + self.children = children + + +from typing import List +from collections import deque + + +class Solution: + def postorder(self, root: 'Node') -> List[int]: + """ + maintain a stack, pop and reverse + """ + if not root: + return [] + + ret = deque() + stk = [root] + visited = set() + while stk: + cur = stk.pop() + ret.appendleft(cur.val) + for c in cur.children: + stk.append(c) + + return list(ret) + + def postorder_visited(self, root: 'Node') -> List[int]: + """ + maintain a stack, if visited before, then pop + """ + ret = [] + if not root: + return ret + + stk = [root] + visited = set() + while stk: + cur = stk[-1] + if cur in visited: + stk.pop() + ret.append(cur.val) + else: + visited.add(cur) + for c in reversed(cur.children): + stk.append(c) + + return ret diff --git a/594 Longest Harmonious Subsequence.py b/594 Longest Harmonious Subsequence.py new file mode 100644 index 0000000..62f2f84 --- /dev/null +++ b/594 Longest Harmonious Subsequence.py @@ -0,0 +1,34 @@ +#!/usr/bin/python3 +""" +We define a harmonious array is an array where the difference between its +maximum value and its minimum value is exactly 1. + +Now, given an integer array, you need to find the length of its longest +harmonious subsequence among all its possible subsequences. + +Example 1: +Input: [1,3,2,2,5,2,3,7] +Output: 5 + +Explanation: The longest harmonious subsequence is [3,2,2,2,3]. +Note: The length of the input array will not exceed 20,000. +""" +from typing import List +from collections import defaultdict + + +class Solution: + def findLHS(self, nums: List[int]) -> int: + """ + counter and iterate + """ + counter = defaultdict(int) + for n in nums: + counter[n] += 1 + + ret = 0 + for k, v in counter.items(): + if k + 1 in counter: + ret = max(ret, v + counter[k + 1]) + + return ret diff --git a/599 Minimum Index Sum of Two Lists.py b/599 Minimum Index Sum of Two Lists.py new file mode 100644 index 0000000..bfd2fa3 --- /dev/null +++ b/599 Minimum Index Sum of Two Lists.py @@ -0,0 +1,48 @@ +#!/usr/bin/python3 +""" +Suppose Andy and Doris want to choose a restaurant for dinner, and they both +have a list of favorite restaurants represented by strings. + +You need to help them find out their common interest with the least list index +sum. If there is a choice tie between answers, output all of them with no order +requirement. You could assume there always exists an answer. + +Example 1: +Input: +["Shogun", "Tapioca Express", "Burger King", "KFC"] +["Piatti", "The Grill at Torrey Pines", "Hungry Hunter Steakhouse", "Shogun"] +Output: ["Shogun"] +Explanation: The only restaurant they both like is "Shogun". +Example 2: +Input: +["Shogun", "Tapioca Express", "Burger King", "KFC"] +["KFC", "Shogun", "Burger King"] +Output: ["Shogun"] +Explanation: The restaurant they both like and have the least index sum is "Shogun" with index sum 1 (0+1). +Note: +The length of both lists will be in the range of [1, 1000]. +The length of strings in both lists will be in the range of [1, 30]. +The index is starting from 0 to the list length minus 1. +No duplicates in both lists. +""" +from typing import List + + +class Solution: + def findRestaurant(self, list1: List[str], list2: List[str]) -> List[str]: + index = {} + for i, v in enumerate(list2): + index[v] = i + + ret = [] + mini = float('inf') + for i, v in enumerate(list1): + if v in index: + cur = i + index[v] # current index sum + if cur < mini: + mini = cur + ret = [v] + elif cur == mini: + ret.append(v) + + return ret diff --git a/605 Can Place Flowers.py b/605 Can Place Flowers.py new file mode 100644 index 0000000..658816e --- /dev/null +++ b/605 Can Place Flowers.py @@ -0,0 +1,44 @@ +#!/usr/bin/python3 +""" +Suppose you have a long flowerbed in which some of the plots are planted and +some are not. However, flowers cannot be planted in adjacent plots - they would +compete for water and both would die. + +Given a flowerbed (represented as an array containing 0 and 1, where 0 means +empty and 1 means not empty), and a number n, return if n new flowers can be +planted in it without violating the no-adjacent-flowers rule. + +Example 1: +Input: flowerbed = [1,0,0,0,1], n = 1 +Output: True +Example 2: +Input: flowerbed = [1,0,0,0,1], n = 2 +Output: False +Note: +The input array won't violate no-adjacent-flowers rule. +The input array size is in the range of [1, 20000]. +n is a non-negative integer which won't exceed the input array size. +""" +from typing import List + + +class Solution: + def canPlaceFlowers(self, flowerbed: List[int], n: int) -> bool: + """ + greedy + """ + if n == 0: + return True + + for i in range(len(flowerbed)): + if ( + flowerbed[i] != 1 and + (i + 1 >= len(flowerbed) or flowerbed[i+1] != 1) and + (i - 1 < 0 or flowerbed[i - 1] != 1) + ): + n -= 1 + flowerbed[i] = 1 + if n == 0: + return True + + return False diff --git a/606 Construct String from Binary Tree.py b/606 Construct String from Binary Tree.py new file mode 100644 index 0000000..d843c90 --- /dev/null +++ b/606 Construct String from Binary Tree.py @@ -0,0 +1,58 @@ +#!/usr/bin/python3 +""" +You need to construct a string consists of parenthesis and integers from a +binary tree with the preorder traversing way. + +The null node needs to be represented by empty parenthesis pair "()". And you +need to omit all the empty parenthesis pairs that don't affect the one-to-one mapping relationship between the string and the original binary tree. + +Example 1: +Input: Binary tree: [1,2,3,4] + 1 + / \ + 2 3 + / + 4 + +Output: "1(2(4))(3)" + +Explanation: Originallay it needs to be "1(2(4)())(3()())", +but you need to omit all the unnecessary empty parenthesis pairs. +And it will be "1(2(4))(3)". +Example 2: +Input: Binary tree: [1,2,3,null,4] + 1 + / \ + 2 3 + \ + 4 + +Output: "1(2()(4))(3)" + +Explanation: Almost the same as the first example, +except we can't omit the first parenthesis pair to break the one-to-one mapping +relationship between the input and the output. +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def tree2str(self, t: TreeNode) -> str: + if not t: + return "" + + left = self.tree2str(t.left) + right = self.tree2str(t.right) + ret = [str(t.val)] + if left or right: + ret.append("(" + left + ")") + if right: + ret.append("(" + right + ")") + + return "".join(ret) diff --git a/609 Find Duplicate File in System.py b/609 Find Duplicate File in System.py new file mode 100644 index 0000000..e69de29 diff --git a/611 Valid Triangle Number.py b/611 Valid Triangle Number.py new file mode 100644 index 0000000..a0b9bd5 --- /dev/null +++ b/611 Valid Triangle Number.py @@ -0,0 +1,99 @@ +#!/usr/bin/python3 +""" +Given an array consists of non-negative integers, your task is to count the +number of triplets chosen from the array that can make triangles if we take them +as side lengths of a triangle. + +Example 1: +Input: [2,2,3,4] +Output: 3 +Explanation: +Valid combinations are: +2,3,4 (using the first 2) +2,3,4 (using the second 2) +2,2,3 +Note: +The length of the given array won't exceed 1000. +The integers in the given array are in the range of [0, 1000]. +""" +from typing import List + + +class Solution: + def triangleNumber(self, nums: List[int]) -> int: + """ + b - a < c < a + b + Brute force O(n^3) + + 3 sums + Three-pointers + O(n^2) + """ + ret = 0 + nums.sort() + n = len(nums) + for k in range(n-1, 1, -1): + i = 0 + j = k - 1 + while i < j: + if nums[i] + nums[j] > nums[k]: + ret += j - i # move i will always satisfy the constraint + j -= 1 # to break + else: + i += 1 # to satisfy + + return ret + + def triangleNumber_error(self, nums: List[int]) -> int: + """ + b - a < c < a + b + Brute force O(n^3) + + 3 sums + Three-pointers + O(n^2) + """ + ret = 0 + nums.sort() + n = len(nums) + for i in range(n - 2): + j = i + 1 + k = n - 1 + while j < k: + # error, since move k will not break the formula + if nums[i] + nums[j] > nums[k]: + ret += k - j + k -= 1 + else: + j += 1 + + return ret + + def triangleNumber_slow(self, nums: List[int]) -> int: + """ + b - a < c < a + b + Brute force O(n^3) + + Cache + Prune + """ + cache = {} + nums.sort() + n = len(nums) + ret = 0 + for i in range(n): + for j in range(i + 1, n): + if (i, j) not in cache: + cur = 0 + for k in range(j + 1, n): + if nums[k] < nums[i] + nums[j]: + cur += 1 + else: + break + cache[(i, j)] = cur + ret += cache[(i, j)] + + return ret + + +if __name__ == "__main__": + assert Solution().triangleNumber([2,2,3,4]) == 3 diff --git a/617 Merge Two Binary Trees.py b/617 Merge Two Binary Trees.py new file mode 100644 index 0000000..2d633f5 --- /dev/null +++ b/617 Merge Two Binary Trees.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +Given two binary trees and imagine that when you put one of them to cover the +other, some nodes of the two trees are overlapped while the others are not. + +You need to merge them into a new binary tree. The merge rule is that if two +nodes overlap, then sum node values up as the new value of the merged node. +Otherwise, the NOT null node will be used as the node of new tree. + +Example 1: + +Input: + Tree 1 Tree 2 + 1 2 + / \ / \ + 3 2 1 3 + / \ \ + 5 4 7 +Output: +Merged tree: + 3 + / \ + 4 5 + / \ \ + 5 4 7 + + +Note: The merging process must start from the root nodes of both trees. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def mergeTrees(self, t1: TreeNode, t2: TreeNode) -> TreeNode: + if not t1 and not t2: + return + + node = TreeNode(0) + node.val += t1 and t1.val or 0 + node.val += t2 and t2.val or 0 + node.left = self.mergeTrees(t1 and t1.left, t2 and t2.left) + node.right = self.mergeTrees(t1 and t1.right, t2 and t2.right) + return node diff --git a/621 Task Scheduler.py b/621 Task Scheduler.py new file mode 100644 index 0000000..226cf55 --- /dev/null +++ b/621 Task Scheduler.py @@ -0,0 +1,101 @@ +#!/usr/bin/python3 +""" +Given a char array representing tasks CPU need to do. It contains capital +letters A to Z where different letters represent different tasks. Tasks could be +done without original order. Each task could be done in one interval. For each +interval, CPU could finish one task or just be idle. + +However, there is a non-negative cooling interval n that means between two same +tasks, there must be at least n intervals that CPU are doing different tasks or +just be idle. + +You need to return the least number of intervals the CPU will take to finish all +the given tasks. + +Example: + +Input: tasks = ["A","A","A","B","B","B"], n = 2 +Output: 8 +Explanation: A -> B -> idle -> A -> B -> idle -> A -> B. + +Note: + +The number of tasks is in the range [1, 10000]. +The integer n is in the range [0, 100]. +""" +from typing import List +from collections import deque, defaultdict +import heapq + + +class Solution: + def leastInterval(self, tasks: List[str], n: int) -> int: + """ + Gap is n + + Find the idle count + + use the max letter to construct page, # of page is max - 1 + (need also consider duplicate) + + Each page size is n + 1 + Free page size is n + 1 - (# of max) + Find the idle count + """ + counter = defaultdict(int) + for t in tasks: + counter[t] += 1 + + maxa = 0 + max_cnt = 0 + for v in counter.values(): + if v > maxa: + maxa = v + max_cnt = 1 + elif v == maxa: + max_cnt += 1 + + page_cnt = maxa - 1 + free_page_size = n + 1 - max_cnt + small_tasks = len(tasks) - max_cnt * maxa + idle = max(0, page_cnt * free_page_size - small_tasks) + return len(tasks) + idle + + + def leastInterval_complicated(self, tasks: List[str], n: int) -> int: + """ + greedy + max heap, most tasks first + cool down queue + """ + counter = defaultdict(int) + for t in tasks: + counter[t] += 1 + + pq = [ + (-v, k) + for k, v in counter.items() + ] + heapq.heapify(pq) + q = deque() # stores (t, k) + clock = 0 + while pq or q: + if q and q[0][0] <= clock: + # don't do while in while when clock++ + _, k = q.popleft() + heapq.heappush(pq, (-counter[k], k)) + + if pq: + _, k = heapq.heappop(pq) + counter[k] -= 1 + if counter[k] > 0: + q.append((clock + 1 + n, k)) + + clock += 1 + + return clock + + +if __name__ == "__main__": + assert Solution().leastInterval(["A","A","A","B","B","B"], 0) == 6 + assert Solution().leastInterval(["A","A","A","B","B","B"], 2) == 8 diff --git a/622 Design Circular Queue.py b/622 Design Circular Queue.py new file mode 100644 index 0000000..a376971 --- /dev/null +++ b/622 Design Circular Queue.py @@ -0,0 +1,98 @@ +#!/usr/bin/python3 +""" +Design your implementation of the circular queue. The circular queue is a +linear data structure in which the operations are performed based on FIFO (First +In First Out) principle and the last position is connected back to the first +position to make a circle. It is also called "Ring Buffer". + +One of the benefits of the circular queue is that we can make use of the spaces +in front of the queue. In a normal queue, once the queue becomes full, we cannot +insert the next element even if there is a space in front of the queue. But +using the circular queue, we can use the space to store new values. + +Your implementation should support following operations: + +MyCircularQueue(k): Constructor, set the size of the queue to be k. +Front: Get the front item from the queue. If the queue is empty, return -1. +Rear: Get the last item from the queue. If the queue is empty, return -1. +enQueue(value): Insert an element into the circular queue. Return true if the +operation is successful. +deQueue(): Delete an element from the circular queue. Return true if the +operation is successful. +isEmpty(): Checks whether the circular queue is empty or not. +isFull(): Checks whether the circular queue is full or not. +""" + + +class MyCircularQueue: + + def __init__(self, k: int): + """ + Initialize your data structure here. Set the size of the queue to be k. + """ + self.head = 0 + self.tail = -1 + self.sz = 0 + self.k = k + self.lst = [None for _ in range(k)] + + + def enQueue(self, value: int) -> bool: + """ + Insert an element into the circular queue. Return true if the operation is successful. + """ + if self.sz >= self.k: + return False + + self.tail += 1 + self.lst[self.tail % self.k] = value + self.sz += 1 + return True + + def deQueue(self) -> bool: + """ + Delete an element from the circular queue. Return true if the operation is successful. + """ + if self.sz <= 0: + return False + + self.lst[self.head % self.k] = None + self.head += 1 + self.sz -= 1 + return True + + def Front(self) -> int: + """ + Get the front item from the queue. + """ + ret = self.lst[self.head % self.k] + return ret if ret is not None else -1 + + def Rear(self) -> int: + """ + Get the last item from the queue. + """ + ret = self.lst[self.tail % self.k] + return ret if ret is not None else -1 + + def isEmpty(self) -> bool: + """ + Checks whether the circular queue is empty or not. + """ + return self.sz == 0 + + def isFull(self) -> bool: + """ + Checks whether the circular queue is full or not. + """ + return self.sz == self.k + + +# Your MyCircularQueue object will be instantiated and called as such: +# obj = MyCircularQueue(k) +# param_1 = obj.enQueue(value) +# param_2 = obj.deQueue() +# param_3 = obj.Front() +# param_4 = obj.Rear() +# param_5 = obj.isEmpty() +# param_6 = obj.isFull() diff --git a/623 Add One Row to Tree.py b/623 Add One Row to Tree.py new file mode 100644 index 0000000..bbf4947 --- /dev/null +++ b/623 Add One Row to Tree.py @@ -0,0 +1,108 @@ +#!/usr/bin/python3 +""" +Given the root of a binary tree, then value v and depth d, you need to add a row +of nodes with value v at the given depth d. The root node is at depth 1. + +The adding rule is: given a positive integer depth d, for each NOT null tree +nodes N in depth d-1, create two tree nodes with value v as N's left subtree +root and right subtree root. And N's original left subtree should be the left +subtree of the new left subtree root, its original right subtree should be the +right subtree of the new right subtree root. If depth d is 1 that means there is +no depth d-1 at all, then create a tree node with value v as the new root of the +whole original tree, and the original tree is the new root's left subtree. + +Example 1: +Input: +A binary tree as following: + 4 + / \ + 2 6 + / \ / + 3 1 5 + +v = 1 + +d = 2 + +Output: + 4 + / \ + 1 1 + / \ + 2 6 + / \ / + 3 1 5 + +Example 2: +Input: +A binary tree as following: + 4 + / + 2 + / \ + 3 1 + +v = 1 + +d = 3 + +Output: + 4 + / + 2 + / \ + 1 1 + / \ +3 1 +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def addOneRow(self, root: TreeNode, v: int, d: int) -> TreeNode: + return self.add(root, v, d, 1, "left") + + def add(self, node, v, d, cur_d, child) -> TreeNode: + # use the return value for parent's reference + if cur_d == d: + new = TreeNode(v) + setattr(new, child, node) + return new + + if node: + node.left = self.add(node.left, v, d, cur_d + 1, "left") + node.right = self.add(node.right, v, d, cur_d + 1, "right") + return node + + +class Solution2: + def addOneRow(self, root: TreeNode, v: int, d: int) -> TreeNode: + if d == 1: + node = TreeNode(v) + node.left = root + return node + + self.add(self, root, v, d, 1) + return root + + def add(self, node, v, d, cur_d) -> None: + if not node: + return + + if cur_d + 1 == d: + left = node.left + right = node.right + node.left = TreeNode(v) + node.left.left = left + node.right = TreeNode(v) + node.right.right = right + + self.add(node.left, v, d, cur_d + 1) + self.add(node.right, v, d, cur_d + 1) diff --git a/628 Maximum Product of Three Numbers.py b/628 Maximum Product of Three Numbers.py new file mode 100644 index 0000000..02caaf4 --- /dev/null +++ b/628 Maximum Product of Three Numbers.py @@ -0,0 +1,40 @@ +#!/usr/bin/python3 +""" +Given an integer array, find three numbers whose product is maximum and output +the maximum product. + +Example 1: + +Input: [1,2,3] +Output: 6 + + +Example 2: + +Input: [1,2,3,4] +Output: 24 + + +Note: + +The length of the given array will be in range [3,104] and all elements are in +the range [-1000, 1000]. +Multiplication of any three numbers in the input won't exceed the range of +32-bit signed integer. +""" +import heapq + +from typing import List + + +class Solution: + def maximumProduct(self, nums: List[int]) -> int: + """ + heapq nlargest nsmallest + """ + mxes = heapq.nlargest(3, nums) + mns = heapq.nsmallest(3, nums) + return max( + mxes[0] * mxes[1] * mxes[2], + mns[0] * mns[1] * mxes[0], + ) diff --git a/635 Design Log Storage System.py b/635 Design Log Storage System.py new file mode 100644 index 0000000..8d65351 --- /dev/null +++ b/635 Design Log Storage System.py @@ -0,0 +1,76 @@ +#!/usr/bin/python3 +""" +You are given several logs that each log contains a unique id and timestamp. +Timestamp is a string that has the following format: +Year:Month:Day:Hour:Minute:Second, for example, 2017:01:01:23:59:59. All domains +are zero-padded decimal numbers. + +Design a log storage system to implement the following functions: + +void Put(int id, string timestamp): Given a log's unique id and timestamp, store +the log in your storage system. + + +int[] Retrieve(String start, String end, String granularity): Return the id of +logs whose timestamps are within the range from start to end. Start and end all +have the same format as timestamp. However, granularity means the time level for +consideration. For example, start = "2017:01:01:23:59:59", end = +"2017:01:02:23:59:59", granularity = "Day", it means that we need to find the +logs within the range from Jan. 1st 2017 to Jan. 2nd 2017. + +Example 1: +put(1, "2017:01:01:23:59:59"); +put(2, "2017:01:01:22:59:59"); +put(3, "2016:01:01:00:00:00"); +retrieve("2016:01:01:01:01:01","2017:01:01:23:00:00","Year"); // return [1,2,3], +because you need to return all logs within 2016 and 2017. +retrieve("2016:01:01:01:01:01","2017:01:01:23:00:00","Hour"); // return [1,2], +because you need to return all logs start from 2016:01:01:01 to 2017:01:01:23, +where log 3 is left outside the range. + +Note: +There will be at most 300 operations of Put or Retrieve. +Year ranges from [2000,2017]. Hour ranges from [00,23]. +Output for Retrieve has no order required. +""" +import bisect + + +class LogSystem: + def __init__(self): + """ + BST - TreeMap (java) + binary search using time stamp + """ + self.lst = [] + + def put(self, id: int, timestamp: str) -> None: + bisect.insort(self.lst, (timestamp, id)) + + def retrieve(self, s: str, e: str, gra: str) -> List[int]: + """ + Use timestamp comparison + Can convert the timestamp to number. + """ + lo = "0001:01:01:00:00:00" + hi = "9999:12:31:23:59:59" + pre = { + "Year": 4, + "Month": 7, + "Day": 10, + "Hour": 13, + "Minute": 16, + "Second": 19, + }[gra] + + s = s[:pre] + lo[pre:] + e = e[:pre] + hi[pre:] + i = bisect.bisect_left(self.lst, (s, 0)) + j = bisect.bisect_right(self.lst, (e, float("inf"))) + return [id for _, id in self.lst[i:j]] + + +# Your LogSystem object will be instantiated and called as such: +# obj = LogSystem() +# obj.put(id,timestamp) +# param_2 = obj.retrieve(s,e,gra) diff --git a/637 Average of Levels in Binary Tree.py b/637 Average of Levels in Binary Tree.py new file mode 100644 index 0000000..ea43ab0 --- /dev/null +++ b/637 Average of Levels in Binary Tree.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +Given a non-empty binary tree, return the average value of the nodes on each +level in the form of an array. +Example 1: +Input: + 3 + / \ + 9 20 + / \ + 15 7 +Output: [3, 14.5, 11] +Explanation: +The average value of nodes on level 0 is 3, on level 1 is 14.5, and on level 2 +is 11. Hence return [3, 14.5, 11]. +Note: +The range of node's value is in the range of 32-bit signed integer. +""" +from typing import List + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def averageOfLevels(self, root: TreeNode) -> List[float]: + """ + BFS + """ + ret = [] + if not root: + return ret + + q = [root] + while q: + n = len(q) + avg = sum(map(lambda node: node.val, q)) / n + ret.append(avg) + cur_q = [] + for node in q: + if node.left: + cur_q.append(node.left) + if node.right: + cur_q.append(node.right) + + q = cur_q + + return ret diff --git a/643 Maximum Average Subarray I.py b/643 Maximum Average Subarray I.py new file mode 100644 index 0000000..969aafc --- /dev/null +++ b/643 Maximum Average Subarray I.py @@ -0,0 +1,36 @@ +#!/usr/bin/python3 +""" +Given an array consisting of n integers, find the contiguous subarray of given +length k that has the maximum average value. And you need to output the maximum +average value. + +Example 1: + +Input: [1,12,-5,-6,50,3], k = 4 +Output: 12.75 +Explanation: Maximum average is (12-5-6+50)/4 = 51/4 = 12.75 + + +Note: + +1 <= k <= n <= 30,000. +Elements of the given array will be in the range [-10,000, 10,000]. +""" +from typing import List + + +class Solution: + def findMaxAverage(self, nums: List[int], k: int) -> float: + """ + two pointers + """ + cur_sum = sum(nums[:k]) + maxa = cur_sum + i = k + while i < len(nums): + cur_sum += nums[i] + cur_sum -= nums[i-k] + maxa = max(maxa, cur_sum) + i += 1 + + return maxa / k diff --git a/645 Set Mismatch.py b/645 Set Mismatch.py new file mode 100644 index 0000000..300bfa8 --- /dev/null +++ b/645 Set Mismatch.py @@ -0,0 +1,52 @@ +#!/usr/bin/python3 +""" +The set S originally contains numbers from 1 to n. But unfortunately, due to the +data error, one of the numbers in the set got duplicated to another number in +the set, which results in repetition of one number and loss of another number. + +Given an array nums representing the data status of this set after the error. +Your task is to firstly find the number occurs twice and then find the number +that is missing. Return them in the form of an array. + +Example 1: +Input: nums = [1,2,2,4] +Output: [2,3] +Note: +The given array size will in the range [2, 10000]. +The given array's numbers won't have any order. +""" +from typing import List + + +class Solution: + def findErrorNums(self, nums: List[int]) -> List[int]: + """ + https://leetcode.com/problems/set-mismatch/discuss/113999/C%2B%2B-True-O(1)-space-O(n)-time-(No-input-modifying)-with-clear-explanation + """ + n = len(nums) + acc0 = 0 # a ^ b + for i in range(n): + acc0 ^= nums[i] + acc0 ^= i + 1 + + first_1 = acc0 & - acc0 # 2's complement, invert the bit left to the first 1 from the right + # go through the arrays once again and split them in 2 categories, if they have that bit set or not + # xor them to get a or b + acc1 = 0 + acc2 = 0 + for i in range(n): + if nums[i] & first_1: + acc1 ^= nums[i] + else: + acc2 ^= nums[i] + + if (i + 1) & first_1: + acc1 ^= i + 1 + else: + acc2 ^= i + 1 + + for i in range(n): + if nums[i] == acc1: + return [acc1, acc2] + + return [acc2, acc1] diff --git a/646 Maximum Length of Pair Chain.py b/646 Maximum Length of Pair Chain.py new file mode 100644 index 0000000..23e01ce --- /dev/null +++ b/646 Maximum Length of Pair Chain.py @@ -0,0 +1,85 @@ +#!/usr/bin/python3 +""" +You are given n pairs of numbers. In every pair, the first number is always +smaller than the second number. + +Now, we define a pair (c, d) can follow another pair (a, b) if and only if +b < c. Chain of pairs can be formed in this fashion. + +Given a set of pairs, find the length longest chain which can be formed. You +needn't use up all the given pairs. You can select pairs in any order. + +Example 1: +Input: [[1,2], [2,3], [3,4]] +Output: 2 +Explanation: The longest chain is [1,2] -> [3,4] +Note: +The number of given pairs will be in the range [1, 1000]. +""" +from typing import List + + +class Solution: + def findLongestChain(self, pairs: List[List[int]]) -> int: + """ + Greedy + sort by the interval end + similar to 435 Non-overlaping interval + O(nlg n) + O(n) + """ + pairs.sort(key=lambda x: x[1]) + n = len(pairs) + + ret = 0 + cur_end = -float("inf") + for i in range(n): + if pairs[i][0] <= cur_end: + continue + + cur_end = pairs[i][1] + ret += 1 + + return ret + + def findLongestChain2(self, pairs: List[List[int]]) -> int: + """ + Greedy + sort by the interval end + similar to 435 Non-overlaping interval + """ + pairs.sort(key=lambda x: x[1]) + n = len(pairs) + + ret = 0 + i = 0 + while i < n: + ret += 1 + cur_end = pairs[i][1] + + i += 1 + while i < n and pairs[i][0] <= cur_end: + i += 1 + + return ret + + +class Solution2: + def findLongestChain(self, pairs: List[List[int]]) -> int: + """ + Let F[i] be the longest chain ended at A[i] + F[i] = max(F[j] + 1 if predicate A[i] A[j]) + O(N^2) + """ + pairs.sort(key=lambda x: tuple(x)) + n = len(pairs) + F = [1 for _ in range(n)] + for i in range(n): + for j in range(i): + if pairs[j][1] < pairs[i][0]: + F[i] = max(F[i], F[j] + 1) + + return max(F) + + +if __name__ == "__main__": + assert Solution().findLongestChain([[1,2], [2,3], [3,4]]) == 2 diff --git a/647 Palindromic Substrings.py b/647 Palindromic Substrings.py new file mode 100644 index 0000000..582b656 --- /dev/null +++ b/647 Palindromic Substrings.py @@ -0,0 +1,59 @@ +#!/usr/bin/python3 +""" +Given a string, your task is to count how many palindromic substrings in this +string. + +The substrings with different start indexes or end indexes are counted as +different substrings even they consist of same characters. + +Example 1: +Input: "abc" +Output: 3 +Explanation: Three palindromic strings: "a", "b", "c". +Example 2: +Input: "aaa" +Output: 6 +Explanation: Six palindromic strings: "a", "a", "a", "aa", "aa", "aaa". +Note: +The input string length won't exceed 1000. +""" +from collections import defaultdict + + +class Solution: + def countSubstrings(self, s): + """ + for every s[i:j], check whether it is a palindrome + O(n^2 * n) + + DP + Let F[i][j] be whether s[i:j] is a palindrome + F[i][j] = F[i+1][j-1] if s[i] == s[j-1] + else False + + :type s: str + :rtype: int + """ + F = defaultdict(lambda: defaultdict(bool)) + n = len(s) + for i in range(n): + F[i][i] = True + F[i][i+1] = True + + for i in range(n-1, -1, -1): + for j in range(i+2, n+1): + if s[i] == s[j-1]: + F[i][j] = F[i+1][j-1] + else: + F[i][j] = False + + return sum( + 1 + for i in range(n) + for j in range(i+1, n+1) + if F[i][j] + ) + + +if __name__ == "__main__": + assert Solution().countSubstrings("aaa") == 6 diff --git a/648 Replace Words.py b/648 Replace Words.py new file mode 100644 index 0000000..95682aa --- /dev/null +++ b/648 Replace Words.py @@ -0,0 +1,93 @@ +#!/usr/bin/python3 +""" +In English, we have a concept called root, which can be followed by some other +words to form another longer word - let's call this word successor. For example, +the root an, followed by other, which can form another word another. + +Now, given a dictionary consisting of many roots and a sentence. You need to +replace all the successor in the sentence with the root forming it. If a +successor has many roots can form it, replace it with the root with the shortest +length. + +You need to output the sentence after the replacement. + +Example 1: + +Input: dict = ["cat", "bat", "rat"] +sentence = "the cattle was rattled by the battery" +Output: "the cat was rat by the bat" + + +Note: + +The input will only have lower-case letters. +1 <= dict words number <= 1000 +1 <= sentence words number <= 1000 +1 <= root length <= 100 +1 <= sentence words length <= 1000 +""" +from typing import List +from collections import defaultdict + + +class Node: + def __init__(self, chr): + self.chr = chr + self.ended = False + self.children = defaultdict(lambda: None) + + +class Trie: + def __init__(self): + self.root = Node(None) # dummy + + @classmethod + def insert(cls, node, w, i): + if not node: + node = Node(w[i]) + + if i == len(w) - 1: + node.ended = True + else: + nxt = w[i + 1] + node.children[nxt] = cls.insert(node.children[nxt], w, i + 1) + + return node + + @classmethod + def search(cls, node, w, i): + if not node: + return + + if node.chr != w[i]: + return + + if node.ended: + return w[:i+1] + elif i + 1 < len(w): + return cls.search(node.children[w[i + 1]], w, i + 1) + else: + return + +class Solution: + def replaceWords(self, dic: List[str], sentence: str) -> str: + trie = Trie() + for word in dic: + root = trie.root + root.children[word[0]] = Trie.insert(root.children[word[0]], word, 0) + + ret = [] + for word in sentence.split(" "): + for child in trie.root.children.values(): + searched = Trie.search(child, word, 0) + if searched: + ret.append(searched) + break + else: + ret.append(word) + + return " ".join(ret) + + +if __name__ == "__main__": + assert Solution().replaceWords(["cat", "bat", "rat"], "the cattle was rattled by the battery") == "the cat was rat by the bat" diff --git a/650 2 Keys Keyboard.py b/650 2 Keys Keyboard.py new file mode 100644 index 0000000..75c9692 --- /dev/null +++ b/650 2 Keys Keyboard.py @@ -0,0 +1,83 @@ +#!/usr/bin/python3 +""" +Initially on a notepad only one character 'A' is present. You can perform two +operations on this notepad for each step: + +Copy All: You can copy all the characters present on the notepad (partial copy +is not allowed). +Paste: You can paste the characters which are copied last time. + + +Given a number n. You have to get exactly n 'A' on the notepad by performing the +minimum number of steps permitted. Output the minimum number of steps to get n 'A'. + +Example 1: + +Input: 3 +Output: 3 +Explanation: +Intitally, we have one character 'A'. +In step 1, we use Copy All operation. +In step 2, we use Paste operation to get 'AA'. +In step 3, we use Paste operation to get 'AAA'. + + +Note: + +The n will be in the range [1, 1000]. +""" + + +class Solution: + def minSteps(self, n: int) -> int: + """ + Prime numger + To get 12 + We need to copy 6 (* 2) + To get 6 + We need to copy 2 (* 3) + To get 2 + We need to copy 1 (* 2) + """ + ret = 0 + for i in range(2, n+1): + while n % i == 0: + ret += i + n //= i + + return ret + + def minSteps_dp(self, n: int) -> int: + """ + Let F[i][j] be the minimum number to reach i A's with j copies + F[i][k] = min + F[i-k][k] + 1 + F[i/2][i/2] + 2 if i/2 == k + + Better dp: + F[i] = F[j] + j / i # copy j / i times + """ + F = [[float('inf') for _ in range(n+1)] for _ in range(n+1)] + F[1][0] = 0 + F[1][1] = 1 + for i in range(2, n + 1): + for j in range(i+1): + F[i][j] = min( + F[i][j], + F[i-j][j] + 1, + ) + if i % 2 == 0: + F[i][i//2] = min( + F[i][i//2], + F[i//2][j] + 2 + ) + + + ret = min(F[n]) + return ret + + +if __name__ == "__main__": + assert Solution().minSteps(7) == 7 + assert Solution().minSteps(3) == 3 + assert Solution().minSteps(4) == 4 diff --git a/652 Find Duplicate Subtrees.py b/652 Find Duplicate Subtrees.py new file mode 100644 index 0000000..c2fd6d3 --- /dev/null +++ b/652 Find Duplicate Subtrees.py @@ -0,0 +1,126 @@ +#!/usr/bin/python3 +""" +Given a binary tree, return all duplicate subtrees. For each kind of duplicate +subtrees, you only need to return the root node of any one of them. + +Two trees are duplicate if they have the same structure with same node values. + +Example 1: + + 1 + / \ + 2 3 + / / \ + 4 2 4 + / + 4 +The following are two duplicate subtrees: + + 2 + / + 4 +and + + 4 +Therefore, you need to return above trees' root in the form of a list. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +from typing import List +from collections import defaultdict + + +class MerkleHash: + def __init__(self): + self.start_key = 0 + self.merkle_hash = defaultdict(self._auto_incr) # subtree -> id + + def _auto_incr(self): + self.start_key += 1 + return self.start_key + + def __call__(self, val): + return self.merkle_hash[val] + + +class Solution: + def __init__(self): + self.counter = defaultdict(int) + self.merkle_hash = MerkleHash() + + def findDuplicateSubtrees(self, root: TreeNode) -> List[TreeNode]: + """ + Merkle hash based on current val, and left substree merkle and right merkle + Assign each subtree a identity/hash + Chain of hash can uniquely identify a subtree + """ + ret = [] + self.walk(root, ret) + return ret + + def walk(self, cur, ret) -> int: + """ + return merkle hash id + """ + if not cur: + return self.merkle_hash(None) + + subtree_value = (cur.val, self.walk(cur.left, ret), self.walk(cur.right, ret)) + merkle_hash = self.merkle_hash(subtree_value) + if self.counter[merkle_hash] == 1: + ret.append(cur) + + self.counter[merkle_hash] += 1 + return merkle_hash + + +class Solution2: + def findDuplicateSubtrees(self, root: TreeNode) -> List[TreeNode]: + """ + Only need to return the root + """ + ret = [] + self.walk(root, defaultdict(int), ret) + return ret + + def walk(self, cur, counter, ret) -> str: + """ + serialize the subtrees and check existence + + Needs to have a unique representation + + for the key, cannot but cur.val in the middle as not be able to + differentiate between + + 0 + / + 0 + + 0 + \ + 0 + because you don't know which one is the root + + complexity: O(N) * O(N) (string concatenation), + """ + if not cur: + return "None" + + cur_key = ",".join([ + self.walk(cur.left, counter, ret), + self.walk(cur.right, counter, ret), + str(cur.val), + ]) + if counter[cur_key] == 1: + ret.append(cur) + + counter[cur_key] += 1 + return cur_key diff --git a/653 Two Sum IV - Input is a BST.py b/653 Two Sum IV - Input is a BST.py new file mode 100644 index 0000000..484156a --- /dev/null +++ b/653 Two Sum IV - Input is a BST.py @@ -0,0 +1,71 @@ +#!/usr/bin/python3 +""" +Given a Binary Search Tree and a target number, return true if there exist two +elements in the BST such that their sum is equal to the given target. + +Example 1: + +Input: + 5 + / \ + 3 6 + / \ \ +2 4 7 + +Target = 9 + +Output: True + + +Example 2: + +Input: + 5 + / \ + 3 6 + / \ \ +2 4 7 + +Target = 28 + +Output: False +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def findTarget(self, root: TreeNode, k: int) -> bool: + self.root = root + return self.walk(root, k) + + def walk(self, node, k): + if not node: + return False + + target = k - node.val + if self.find(self.root, target, node): + return True + + if self.walk(node.left, k) or self.walk(node.right, k): + return True + + return False + + def find(self, node, target, existing): + if not node: + return False + + if node.val == target: + return node != existing + + if target < node.val: + return self.find(node.left, target, existing) + else: + return self.find(node.right, target, existing) diff --git a/654 Maximum Binary Tree.py b/654 Maximum Binary Tree.py new file mode 100644 index 0000000..6ab869a --- /dev/null +++ b/654 Maximum Binary Tree.py @@ -0,0 +1,97 @@ +#!/usr/bin/python3 +""" +Given an integer array with no duplicates. A maximum tree building on this array +is defined as follow: + +The root is the maximum number in the array. +The left subtree is the maximum tree constructed from left part subarray divided +by the maximum number. +The right subtree is the maximum tree constructed from right part subarray +divided by the maximum number. +Construct the maximum tree by the given array and output the root node of this +tree. + +Example 1: +Input: [3,2,1,6,0,5] +Output: return the tree root node representing the following tree: + + 6 + / \ + 3 5 + \ / + 2 0 + \ + 1 +Note: +The size of the given array will be in the range [1,1000]. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +from typing import List +import heapq + + +class Solution: + def constructMaximumBinaryTree(self, nums: List[int]) -> TreeNode: + """ + monotonic stack - a stack to keep a decreasing subsequence from left to + right + the cur is the stk[-1]'s right + the cur's left is elements to its left not in monotonic stack + """ + stk = [] + for n in nums: + cur = TreeNode(n) + while stk and stk[-1].val < cur.val: + left = stk.pop() + cur.left = left + + if stk: + stk[-1].right = cur + + stk.append(cur) + + return stk[0] + +class Solution_heap: + def constructMaximumBinaryTree(self, nums: List[int]) -> TreeNode: + """ + heap O(n lgn) + insert by index O(n lgn) + """ + if not nums: + return + + h = [(-v, v) for v in nums] + idx = { + v: i + for i, v in enumerate(nums) + } + heapq.heapify(h) + root = None + while h: + _, m = heapq.heappop(h) + root = self.insert(root, m, idx) + + return root + + def insert(self, node, m, idx): + if not node: + return TreeNode(m) + + if idx[m] < idx[node.val]: + node.left = self.insert(node.left, m, idx) + elif idx[m] > idx[node.val]: + node.right = self.insert(node.right, m, idx) + else: + raise + + return node diff --git a/655 Print Binary Tree.py b/655 Print Binary Tree.py new file mode 100644 index 0000000..e1a6d82 --- /dev/null +++ b/655 Print Binary Tree.py @@ -0,0 +1,74 @@ +""" +Given the root of a binary tree, construct a 0-indexed m x n string matrix res that represents a formatted layout of the tree. The formatted layout matrix should be constructed using the following rules: + +The height of the tree is height and the number of rows m should be equal to height + 1. +The number of columns n should be equal to 2^(height+1) - 1. +Place the root node in the middle of the top row (more formally, at location res[0][(n-1)/2]). +For each node that has been placed in the matrix at position res[r][c], place its left child at res[r+1][c-2^(height-r-1)] and its right child at res[r+1][c+2^(height-r-1)]. +Continue this process until all the nodes in the tree have been placed. +Any empty cells should contain the empty string "". +Return the constructed matrix res. + +Example 1: + +Input: root = [1,2] +Output: +[["","1",""], + ["2","",""]] +Example 2: + + +Input: root = [1,2,3,null,4] +Output: +[["","","","1","","",""], + ["","2","","","","3",""], + ["","","4","","","",""]] + + +Constraints: + +The number of nodes in the tree is in the range [1, 2^10]. +-99 <= Node.val <= 99 +The depth of the tree will be in the range [1, 10]. +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, val=0, left=None, right=None): + self.val = val + self.left = left + self.right = right + + +class Solution: + def printTree(self, root: Optional[TreeNode]) -> List[List[str]]: + """ + get height first + then brute force + """ + h = -1 + q = [root] + while q: + new_q = [] + for node in q: + if node.left: + new_q.append(node.left) + if node.right: + new_q.append(node.right) + q = new_q + h += 1 + + M = h + 1 + N = (1 << h + 1) - 1 + res = [ + ["" for _ in range(N)] + for _ in range(M) + ] + self.dfs(h, res, 0, (N-1)//2, root) + return res + + def dfs(self, h, res, r, c, node): + res[r][c] = str(node.val) + if node.left: + self.dfs(h, res, r+1, c - (1 << h-r-1), node.left) + if node.right: + self.dfs(h, res, r+1, c + (1 << h-r-1), node.right) diff --git a/657 Robot Return to Origin.py b/657 Robot Return to Origin.py new file mode 100644 index 0000000..eec7d60 --- /dev/null +++ b/657 Robot Return to Origin.py @@ -0,0 +1,39 @@ +#!/usr/bin/python3 +""" +There is a robot starting at position (0, 0), the origin, on a 2D plane. Given +a sequence of its moves, judge if this robot ends up at (0, 0) after it +completes its moves. + +The move sequence is represented by a string, and the character moves[i] +represents its ith move. Valid moves are R (right), L (left), U (up), and D +(down). If the robot returns to the origin after it finishes all of its moves, +return true. Otherwise, return false. + +Note: The way that the robot is "facing" is irrelevant. "R" will always make the +robot move to the right once, "L" will always make it move left, etc. Also, +assume that the magnitude of the robot's movement is the same for each move. + +Example 1: + +Input: "UD" +Output: true +Explanation: The robot moves up once, and then down once. All moves have the +same magnitude, so it ended up at the origin where it started. Therefore, we +return true. + + +Example 2: + +Input: "LL" +Output: false +Explanation: The robot moves left twice. It ends up two "moves" to the left of +the origin. We return false because it is not at the origin at the end of its +moves. +""" +from collections import Counter + + +class Solution: + def judgeCircle(self, moves: str) -> bool: + counter = Counter(moves) + return counter["L"] == counter["R"] and counter["U"] == counter["D"] diff --git a/658 Find K Closest Elements.py b/658 Find K Closest Elements.py new file mode 100644 index 0000000..8cc26fe --- /dev/null +++ b/658 Find K Closest Elements.py @@ -0,0 +1,75 @@ +#!/usr/bin/python3 +""" +Given a sorted array, two integers k and x, find the k closest elements to x in +the array. The result should also be sorted in ascending order. If there is a +tie, the smaller elements are always preferred. + +Example 1: +Input: [1,2,3,4,5], k=4, x=3 +Output: [1,2,3,4] +Example 2: +Input: [1,2,3,4,5], k=4, x=-1 +Output: [1,2,3,4] +Note: +The value k is positive and will always be smaller than the length of the sorted array. +Length of the given array is positive and will not exceed 104 +Absolute value of elements in the array and x will not exceed 104 +""" +from typing import List +from bisect import bisect_left +from collections import deque + + +class Solution: + def findClosestElements(self, A: List[int], k: int, x: int) -> List[int]: + """ + binary search without two pointers scanning + """ + n = len(A) + lo = 0 + hi = n - k + while lo < hi: + mid = (lo + hi) // 2 + if abs(x - A[mid]) > abs(A[mid + k] - x): + # better to have A[mid+k] rather than A[mid] + lo = mid + 1 + else: + hi = mid + + return A[lo:lo+k] + + def findClosestElements2(self, A: List[int], k: int, x: int) -> List[int]: + """ + input sorted arrya + two pointers + """ + n = len(A) + idx = bisect_left(A, x) + ret = deque() + i = idx - 1 + j = idx + while k: + if 0 <= i < n and 0 <= j < n: + if abs(A[i] - x) <= abs(A[j] - x): + ret.appendleft(A[i]) + i -= 1 + else: + ret.append(A[j]) + j += 1 + elif 0 <= i < n: + ret.appendleft(A[i]) + i -= 1 + elif 0 <= j < n: + ret.append(A[j]) + j += 1 + else: + raise + + k -= 1 + + return list(ret) + + +if __name__ == "__main__": + assert Solution().findClosestElements([1,2,3,4,5], 4, 3) == [1,2,3,4] + assert Solution().findClosestElements([1,2,3,4,5], 4, -1) == [1,2,3,4] diff --git a/659 Split Array into Consecutive Subsequences.py b/659 Split Array into Consecutive Subsequences.py new file mode 100644 index 0000000..8162c3c --- /dev/null +++ b/659 Split Array into Consecutive Subsequences.py @@ -0,0 +1,117 @@ +#!/usr/bin/python3 +""" +You are given an integer array sorted in ascending order (may contain +duplicates), you need to split them into several subsequences, where each +subsequences consist of at least 3 consecutive integers. Return whether you can +make such a split. + +Example 1: +Input: [1,2,3,3,4,5] +Output: True +Explanation: +You can split them into two consecutive subsequences : +1, 2, 3 +3, 4, 5 +Example 2: +Input: [1,2,3,3,4,4,5,5] +Output: True +Explanation: +You can split them into two consecutive subsequences : +1, 2, 3, 4, 5 +3, 4, 5 +Example 3: +Input: [1,2,3,4,4,5] +Output: False +Note: +The length of the input is in range of [1, 10000] +""" +from typing import List +from collections import defaultdict +import heapq + + +class Solution: + def isPossible(self, nums: List[int]) -> bool: + """ + Attribute a number to a existing consecutive subsequences + future numbers depend on this number to form the subsequence can also + attribtue to this existing subsequence + + If no existing one to attribtue, form a consecutive (l >= 3) by use the + subsequent numbers by looking forward + + Let F[i] be the number of consecutive subsequence at A[i] + """ + counter = defaultdict(int) + for e in nums: + counter[e] += 1 + + F = defaultdict(int) + for e in nums: + if counter[e] == 0: + continue + counter[e] -= 1 + + if F[e - 1] > 0: + F[e - 1] -= 1 + F[e] += 1 + elif counter[e + 1] > 0 and counter[e + 2] > 0: + F[e + 2] += 1 + counter[e + 1] -= 1 + counter[e + 2] -= 1 + else: + return False + + return True + + +class Interval: + def __init__(self, end, length): + self.end = end + self.length = length + + def __lt__(self, other): + if self.end == other.end: + return self.length < other.length + + return self.end < other.end + + def __repr__(self): + return repr((self.end, self.length)) + + +class Solution2: + def isPossible(self, nums: List[int]) -> bool: + """ + (length, last) + heap sortest first + >= 3, then drop + + split when duplicate + """ + h = [] + for n in nums: + while h and h[0].end + 1 < n: + itvl = heapq.heappop(h) + if itvl.length < 3: + return False + + if not h: + heapq.heappush(h, Interval(n, 1)) + elif h[0].end + 1 == n: + itvl = heapq.heappop(h) + heapq.heappush(h, Interval(n, itvl.length + 1)) + else: # n == end + heapq.heappush(h, Interval(n, 1)) + + + for itvl in h: + if itvl.length < 3: + return False + + return True + +if __name__ == "__main__": + assert Solution().isPossible([1,2,3,3,4,5]) == True + assert Solution().isPossible([1,2,3,3,4,4,5,5]) == True + assert Solution().isPossible([1,2,3,4,4,5]) == False diff --git a/662 Maximum Width of Binary Tree.py b/662 Maximum Width of Binary Tree.py new file mode 100644 index 0000000..69512c2 --- /dev/null +++ b/662 Maximum Width of Binary Tree.py @@ -0,0 +1,97 @@ +#!/usr/bin/python3 +""" +Given a binary tree, write a function to get the maximum width of the given +tree. The width of a tree is the maximum width among all levels. The binary tree +has the same structure as a full binary tree, but some nodes are null. + +The width of one level is defined as the length between the end-nodes (the +leftmost and right most non-null nodes in the level, where the null nodes +between the end-nodes are also counted into the length calculation. + +Example 1: + +Input: + + 1 + / \ + 3 2 + / \ \ + 5 3 9 + +Output: 4 +Explanation: The maximum width existing in the third level with the length 4 (5,3,null,9). +Example 2: + +Input: + + 1 + / + 3 + / \ + 5 3 + +Output: 2 +Explanation: The maximum width existing in the third level with the length 2 (5,3). +Example 3: + +Input: + + 1 + / \ + 3 2 + / + 5 + +Output: 2 +Explanation: The maximum width existing in the second level with the length 2 (3,2). +Example 4: + +Input: + + 1 + / \ + 3 2 + / \ + 5 9 + / \ + 6 7 +Output: 8 +Explanation:The maximum width existing in the fourth level with the length 8 (6,null,null,null,null,null,null,7). +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def widthOfBinaryTree(self, root: TreeNode) -> int: + """ + 0 + 0 1 + 0 1 2 3 + + BFS, level index + """ + if not root: + return 0 + + ret = 0 + q = [(0, root)] # (index, node) + while q: + cur_q = [] + left, right = q[0][0], q[-1][0] + ret = max(ret, right - left + 1) + for idx, node in q: + if node.left: + cur_q.append((idx * 2, node.left)) + if node.right: + cur_q.append((idx * 2 + 1, node.right)) + + q = cur_q + + return ret diff --git a/663 Equal Tree Partition.py b/663 Equal Tree Partition.py new file mode 100644 index 0000000..b93549d --- /dev/null +++ b/663 Equal Tree Partition.py @@ -0,0 +1,72 @@ +#!/usr/bin/python3 +""" +premium question +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.sums = [] + + def checkEqualTree(self, root: TreeNode) -> bool: + """ + To save 2nd pass, store sums + space: O(N) + """ + self.dfs(root) + total = self.sums.pop() + return total % 2 == 0 and total // 2 in self.sums + + def dfs(self, node): + if not node: + return 0 + + l = self.dfs(node.left) + r = self.dfs(node.right) + s = l + r + node.val + self.sums.append(s) + return s + + +class Solution: + def __init__(self): + """ + Save space, two passes + """ + self.exists = False + self.root = None # need to handle 0 + self.total_sum = None + + def checkEqualTree(self, root: TreeNode) -> bool: + """ + two passes + 1st pass, get total sum + 2nd pass, check whether has sum/2 + space: O(log N) + + To save 2nd pass, store sums + space: O(N) + """ + self.root = root + self.total_sum = self.dfs(root) + self.dfs(root) + return self.exists + + def dfs(self, node): + if not node: + return 0 + + l = self.dfs(node.left) + r = self.dfs(node.right) + s = l + r + node.val + if node != self.root and self.total_sum != None and self.total_sum == s * 2: + self.exists = True + + return s diff --git a/665 Non-decreasing Array.py b/665 Non-decreasing Array.py new file mode 100644 index 0000000..803287c --- /dev/null +++ b/665 Non-decreasing Array.py @@ -0,0 +1,66 @@ +#!/usr/bin/python3 +""" +Given an array with n integers, your task is to check if it could become +non-decreasing by modifying at most 1 element. + +We define an array is non-decreasing if array[i] <= array[i + 1] holds for every +i (1 <= i < n). + +Example 1: +Input: [4,2,3] +Output: True +Explanation: You could modify the first 4 to 1 to get a non-decreasing array. +Example 2: +Input: [4,2,1] +Output: False +Explanation: You can't get a non-decreasing array by modify at most one element. +Note: The n belongs to [1, 10,000]. +""" +from typing import List + + +class Solution: + def checkPossibility(self, A: List[int]) -> bool: + """ + greedy change + two way of changing + """ + changed = False + for i in range(len(A) - 1): + if A[i] <= A[i + 1]: + continue + if not changed: + if i - 1 < 0 or A[i-1] <= A[i+1]: + A[i] = A[i+1] + else: + A[i+1] = A[i] + changed = True + else: + return False + + return True + + def checkPossibility_error(self, A: List[int]) -> bool: + """ + greedy change + """ + changed = False + for i in range(len(A) - 1): + if A[i] <= A[i + 1]: + continue + if not changed: + A[i] = A[i + 1] # Error + if i - 1 < 0 or A[i - 1] <= A[i]: + changed = True + else: + return False + else: + return False + + return True + + +if __name__ == "__main__": + assert Solution().checkPossibility([4,2,3]) == True + assert Solution().checkPossibility([3,4,2,3]) == False + assert Solution().checkPossibility([2,3,3,2,4]) == True diff --git a/669 Trim a Binary Search Tree.py b/669 Trim a Binary Search Tree.py new file mode 100644 index 0000000..5537e25 --- /dev/null +++ b/669 Trim a Binary Search Tree.py @@ -0,0 +1,69 @@ +#!/usr/bin/python3 +""" +Given a binary search tree and the lowest and highest boundaries as L and R, +trim the tree so that all its elements lies in [L, R] (R >= L). You might need +to change the root of the tree, so the result should return the new root of the +trimmed binary search tree. + +Example 1: +Input: + 1 + / \ + 0 2 + + L = 1 + R = 2 + +Output: + 1 + \ + 2 +Example 2: +Input: + 3 + / \ + 0 4 + \ + 2 + / + 1 + + L = 1 + R = 3 + +Output: + 3 + / + 2 + / + 1 +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def trimBST(self, root: TreeNode, L: int, R: int) -> TreeNode: + """ + post-order traverse + """ + return self.walk(root, L, R) + + def walk(self, node, L, R): + if not node: + return None + + node.left = self.walk(node.left, L, R) + node.right = self.walk(node.right, L, R) + if node.val < L: + return node.right + elif node.val > R: + return node.left + else: + return node diff --git a/670 Maximum Swap.py b/670 Maximum Swap.py new file mode 100644 index 0000000..50c66f8 --- /dev/null +++ b/670 Maximum Swap.py @@ -0,0 +1,45 @@ +#!/usr/bin/python3 +""" +Given a non-negative integer, you could swap two digits at most once to get the +maximum valued number. Return the maximum valued number you could get. + +Example 1: +Input: 2736 +Output: 7236 +Explanation: Swap the number 2 and the number 7. +Example 2: +Input: 9973 +Output: 9973 +Explanation: No swap. +Note: +The given number is in the range [0, 108] +""" + + +class Solution: + def maximumSwap(self, num: int) -> int: + """ + stk maintain a increasing stack from right to left + """ + stk = [] + nums = list(str(num)) + n = len(nums) + for i in range(n-1, -1, -1): + if stk and stk[-1][1] >= nums[i]: # only keep the rightmost duplicate + continue + stk.append((i, nums[i])) + + for i in range(n): + while stk and stk[-1][0] <= i: + stk.pop() + if stk and stk[-1][1] > nums[i]: + j = stk[-1][0] + nums[i], nums[j] = nums[j], nums[i] + break + + return int("".join(nums)) + + +if __name__ == "__main__": + assert Solution().maximumSwap(2736) == 7236 + assert Solution().maximumSwap(9973) == 9973 diff --git a/671 Second Minimum Node In a Binary Tree.py b/671 Second Minimum Node In a Binary Tree.py new file mode 100644 index 0000000..961ed43 --- /dev/null +++ b/671 Second Minimum Node In a Binary Tree.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +Given a non-empty special binary tree consisting of nodes with the non-negative +value, where each node in this tree has exactly two or zero sub-node. If the +node has two sub-nodes, then this node's value is the smaller value among its +two sub-nodes. + +Given such a binary tree, you need to output the second minimum value in the set +made of all the nodes' value in the whole tree. + +If no such second minimum value exists, output -1 instead. + +Example 1: +Input: + 2 + / \ + 2 5 + / \ + 5 7 + +Output: 5 +Explanation: The smallest value is 2, the second smallest value is 5. +Example 2: +Input: + 2 + / \ + 2 2 + +Output: -1 +Explanation: The smallest value is 2, but there isn't any second smallest value. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def findSecondMinimumValue(self, root: TreeNode) -> int: + ret = self.find(root) + return -1 if ret == float('inf') else ret + + def find(self, root: TreeNode) -> int: + """ + find the second min + """ + if not root: + return float('inf') + + if root.left and root.right: + if root.left.val == root.val: + left = self.find(root.left) + else: + left = root.left.val + + if root.right.val == root.val: + right = self.find(root.right) + else: + right = root.right.val + + return min(left, right) + + return float('inf') diff --git a/673 Number of Longest Increasing Subsequence.py b/673 Number of Longest Increasing Subsequence.py new file mode 100644 index 0000000..67a3b72 --- /dev/null +++ b/673 Number of Longest Increasing Subsequence.py @@ -0,0 +1,65 @@ +#!/usr/bin/python3 +""" +Given an unsorted array of integers, find the number of longest increasing +subsequence. + +Example 1: +Input: [1,3,5,4,7] +Output: 2 +Explanation: The two longest increasing subsequence are [1, 3, 4, 7] and +[1, 3, 5, 7]. +Example 2: +Input: [2,2,2,2,2] +Output: 5 +Explanation: The length of longest continuous increasing subsequence is 1, and +there are 5 subsequences' length is 1, so output 5. +Note: Length of the given array will be not exceed 2000 and the answer is +guaranteed to be fit in 32-bit signed int. +""" +from typing import List + + +class LenCnt: + def __init__(self, l, c): + self.l = l + self.c = c + + def __repr__(self): + return repr((self.l, self.c)) + + +class Solution: + def findNumberOfLIS(self, A: List[int]) -> int: + """ + Two pass - 1st pass find the LIS, 2nd pass find the number + Let F[i] be the length of LIS ended at A[i] + """ + if not A: + return 0 + + n = len(A) + F = [LenCnt(l=1, c=1) for _ in A] + mx = LenCnt(l=1, c=1) + for i in range(1, n): + for j in range(i): + if A[i] > A[j]: + if F[i].l < F[j].l + 1: + F[i].l = F[j].l + 1 + F[i].c = F[j].c + elif F[i].l == F[j].l + 1: + F[i].c += F[j].c + + if F[i].l > mx.l: + # mx = F[i] error, need deep copy + mx.l = F[i].l + mx.c = F[i].c + elif F[i].l == mx.l: + mx.c += F[i].c + + return mx.c + + +if __name__ == "__main__": + assert Solution().findNumberOfLIS([1,1,1,2,2,2,3,3,3]) == 27 + assert Solution().findNumberOfLIS([1, 3, 5, 4, 7]) == 2 + assert Solution().findNumberOfLIS([2, 2, 2, 2, 2]) == 5 diff --git a/674 Longest Continuous Increasing Subsequence.py b/674 Longest Continuous Increasing Subsequence.py new file mode 100644 index 0000000..248f245 --- /dev/null +++ b/674 Longest Continuous Increasing Subsequence.py @@ -0,0 +1,42 @@ +#!/usr/bin/python3 +""" +Given an unsorted array of integers, find the length of longest continuous +increasing subsequence (subarray). + +Example 1: +Input: [1,3,5,4,7] +Output: 3 +Explanation: The longest continuous increasing subsequence is [1,3,5], its +length is 3. +Even though [1,3,5,7] is also an increasing subsequence, it's not a continuous +one where 5 and 7 are separated by 4. +Example 2: +Input: [2,2,2,2,2] +Output: 1 +Explanation: The longest continuous increasing subsequence is [2], its length +is 1. +Note: Length of the array will not exceed 10,000. +""" +from typing import List + + +class Solution: + def findLengthOfLCIS(self, nums: List[int]) -> int: + """ + pointer is sufficient + """ + if not nums: + return 0 + + ret = 1 + i = 1 + while i < len(nums): + cur = 1 + while i < len(nums) and nums[i] > nums[i-1]: + cur += 1 + i += 1 + + i += 1 + ret = max(ret, cur) + + return ret diff --git a/676 Implement Magic Dictionary.py b/676 Implement Magic Dictionary.py new file mode 100644 index 0000000..d546ed9 --- /dev/null +++ b/676 Implement Magic Dictionary.py @@ -0,0 +1,90 @@ +#!/usr/bin/python3 +""" +Implement a magic directory with buildDict, and search methods. + +For the method buildDict, you'll be given a list of non-repetitive words to +build a dictionary. + +For the method search, you'll be given a word, and judge whether if you modify +exactly one character into another character in this word, the modified word is in the dictionary you just built. + +Example 1: +Input: buildDict(["hello", "leetcode"]), Output: Null +Input: search("hello"), Output: False +Input: search("hhllo"), Output: True +Input: search("hell"), Output: False +Input: search("leetcoded"), Output: False +""" +from typing import List +from collections import defaultdict + + +class MagicDictionary: + + def __init__(self): + """ + Initialize your data structure here. + """ + class Node: + def __init__(self, chr): + self.chr = chr + self.end = False # a word ends here + self.children = defaultdict(lambda: None) + + class Trie: + def __init__(self): + self.root = Node(None) + + def insert(self, cur, s, i): + if not cur: + cur = Node(s[i]) + + if i == len(s) -1: + cur.end = True + else: + nxt = s[i+1] + cur.children[nxt] = self.insert(cur.children[nxt], s, i + 1) + + return cur + + def search(self, cur, s, i, modified): + if cur.chr != s[i]: + if modified: + return False + modified = True + + if i == len(s) - 1: + # modified exactly once and have a word ends here + return modified and cur.end + + for child in cur.children.values(): + if self.search(child, s, i + 1, modified): + return True + + return False + + self.trie = Trie() + + def buildDict(self, dic: List[str]) -> None: + """ + Build a dictionary through a list of words + """ + for s in dic: + root = self.trie.root + root.children[s[0]] = self.trie.insert(root.children[s[0]], s, 0) + + def search(self, word: str) -> bool: + """ + Returns if there is any word in the trie that equals to the given word after modifying exactly one character + """ + for child in self.trie.root.children.values(): + if self.trie.search(child, word, 0, False): + return True + + return False + + +# Your MagicDictionary object will be instantiated and called as such: +# obj = MagicDictionary() +# obj.buildDict(dict) +# param_2 = obj.search(word) diff --git a/677 Map Sum Pairs.py b/677 Map Sum Pairs.py new file mode 100644 index 0000000..19eb889 --- /dev/null +++ b/677 Map Sum Pairs.py @@ -0,0 +1,128 @@ +#!/usr/bin/python3 +""" +Implement a MapSum class with insert, and sum methods. + +For the method insert, you'll be given a pair of (string, integer). The string +represents the key and the integer represents the value. If the key already +existed, then the original key-value pair will be overridden to the new one. + +For the method sum, you'll be given a string representing the prefix, and you +need to return the sum of all the pairs' value whose key starts with the prefix. + +Example 1: +Input: insert("apple", 3), Output: Null +Input: sum("ap"), Output: 3 +Input: insert("app", 2), Output: Null +Input: sum("ap"), Output: 5 +""" + + +class MapSum: + + def __init__(self): + """ + Initialize your data structure here. + + Trie + + update using delta + """ + from collections import defaultdict + + class TrieNode: + def __init__(self, chr, sum, val): + self.chr = chr + self.sum = sum + self.val = val + self.children = defaultdict(lambda: None) + + class Trie: + def __init__(self): + self.root = TrieNode(None, 0, 0) # dummy root + + def insert(self, cur, key, i, val): + if not cur: + cur = TrieNode(key[i], 0, 0) + + if i == len(key) - 1: + delta = val - cur.val + cur.val = val + else: + cur.children[key[i+1]], delta = self.insert(cur.children[key[i+1]], key, i + 1, val) + + cur.sum += delta + return cur, delta + + self.trie = Trie() + + def insert(self, key: str, val: int) -> None: + root = self.trie.root + root.children[key[0]], _ = self.trie.insert(root.children[key[0]], key, 0, val) + + def sum(self, prefix: str) -> int: + node = self.trie.root + for a in prefix: + if a not in node.children: + return 0 + + node = node.children[a] + + return node.sum + + +class MapSum2: + + def __init__(self): + """ + Initialize your data structure here. + + Trie + + update using delta + """ + class TrieNode: + def __init__(self, chr, sum, val): + self.chr = chr + self.sum = sum + self.val = val + self.children = {} + + class Trie: + def __init__(self): + self.root = TrieNode(None, 0, 0) # dummy root + + def insert(self, pi, key, i, val): + if key[i] not in pi.children: + cur = TrieNode(key[i], 0, 0) + pi.children[key[i]] = cur + + cur = pi.children[key[i]] + if i + 1 < len(key): + cur.children[key[i+1]], delta = self.insert(cur, key, i + 1, val) + else: + delta = val - cur.val + cur.val = val + + cur.sum += delta + return cur, delta + + self.trie = Trie() + + def insert(self, key: str, val: int) -> None: + self.trie.insert(self.trie.root, key, 0, val) + + def sum(self, prefix: str) -> int: + node = self.trie.root + for a in prefix: + if a not in node.children: + return 0 + + node = node.children[a] + + return node.sum + + +# Your MapSum object will be instantiated and called as such: +# obj = MapSum() +# obj.insert(key,val) +# param_2 = obj.sum(prefix) diff --git a/678 Valid Parenthesis String.py b/678 Valid Parenthesis String.py new file mode 100644 index 0000000..555c47a --- /dev/null +++ b/678 Valid Parenthesis String.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +Given a string containing only three types of characters: '(', ')' and '*', +write a function to check whether this string is valid. We define the validity +of a string by these rules: + +Any left parenthesis '(' must have a corresponding right parenthesis ')'. +Any right parenthesis ')' must have a corresponding left parenthesis '('. +Left parenthesis '(' must go before the corresponding right parenthesis ')'. +'*' could be treated as a single right parenthesis ')' or a single left +parenthesis '(' or an empty string. +An empty string is also valid. + +Example 1: +Input: "()" +Output: True +Example 2: +Input: "(*)" +Output: True +Example 3: +Input: "(*))" +Output: True +Note: +The string size will be in the range [1, 100]. +""" + + +class Solution: + def checkValidString(self, s: str) -> bool: + """ + Brute force: dfs branching on "*". + + Better Solution: + keep two stack: stak of "(" and stack of "*" + """ + stk_left = [] + stk_star = [] + for i, c in enumerate(s): + if c == "(": + stk_left.append(i) + elif c == "*": + stk_star.append(i) + else: + if stk_left: + stk_left.pop() + elif stk_star: + stk_star.pop() + else: + return False + + while stk_left and stk_star and stk_star[-1] > stk_left[-1]: + stk_star.pop() + stk_left.pop() + + return not stk_left + + +if __name__ == "__main__": + assert Solution().checkValidString("(*))") == True + assert Solution().checkValidString("*(") == False + assert Solution().checkValidString("(*)") == True diff --git a/679 24 Game.py b/679 24 Game.py new file mode 100644 index 0000000..2c6803e --- /dev/null +++ b/679 24 Game.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +You have 4 cards each containing a number from 1 to 9. You need to judge whether +they could operated through *, /, +, -, (, ) to get the value of 24. + +Example 1: +Input: [4, 1, 8, 7] +Output: True +Explanation: (8-4) * (7-1) = 24 +Example 2: +Input: [1, 2, 1, 2] +Output: False +Note: +The division operator / represents real division, not integer division. For +example, 4 / (1 - 2/3) = 12. +Every operation done is between two numbers. In particular, we cannot use - as a +unary operator. For example, with [1, 1, 1, 1] as input, the expression -1 - 1 - 1 - 1 is not allowed. +You cannot concatenate numbers together. For example, if the input is +[1, 2, 1, 2], we cannot write this as 12 + 12. +""" +from typing import List + + +class Solution: + def judgePoint24(self, nums: List[int]) -> bool: + return self.dfs(nums, {}) + + def dfs(self, A, cache): + if tuple(A) not in cache: + n = len(A) + if n == 1: + return abs(A[0] - 24) < 0.001 + + for i in range(n): + for j in range(i): + a = A[i] + b = A[j] + for c in (a+b, a-b, b-a, a*b, b and a/b, a and b/a): + # if 0, duplicated as a * b + A_new = A[:j] + A[j+1:i] + A[i+1:] + [c] + A_new.sort() + if self.dfs(A_new, cache): + cache[tuple(A)] = True + return cache[tuple(A)] + + cache[tuple(A)] = False + + return cache[tuple(A)] + + +if __name__ == "__main__": + assert Solution().judgePoint24([4, 1, 8, 7]) == True + assert Solution().judgePoint24([1, 2, 1, 2]) == False diff --git a/680 Valid Palindrome II.py b/680 Valid Palindrome II.py new file mode 100644 index 0000000..d2f24fd --- /dev/null +++ b/680 Valid Palindrome II.py @@ -0,0 +1,47 @@ +#!/usr/bin/python3 +""" +Given a non-empty string s, you may delete at most one character. Judge whether +you can make it a palindrome. + +Example 1: +Input: "aba" +Output: True +Example 2: +Input: "abca" +Output: True +Explanation: You could delete the character 'c'. +Note: +The string will only contain lowercase characters a-z. The maximum length of the +string is 50000. +""" + + +class Solution: + def validPalindrome(self, s: str) -> bool: + """ + Brute force, delete and check. O(n^2) + + Start from start and end, then check equal. If not match, skip either + side (i.e. delete a character), then check palindrome + """ + n = len(s) + i = 0 + j = n - 1 + while i < j: + if s[i] == s[j]: + i += 1 + j -= 1 + else: + # error, for -1, start > end. Indexing is like range + # return s[i:j] == s[i:j:-1] or s[i+1:j+1] == s[i+1:j+1:-1] + return self.is_palindrome(s[i:j]) or self.is_palindrome(s[i+1:j+1]) + + return True + + def is_palindrome(self, s): + return s == s[::-1] + + +if __name__ == "__main__": + assert Solution().validPalindrome("aba") == True + assert Solution().validPalindrome("abca") == True diff --git a/684 Redundant Connection.py b/684 Redundant Connection.py new file mode 100644 index 0000000..c75e197 --- /dev/null +++ b/684 Redundant Connection.py @@ -0,0 +1,146 @@ +#!/usr/bin/python3 +""" +In this problem, a tree is an undirected graph that is connected and has no +cycles. + +The given input is a graph that started as a tree with N nodes (with distinct +values 1, 2, ..., N), with one additional edge added. The added edge has two +different vertices chosen from 1 to N, and was not an edge that already existed. + +The resulting graph is given as a 2D-array of edges. Each element of edges is a +pair [u, v] with u < v, that represents an undirected edge connecting nodes u +and v. + +Return an edge that can be removed so that the resulting graph is a tree of N +nodes. If there are multiple answers, return the answer that occurs last in the given 2D-array. The answer edge [u, v] should be in the same format, with u < v. + +Example 1: +Input: [[1,2], [1,3], [2,3]] +Output: [2,3] +Explanation: The given undirected graph will be like this: + 1 + / \ +2 - 3 +Example 2: +Input: [[1,2], [2,3], [3,4], [1,4], [1,5]] +Output: [1,4] +Explanation: The given undirected graph will be like this: +5 - 1 - 2 + | | + 4 - 3 +Note: +The size of the input 2D-array will be between 3 and 1000. +Every integer represented in the 2D-array will be between 1 and N, where N is +the size of the input array. +""" +from typing import List +from collections import defaultdict + + +class DisjointSet(): + def __init__(self): + self.sz = {} # element -> size + self.pi = {} # element -> pi + + def add(self, x): + if x not in self.pi: # need to check, otherwise override wrongly + self.sz[x] = 1 + self.pi[x] = x + + def unionize(self, x, y): + p1 = self.root(x) + p2 = self.root(y) + if p1 != p2: + sz1 = self.sz[p1] + sz2 = self.sz[p2] + if sz1 > sz2: + p1, p2 = p2, p1 + + self.pi[p1] = p2 + self.sz[p2] += self.sz[p1] + del self.sz[p1] + + def root(self, x): + p = self.pi[x] + if p != x: + self.pi[x] = self.root(p) + + return self.pi[x] + + def is_union(self, x, y): + if x in self.pi and y in self.pi: + return self.root(x) == self.root(y) + + return False + + +class Solution: + def findRedundantConnection(self, edges: List[List[int]]) -> List[int]: + """ + Union-find + """ + ds = DisjointSet() + for p, q in edges: + ds.add(p) + ds.add(q) + if ds.is_union(p, q): + return [p, q] + + ds.unionize(p, q) + + raise + +class Solution_dfs: + def findRedundantConnection(self, edges: List[List[int]]) -> List[int]: + """ + Construct graph: O(|E|) + Find circle through dfs: O(|V|) + Notice: need to extract the circle from the cyclic path + """ + G = defaultdict(set) + for p, q in edges: + G[p].add(q) + G[q].add(p) + + visited = set() + for k in G.keys(): + if k not in visited: + circle = self.dfs(G, k, None, set([k]), [k], visited) + if circle: + for p, q in reversed(edges): + if p in circle and q in circle: + return [p, q] + + raise + + def dfs(self, G, cur, pi, path, path_list, visited): + visited.add(cur) + + for nbr in G[cur]: + if nbr != pi: + if nbr in path: + # extract the circle from path + circle = set() + in_circle = False + for e in path_list: + if e == nbr: + in_circle = True + if in_circle: + circle.add(e) + return circle + + path.add(nbr) + path_list.append(nbr) + circle = self.dfs(G, nbr, cur, path, path_list, visited) + if circle: + return circle + path.remove(nbr) + path_list.pop() + + return None + + +if __name__ == "__main__": + assert Solution().findRedundantConnection([[1,2], [1,3], [2,3]]) == [2, 3] + assert Solution().findRedundantConnection([[1,2], [2,3], [3,4], [1,4], [1,5]]) == [1, 4] + assert Solution().findRedundantConnection([[30,44],[34,47],[22,32],[35,44],[26,36],[2,15],[38,41],[28,35],[24,37],[14,49],[44,45],[11,50],[20,39],[7,39],[19,22],[3,17],[15,25],[1,39],[26,40],[5,14],[6,23],[5,6],[31,48],[13,22],[41,44],[10,19],[12,41],[1,12],[3,14],[40,50],[19,37],[16,26],[7,25],[22,33],[21,27],[9,50],[24,42],[43,46],[21,47],[29,40],[31,34],[9,31],[14,31],[5,48],[3,18],[4,19],[8,17],[38,46],[35,37],[17,43]]) == [5,48] diff --git a/686 Repeated String Match.py b/686 Repeated String Match.py new file mode 100644 index 0000000..e6deeed --- /dev/null +++ b/686 Repeated String Match.py @@ -0,0 +1,42 @@ +#!/usr/bin/python3 +""" +Given two strings A and B, find the minimum number of times A has to be repeated +such that B is a substring of it. If no such solution, return -1. + +For example, with A = "abcd" and B = "cdabcdab". + +Return 3, because by repeating A three times (“abcdabcdabcd”), B is a substring +of it; and B is not a substring of A repeated two times ("abcdabcd"). + +Note: +The length of A and B will be between 1 and 10000. +""" +import math + + +class Solution: + def repeatedStringMatch(self, A, B): + r = math.ceil(len(B) / len(A)) + for count in (r, r + 1): # r + 1 when len(B) % len(A) == 0 + if B in A * count: + return count + + return -1 + + def repeatedStringMatch_TLE(self, A: str, B: str) -> int: + for i in range(len(A)): + j = 0 + count = 0 + while j < len(B): + if i + j - count * len(A) >= len(A): + count += 1 + idx = i + j - count * len(A) + if A[idx] == B[j]: + j += 1 + else: + break + + if j == len(B): + return count + 1 + + return -1 diff --git a/687 Longest Univalue Path.py b/687 Longest Univalue Path.py new file mode 100644 index 0000000..53a14fe --- /dev/null +++ b/687 Longest Univalue Path.py @@ -0,0 +1,97 @@ +#!/usr/bin/python3 +""" +Given a binary tree, find the length of the longest path where each node in the +path has the same value. This path may or may not pass through the root. + +Note: The length of path between two nodes is represented by the number of edges +between them. + +Example 1: + +Input: + + 5 + / \ + 4 5 + / \ \ + 1 1 5 +Output: + +2 +Example 2: + +Input: + + 1 + / \ + 4 5 + / \ \ + 4 4 5 +Output: + +2 +Note: The given binary tree has not more than 10000 nodes. The height of the +tree is not more than 1000. +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.ret = 0 + + def longestUnivaluePath(self, root: TreeNode) -> int: + self.find(root) + return self.ret + + def find(self, node): + """ + the longest path ended at node + """ + if not node: + return 0 + + left = self.find(node.left) + right = self.find(node.right) + left_path = left + 1 if node.left and node.left.val == node.val else 0 + right_path = right + 1 if node.right and node.right.val == node.val else 0 + self.ret = max(self.ret, left_path + right_path) + return max(left_path, right_path) + + +class Solution_error: + def __init__(self): + self.ret = 0 + + def longestUnivaluePath(self, root: TreeNode) -> int: + self.find(root) + return self.ret + + def find(self, node): + """ + the longest path ended at node + """ + if not node: + return 0 + + left = self.find(node.left) + right = self.find(node.right) + cur = 1 # node.val + path = 1 + if left and node.left.val == node.val: + path += left + cur = left + 1 + + if right and node.right.val == node.val: + path += right + if right > left: + cur = right + 1 + + self.ret = max(self.ret, path - 1) + return cur diff --git a/688 Knight Probability in Chessboard.py b/688 Knight Probability in Chessboard.py new file mode 100644 index 0000000..6389f72 --- /dev/null +++ b/688 Knight Probability in Chessboard.py @@ -0,0 +1,108 @@ +#!/usr/bin/python3 +""" +On an NxN chessboard, a knight starts at the r-th row and c-th column and +attempts to make exactly K moves. The rows and columns are 0 indexed, so the +top-left square is (0, 0), and the bottom-right square is (N-1, N-1). + +A chess knight has 8 possible moves it can make, as illustrated below. Each move +is two squares in a cardinal direction, then one square in an orthogonal +direction. + +[Image] + +Each time the knight is to move, it chooses one of eight possible moves +uniformly at random (even if the piece would go off the chessboard) and moves +there. + +The knight continues moving until it has made exactly K moves or has moved off +the chessboard. Return the probability that the knight remains on the board +after it has stopped moving. + +Example: + +Input: 3, 2, 0, 0 +Output: 0.0625 +Explanation: There are two moves (to (1,2), (2,1)) that will keep the knight on +the board. +From each of those positions, there are also two moves that will keep the knight +on the board. +The total probability the knight stays on the board is 0.0625. +""" +dirs = ( + (-1, -2), + (-1, 2), + (1, -2), + (1, 2), + (-2, -1), + (-2, 1), + (2, -1), + (2, 1), +) + + +class Solution: + def knightProbability(self, N: int, K: int, r: int, c: int) -> float: + """ + brute force K step + + with memory, it is considered dp + """ + q = set([(r, c)]) # working que + P = [[0 for _ in range(N)] for _ in range(N)] + P[r][c] = 1 # optimize memory + k = 0 + while k < K: + k += 1 + cur_q = set() + cur_P = [[0 for _ in range(N)] for _ in range(N)] + for i, j in q: + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < N and 0 <= J < N: + cur_q.add((I, J)) + cur_P[I][J] += P[i][j] * 1 / 8 + + q = cur_q + P = cur_P + + return sum([ + P[i][j] + for i in range(N) + for j in range(N) + ]) + + + def knightProbability_error(self, N: int, K: int, r: int, c: int) -> float: + """ + brute force K step + """ + q = [(r, c)] # working que + P = [[0 for _ in range(N)] for _ in range(N)] + P[r][c] = 1 # optimize memory + k = 0 + while k < K: + k += 1 + cur_q = [] + cur_P = [[0 for _ in range(N)] for _ in range(N)] + for i, j in q: + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < N and 0 <= J < N: + cur_q.append((I, J)) # error, count multiple times + cur_P[I][J] += P[i][j] * 1 / 8 + + q = cur_q + P = cur_P + + return sum([ + P[i][j] + for i in range(N) + for j in range(N) + ]) + + +if __name__ == "__main__": + assert Solution().knightProbability(3, 2, 0, 0) == 0.0625 + assert Solution().knightProbability(3, 3, 0, 0) == 0.015625 diff --git a/690 Employee Importance.py b/690 Employee Importance.py new file mode 100644 index 0000000..4d97278 --- /dev/null +++ b/690 Employee Importance.py @@ -0,0 +1,66 @@ +""" +You have a data structure of employee information, including the employee's unique ID, importance value, and direct subordinates' IDs. + +You are given an array of employees employees where: + +employees[i].id is the ID of the ith employee. +employees[i].importance is the importance value of the ith employee. +employees[i].subordinates is a list of the IDs of the direct subordinates of the ith employee. +Given an integer id that represents an employee's ID, return the total importance value of this employee and all their direct and indirect subordinates. + + + +Example 1: + + +Input: employees = [[1,5,[2,3]],[2,3,[]],[3,3,[]]], id = 1 +Output: 11 +Explanation: Employee 1 has an importance value of 5 and has two direct subordinates: employee 2 and employee 3. +They both have an importance value of 3. +Thus, the total importance value of employee 1 is 5 + 3 + 3 = 11. +Example 2: + + +Input: employees = [[1,2,[5]],[5,-3,[]]], id = 5 +Output: -3 +Explanation: Employee 5 has an importance value of -3 and has no direct subordinates. +Thus, the total importance value of employee 5 is -3. + + +Constraints: + +1 <= employees.length <= 2000 +1 <= employees[i].id <= 2000 +All employees[i].id are unique. +-100 <= employees[i].importance <= 100 +One employee has at most one direct leader and may have several subordinates. +The IDs in employees[i].subordinates are valid IDs. +""" +""" +# Definition for Employee. +class Employee: + def __init__(self, id: int, importance: int, subordinates: List[int]): + self.id = id + self.importance = importance + self.subordinates = subordinates +""" + +class Solution: + def getImportance(self, employees: List['Employee'], id: int) -> int: + """ + find it then dfs + """ + G = {} + for e in employees: + G[e.id] = e + + for e in employees: + if e.id == id: + return self.dfs(e, G) + + def dfs(self, node, G): + s = node.importance + for i in node.subordinates: + child = G[i] + s += self.dfs(child, G) + return s diff --git a/692 Top K Frequent Words.py b/692 Top K Frequent Words.py new file mode 100644 index 0000000..c66f0ce --- /dev/null +++ b/692 Top K Frequent Words.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +Given a non-empty list of words, return the k most frequent elements. + +Your answer should be sorted by frequency from highest to lowest. If two words +have the same frequency, then the word with the lower alphabetical order comes +first. + +Example 1: +Input: ["i", "love", "leetcode", "i", "love", "coding"], k = 2 +Output: ["i", "love"] +Explanation: "i" and "love" are the two most frequent words. + Note that "i" comes before "love" due to a lower alphabetical order. +Example 2: +Input: ["the", "day", "is", "sunny", "the", "the", "the", "sunny", "is", "is"], k = 4 +Output: ["the", "is", "sunny", "day"] +Explanation: "the", "is", "sunny" and "day" are the four most frequent words, + with the number of occurrence being 4, 3, 2 and 1 respectively. +Note: +You may assume k is always valid, 1 ≤ k ≤ number of unique elements. +Input words contain only lowercase letters. +Follow up: +Try to solve it in O(n log k) time and O(n) extra space. +""" +import heapq +from collections import defaultdict +from typing import List + + +class Word: + def __init__(self, content, count): + self.content = content + self.count = count + + def __lt__(self, other): + if self.count == other.count: + return self.content > other.content + + return self.count < other.count + + +class Solution: + def topKFrequent(self, words: List[str], k: int) -> List[str]: + """ + quick select log n + heap log k + """ + h = [] + counter = defaultdict(int) + for w in words: + counter[w] += 1 + + for w, c in counter.items(): + heapq.heappush(h, Word(w, c)) + if len(h) > k: + heapq.heappop(h) + + ret = [] + while h: + w = heapq.heappop(h).content + ret.append(w) + + return ret[::-1] + + +if __name__ == "__main__": + assert Solution().topKFrequent(["i", "love", "leetcode", "i", "love", "coding"], 2) diff --git a/693 Binary Number with Alternating Bits.py b/693 Binary Number with Alternating Bits.py new file mode 100644 index 0000000..0163daf --- /dev/null +++ b/693 Binary Number with Alternating Bits.py @@ -0,0 +1,35 @@ +#!/usr/bin/python3 +""" +Given a positive integer, check whether it has alternating bits: namely, if two +adjacent bits will always have different values. + +Example 1: +Input: 5 +Output: True +Explanation: +The binary representation of 5 is: 101 +Example 2: +Input: 7 +Output: False +Explanation: +The binary representation of 7 is: 111. +""" + + +class Solution: + def hasAlternatingBits(self, n: int) -> bool: + last = None + while n: + cur = n & 1 + # `if last` is error + if last is not None and last ^ cur == 0: + return False + last = cur + n >>= 1 + + return True + + +if __name__ == "__main__": + assert Solution().hasAlternatingBits(5) == True + assert Solution().hasAlternatingBits(7) == False diff --git a/695 Max Area of Island.py b/695 Max Area of Island.py new file mode 100644 index 0000000..4fc796f --- /dev/null +++ b/695 Max Area of Island.py @@ -0,0 +1,74 @@ +#!/usr/bin/python3 +""" +Given a non-empty 2D array grid of 0's and 1's, an island is a group of 1's +(representing land) connected 4-directionally (horizontal or vertical.) You may +assume all four edges of the grid are surrounded by water. + +Find the maximum area of an island in the given 2D array. (If there is no +island, the maximum area is 0.) + +Example 1: + +[[0,0,1,0,0,0,0,1,0,0,0,0,0], + [0,0,0,0,0,0,0,1,1,1,0,0,0], + [0,1,1,0,1,0,0,0,0,0,0,0,0], + [0,1,0,0,1,1,0,0,1,0,1,0,0], + [0,1,0,0,1,1,0,0,1,1,1,0,0], + [0,0,0,0,0,0,0,0,0,0,1,0,0], + [0,0,0,0,0,0,0,1,1,1,0,0,0], + [0,0,0,0,0,0,0,1,1,0,0,0,0]] +Given the above grid, return 6. Note the answer is not 11, because the island +must be connected 4-directionally. +Example 2: + +[[0,0,0,0,0,0,0,0]] +Given the above grid, return 0. +Note: The length of each dimension in the given grid does not exceed 50. +""" +from typing import List + + +dirs = ((0, -1), (0, 1), (-1, 0), (1, 0)) + + +class Solution: + def maxAreaOfIsland(self, grid: List[List[int]]) -> int: + """ + dfs + """ + if not grid: + return 0 + + ret = 0 + m, n = len(grid), len(grid[0]) + visited = [[False for _ in range(n)] for _ in range(m)] + for i in range(m): + for j in range(n): + if not visited[i][j] and grid[i][j] == 1: + ret = max(ret, self.dfs(grid, i, j, visited)) + + return ret + + def dfs(self, grid, i, j, visited) -> int: + visited[i][j] = True + ret = 1 + m, n = len(grid), len(grid[0]) + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n and not visited[I][J] and grid[I][J] == 1: + ret += self.dfs(grid, I, J, visited) + + return ret + + +if __name__ == "__main__": + grid = [[0,0,1,0,0,0,0,1,0,0,0,0,0], + [0,0,0,0,0,0,0,1,1,1,0,0,0], + [0,1,1,0,1,0,0,0,0,0,0,0,0], + [0,1,0,0,1,1,0,0,1,0,1,0,0], + [0,1,0,0,1,1,0,0,1,1,1,0,0], + [0,0,0,0,0,0,0,0,0,0,1,0,0], + [0,0,0,0,0,0,0,1,1,1,0,0,0], + [0,0,0,0,0,0,0,1,1,0,0,0,0]] + assert Solution().maxAreaOfIsland(grid) == 6 diff --git a/696 Count Binary Substrings.py b/696 Count Binary Substrings.py new file mode 100644 index 0000000..5f90b4a --- /dev/null +++ b/696 Count Binary Substrings.py @@ -0,0 +1,69 @@ +#!/usr/bin/python3 +""" +Give a string s, count the number of non-empty (contiguous) substrings that have +the same number of 0's and 1's, and all the 0's and all the 1's in these +substrings are grouped consecutively. + +Substrings that occur multiple times are counted the number of times they occur. + +Example 1: +Input: "00110011" +Output: 6 +Explanation: There are 6 substrings that have equal number of consecutive 1's +and 0's: "0011", "01", "1100", "10", "0011", and "01". + +Notice that some of these substrings repeat and are counted the number of times +they occur. + +Also, "00110011" is not a valid substring because all the 0's (and 1's) are not +grouped together. +Example 2: +Input: "10101" +Output: 4 +Explanation: There are 4 substrings: "10", "01", "10", "01" that have equal +number of consecutive 1's and 0's. +""" + + +class Solution: + def countBinarySubstrings(self, s: str) -> int: + """ + two-pointers + math + """ + cur = 1 # 0 1 symmetry, no need 0, 1 counter, only need cur and prev counter + prev = 0 + ret = 0 + for i in range(1, len(s)): + if s[i] == s[i-1]: + cur += 1 + else: + prev = cur + cur = 1 + if prev >= cur: + ret += 1 + + return ret + + def countBinarySubstrings_error(self, s: str) -> int: + """ + two-pointers + math + """ + counter = {"0": 0, "1": 0} + ret = 0 + if not s: + return ret + counter[s[0]] += 1 + for i in range(1, len(s)): + if s[i] != s[i-1] and counter[s[i]] != 0: + counter[s[i]] = 0 + + counter[s[i]] += 1 + if min(counter["0"], counter["1"]) > 0: + ret += 1 + + return ret + + +if __name__ == "__main__": + assert Solution().countBinarySubstrings("00110011") == 6 + assert Solution().countBinarySubstrings("00110") == 3 diff --git a/697 Degree of an Array.py b/697 Degree of an Array.py new file mode 100644 index 0000000..8ef5c98 --- /dev/null +++ b/697 Degree of an Array.py @@ -0,0 +1,56 @@ +#!/usr/bin/python3 +""" +Given a non-empty array of non-negative integers nums, the degree of this array +is defined as the maximum frequency of any one of its elements. + +Your task is to find the smallest possible length of a (contiguous) subarray of +nums, that has the same degree as nums. + +Example 1: +Input: [1, 2, 2, 3, 1] +Output: 2 +Explanation: +The input array has a degree of 2 because both elements 1 and 2 appear twice. +Of the subarrays that have the same degree: +[1, 2, 2, 3, 1], [1, 2, 2, 3], [2, 2, 3, 1], [1, 2, 2], [2, 2, 3], [2, 2] +The shortest length is 2. So return 2. +Example 2: +Input: [1,2,2,3,1,4,2] +Output: 6 +Note: + +nums.length will be between 1 and 50,000. +nums[i] will be an integer between 0 and 49,999. +""" +from typing import List +from collections import defaultdict + + +class Solution: + def findShortestSubArray(self, nums: List[int]) -> int: + """ + counter + two pointers does not work + counter + first appearance + """ + if not nums: + return + + counter = defaultdict(int) + first = {} # map from number to index + mx = [0, 0] # [degree, length] + for i, n in enumerate(nums): + if n not in first: + first[n] = i # setdefault + counter[n] += 1 + if counter[n] > mx[0]: + # If there is only one mode number + mx = [counter[n], i - first[n] + 1] + elif counter[n] == mx[0]: + # How to handle duplicate mode number + mx[1] = min(mx[1], i - first[n] + 1) + + return mx[1] + + +if __name__ == "__main__": + assert Solution().findShortestSubArray([1, 2, 2, 3, 1]) == 2 diff --git a/698 Partition to K Equal Sum Subsets.py b/698 Partition to K Equal Sum Subsets.py new file mode 100644 index 0000000..318e128 --- /dev/null +++ b/698 Partition to K Equal Sum Subsets.py @@ -0,0 +1,107 @@ +#!/usr/bin/python3 +""" +Given an array of integers nums and a positive integer k, find whether it's +possible to divide this array into k non-empty subsets whose sums are all equal. + +Example 1: + +Input: nums = [4, 3, 2, 3, 5, 2, 1], k = 4 +Output: True +Explanation: It's possible to divide it into 4 subsets (5), (1, 4), (2,3), (2,3) +with equal sums. + + +Note: + +1 <= k <= len(nums) <= 16. +0 < nums[i] < 10000. +""" +from typing import List + + +class Solution: + def canPartitionKSubsets(self, nums: List[int], k: int) -> bool: + """ + resurive search + """ + s = sum(nums) + if s % k != 0: + return False + + target = s // k + visited = [False for _ in nums] + return self.dfs(nums, 0, None, target, visited, k) + + def dfs(self, nums, start_idx, cur_sum, target_sum, visited, k): + """ + some corner cases: + 1. target_sum default at 0: sum or empty array is 0? + 2. nxt_sum = (cur_sum or 0) + nums[i] rather than cur_sum or 0 + nums[i] + arithmetic operator has higher precedence than logic operator + + start index to prune + """ + if k == 1: + return True + + if cur_sum and cur_sum == target_sum: + # start index is 0 + return self.dfs(nums, 0, None, target_sum, visited, k - 1) + + for i in range(start_idx, len(nums)): + if not visited[i]: + # corner case target_sum is 0 + visited[i] = True + nxt_sum = (cur_sum or 0) + nums[i] + # error when cur_sum or 0 + nums[i] + # arithmetic operator has higher precedence than logic operator + if self.dfs(nums, i + 1, nxt_sum, target_sum, visited, k): + return True + visited[i] = False + + return False + + +class Solution_TLE: + def canPartitionKSubsets(self, nums: List[int], k: int) -> bool: + """ + resurive search + """ + s = sum(nums) + if s % k != 0: + return False + + target = s // k + visited = [False for _ in nums] + return self.dfs(nums, None, target, visited, k) + + def dfs(self, nums, cur_sum, target_sum, visited, k): + """ + some corner cases: + 1. target_sum default at 0: sum or empty array is 0? + 2. nxt_sum = (cur_sum or 0) + nums[i] rather than cur_sum or 0 + nums[i] + arithmetic operator has higher precedence than logic operator + """ + if k == 0: + return True + + if cur_sum and cur_sum == target_sum: + return self.dfs(nums, None, target_sum, visited, k - 1) + + for i in range(len(nums)): + if not visited[i]: + # corner case target_sum is 0 + visited[i] = True + nxt_sum = (cur_sum or 0) + nums[i] + # error when cur_sum or 0 + nums[i] + # arithmetic operator has higher precedence than logic operator + if self.dfs(nums, nxt_sum, target_sum, visited, k): + return True + visited[i] = False + + return False + + +if __name__ == "__main__": + assert Solution().canPartitionKSubsets([5, 3, 2, 3, 1, 2, 4], 4) == True + assert Solution().canPartitionKSubsets([4, 3, 2, 3, 5, 2, 1], 4) == True diff --git a/700 Search in a Binary Search Tree.py b/700 Search in a Binary Search Tree.py new file mode 100644 index 0000000..a99a6a6 --- /dev/null +++ b/700 Search in a Binary Search Tree.py @@ -0,0 +1,49 @@ +#!/usr/bin/python3 +""" +Given the root node of a binary search tree (BST) and a value. You need to +find the node in the BST that the node's value equals the given value. Return +the subtree rooted with that node. If such node doesn't exist, you should return +NULL. + +For example, + +Given the tree: + 4 + / \ + 2 7 + / \ + 1 3 + +And the value to search: 2 +You should return this subtree: + + 2 + / \ + 1 3 +In the example above, if we want to search the value 5, since there is no node +with value 5, we should return NULL. + +Note that an empty tree is represented by NULL, therefore you would see the +expected output (serialized tree format) as [], not null. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def searchBST(self, root: TreeNode, val: int) -> TreeNode: + if not root: + return None + + if root.val == val: + return root + elif root.val < val: + return self.searchBST(root.right, val) + else: + return self.searchBST(root.left, val) diff --git a/701 Insert into a Binary Search Tree.py b/701 Insert into a Binary Search Tree.py new file mode 100644 index 0000000..ca541bd --- /dev/null +++ b/701 Insert into a Binary Search Tree.py @@ -0,0 +1,57 @@ +#!/usr/bin/python3 +""" +Given the root node of a binary search tree (BST) and a value to be inserted +into the tree, insert the value into the BST. Return the root node of the BST +after the insertion. It is guaranteed that the new value does not exist in the +original BST. + +Note that there may exist multiple valid ways for the insertion, as long as the +tree remains a BST after insertion. You can return any of them. + +For example, + +Given the tree: + 4 + / \ + 2 7 + / \ + 1 3 +And the value to insert: 5 +You can return this binary search tree: + + 4 + / \ + 2 7 + / \ / + 1 3 5 +This tree is also valid: + + 5 + / \ + 2 7 + / \ + 1 3 + \ + 4 +""" +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def insertIntoBST(self, root: TreeNode, val: int) -> TreeNode: + if not root: + return TreeNode(val) + + if root.val < val: + root.right = self.insertIntoBST(root.right, val) + elif root.val > val: + root.left = self.insertIntoBST(root.left, val) + else: + raise + + return root diff --git a/703 Kth Largest Element in a Stream.py b/703 Kth Largest Element in a Stream.py new file mode 100644 index 0000000..4d34d3f --- /dev/null +++ b/703 Kth Largest Element in a Stream.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +Design a class to find the kth largest element in a stream. Note that it is the +kth largest element in the sorted order, not the kth distinct element. + +Your KthLargest class will have a constructor which accepts an integer k and an +integer array nums, which contains initial elements from the stream. For each +call to the method KthLargest.add, return the element representing the kth +largest element in the stream. + +Example: + +int k = 3; +int[] arr = [4,5,8,2]; +KthLargest kthLargest = new KthLargest(3, arr); +kthLargest.add(3); // returns 4 +kthLargest.add(5); // returns 5 +kthLargest.add(10); // returns 5 +kthLargest.add(9); // returns 8 +kthLargest.add(4); // returns 8 +Note: +You may assume that nums' length ≥ k-1 and k ≥ 1. +""" +from typing import List +import heapq + + +class KthLargest: + + def __init__(self, k: int, nums: List[int]): + """ + heap + min-heap, since we want the head be the k-th largest + """ + self.h = [] + self.k = k + for n in nums: + self.add(n) + + def add(self, val: int) -> int: + heapq.heappush(self.h, val) + if len(self.h) > self.k: + heapq.heappop(self.h) + + return self.h[0] + + + + + +# Your KthLargest object will be instantiated and called as such: +# obj = KthLargest(k, nums) +# param_1 = obj.add(val) diff --git a/704 Binary Search.py b/704 Binary Search.py new file mode 100644 index 0000000..f759e34 --- /dev/null +++ b/704 Binary Search.py @@ -0,0 +1,43 @@ +#!/usr/bin/python3 +""" +Given a sorted (in ascending order) integer array nums of n elements and a +target value, write a function to search target in nums. If target exists, then +return its index, otherwise return -1. + + +Example 1: + +Input: nums = [-1,0,3,5,9,12], target = 9 +Output: 4 +Explanation: 9 exists in nums and its index is 4 + +Example 2: + +Input: nums = [-1,0,3,5,9,12], target = 2 +Output: -1 +Explanation: 2 does not exist in nums so return -1 + + +Note: + +You may assume that all elements in nums are unique. +n will be in the range [1, 10000]. +The value of each element in nums will be in the range [-9999, 9999]. +""" +from typing import List + + +class Solution: + def search(self, nums: List[int], target: int) -> int: + lo = 0 + hi = len(nums) + while lo < hi: + mid = (lo + hi) // 2 + if nums[mid] == target: + return mid + elif nums[mid] < target: + lo = mid + 1 + else: + hi = mid + + return -1 diff --git a/712 Minimum ASCII Delete Sum for Two Strings.py b/712 Minimum ASCII Delete Sum for Two Strings.py new file mode 100644 index 0000000..6cbdcbe --- /dev/null +++ b/712 Minimum ASCII Delete Sum for Two Strings.py @@ -0,0 +1,93 @@ +#!/usr/bin/python3 +""" +Given two strings s1, s2, find the lowest ASCII sum of deleted characters to make +two strings equal. + +Example 1: +Input: s1 = "sea", s2 = "eat" +Output: 231 +Explanation: Deleting "s" from "sea" adds the ASCII value of "s" (115) to the +sum. +Deleting "t" from "eat" adds 116 to the sum. +At the end, both strings are equal, and 115 + 116 = 231 is the minimum sum +possible to achieve this. + +Example 2: +Input: s1 = "delete", s2 = "leet" +Output: 403 +Explanation: Deleting "dee" from "delete" to turn the string into "let", +adds 100[d]+101[e]+101[e] to the sum. Deleting "e" from "leet" adds 101[e] to the sum. +At the end, both strings are equal to "let", and the answer is 100+101+101+101 = 403. +If instead we turned both strings into "lee" or "eet", we would get answers of 433 or 417, which are higher. +Note: + +0 < s1.length, s2.length <= 1000. +All elements of each string will have an ASCII value in [97, 122]. +""" + + +class Solution: + def minimumDeleteSum(self, s1: str, s2: str) -> int: + """ + let F[i][j] be the cost to delete & make s1[:i] == s2[:j] + F[i][j] = min + F[i][j-1] + cost (delete s2[j-1], and then delete & make s1[:i] == s2[:j-1]) + F[i-1][j] + cost + F[i-1][j-1] if (s1[i-1] == s2[j-1]) + """ + m, n = len(s1), len(s2) + F = [[float('inf') for _ in range(n + 1)] for _ in range(m + 1)] + F[0][0] = 0 + for i in range(1, m + 1): + F[i][0] = F[i-1][0] + ord(s1[i-1]) + for j in range(1, n + 1): + F[0][j] = F[0][j-1] + ord(s2[j-1]) + for i in range(1, m + 1): + for j in range(1, n + 1): + F[i][j] = min( + F[i][j], + F[i][j-1] + ord(s2[j-1]), + F[i-1][j] + ord(s1[i-1]), + ) + if s1[i-1] == s2[j-1]: + F[i][j] = min( + F[i][j], + F[i-1][j-1], + ) + + return F[m][n] + + def minimumDeleteSum_error(self, s1: str, s2: str) -> int: + """ + let F[i][j] be the cost to make s1[:i] == s2[:j] + F[i][j] = min + F[i][j-1] + cost (delete s2[j-1]) + F[i-1][j] + cost + F[i-1][j-1] if (s1[i-1] == s2[j-1]) + + Error at initial conditions + """ + m, n = len(s1), len(s2) + F = [[float('inf') for _ in range(n + 1)] for _ in range(m + 1)] + F[0][0] = 0 + F[1][0] = ord(s1[0]) + F[0][1] = ord(s2[0]) + for i in range(1, m + 1): + for j in range(1, n + 1): + F[i][j] = min( + F[i][j], + F[i][j-1] + ord(s2[j-1]), + F[i-1][j] + ord(s1[i-1]), + ) + if s1[i-1] == s2[j-1]: + F[i][j] = min( + F[i][j], + F[i-1][j-1], + ) + + return F[m][n] + + +if __name__ == "__main__": + assert Solution().minimumDeleteSum("sea", "eat") == 231 + assert Solution().minimumDeleteSum("delete", "leet") == 403 diff --git a/713 Subarray Product Less Than K.py b/713 Subarray Product Less Than K.py new file mode 100644 index 0000000..40b8570 --- /dev/null +++ b/713 Subarray Product Less Than K.py @@ -0,0 +1,42 @@ +#!/usr/bin/python3 +""" +Your are given an array of positive integers nums. + +Count and print the number of (contiguous) subarrays where the product of all +the elements in the subarray is less than k. + +Example 1: +Input: nums = [10, 5, 2, 6], k = 100 +Output: 8 +Explanation: The 8 subarrays that have product less than 100 are: [10], [5], +[2], [6], [10, 5], [5, 2], [2, 6], [5, 2, 6]. +Note that [10, 5, 2] is not included as the product of 100 is not strictly less +than k. +Note: + +0 < nums.length <= 50000. +0 < nums[i] < 1000. +0 <= k < 10^6. +""" +from typing import List + + +class Solution: + def numSubarrayProductLessThanK(self, nums: List[int], k: int) -> int: + """ + Two pointer + Count attribute to the end + """ + i = 0 + ret = 0 + p = 1 + for j in range(len(nums)): + p *= nums[j] + while p >= k and i <= j: + p //= nums[i] + i += 1 + + ret += j - i + 1 # count attribute + # if i > j, i can only be j + 1 + + return ret diff --git a/718 Maximum Length of Repeated Subarray.py b/718 Maximum Length of Repeated Subarray.py new file mode 100644 index 0000000..74f03f3 --- /dev/null +++ b/718 Maximum Length of Repeated Subarray.py @@ -0,0 +1,47 @@ +#!/usr/bin/python3 +""" +Given two integer arrays A and B, return the maximum length of an subarray that +appears in both arrays. + +Example 1: +Input: +A: [1,2,3,2,1] +B: [3,2,1,4,7] +Output: 3 +Explanation: +The repeated subarray with maximum length is [3, 2, 1]. +Note: +1 <= len(A), len(B) <= 1000 +0 <= A[i], B[i] < 100 +""" +from typing import List +from collections import defaultdict + + +class Solution: + def findLength(self, A: List[int], B: List[int]) -> int: + """ + similar to longest substring + Brute force O(mn) + + DP - O(mn) + possible + F[i][j] be the longest substring ended at A[i-1], B[i-1] + F[i][j] = F[i-1][j-1] + 1 if A[i-1] == B[i-1] else 0 + """ + m, n = len(A), len(B) + F = defaultdict(lambda: defaultdict(int)) + for i in range(1, m+1): + for j in range(1, n+1): + if A[i-1] == B[j-1]: + F[i][j] = F[i-1][j-1] + 1 + + return max( + F[i][j] + for i in range(1, m+1) + for j in range(1, n+1) + ) + + +if __name__ == "__main__": + assert Solution().findLength([1,2,3,2,1], [3,2,1,4,7]) == 3 diff --git a/721 Accounts Merge.py b/721 Accounts Merge.py new file mode 100644 index 0000000..e4c833e --- /dev/null +++ b/721 Accounts Merge.py @@ -0,0 +1,105 @@ +#!/usr/bin/python3 +""" +Given a list accounts, each element accounts[i] is a list of strings, where the +first element accounts[i][0] is a name, and the rest of the elements are emails +representing emails of the account. + +Now, we would like to merge these accounts. Two accounts definitely belong to +the same person if there is some email that is common to both accounts. Note +that even if two accounts have the same name, they may belong to different +people as people could have the same name. A person can have any number of +accounts initially, but all of their accounts definitely have the same name. + +After merging the accounts, return the accounts in the following format: the +first element of each account is the name, and the rest of the elements are +emails in sorted order. The accounts themselves can be returned in any order. + +Example 1: +Input: +accounts = [["John", "johnsmith@mail.com", "john00@mail.com"], ["John", +"johnnybravo@mail.com"], ["John", "johnsmith@mail.com", +"john_newyork@mail.com"], ["Mary", "mary@mail.com"]] +Output: [["John", 'john00@mail.com', 'john_newyork@mail.com', +'johnsmith@mail.com'], ["John", "johnnybravo@mail.com"], ["Mary", +"mary@mail.com"]] + +Explanation: +The first and third John's are the same person as they have the common email +"johnsmith@mail.com". +The second John and Mary are different people as none of their email addresses +are used by other accounts. +We could return these lists in any order, for example the answer [['Mary', +'mary@mail.com'], ['John', 'johnnybravo@mail.com'], +['John', 'john00@mail.com', 'john_newyork@mail.com', 'johnsmith@mail.com']] +would still be accepted. +Note: + +The length of accounts will be in the range [1, 1000]. +The length of accounts[i] will be in the range [1, 10]. +The length of accounts[i][j] will be in the range [1, 30]. +""" +from collections import defaultdict + + +class Solution: + def accountsMerge(self, accounts: List[List[str]]) -> List[List[str]]: + """ + merge has to be dfs + account id + """ + email_to_ids = defaultdict(set) + for i, v in enumerate(accounts): + for email in v[1:]: + email_to_ids[email].add(i) + + # graph nodes by ids, edges by email + visited = [False for _ in accounts] + ret = [] + for i, v in enumerate(accounts): + if not visited[i]: + emails = set() + self.dfs(i, accounts, email_to_ids, emails, visited) + ret.append([v[0]] + sorted(emails)) + + return ret + + def dfs(self, i, accounts, email_to_ids, emails, visited): + visited[i] = True + for email in accounts[i][1:]: + emails.add(email) + for nbr in email_to_ids[email]: + if not visited[nbr]: + self.dfs(nbr, accounts, email_to_ids, emails, visited) + + + def accountsMerge_error(self, accounts: List[List[str]]) -> List[List[str]]: + """ + data structure + map: email -> id, if exist mapping, then merge + map: id -> [email] + + mistake: not dfs, search on the first level + """ + email_id = {} + id_emails = defaultdict(list) + for i in range(len(accounts)): + person = None + for email in accounts[i][1:]: + if email in email_id: + person = email_id[email] + break + + for email in accounts[i][1:]: + if person is None: + person = i + email_id[email] = person + id_emails[person].append(email) + elif email not in email_id: + email_id[email] = person + id_emails[person].append(email) + + ret = [] + for k, v in id_emails.items(): + ret.append([accounts[k][0]] + sorted(v)) + + return ret diff --git a/725 Split Linked List in Parts.py b/725 Split Linked List in Parts.py new file mode 100644 index 0000000..36be0d0 --- /dev/null +++ b/725 Split Linked List in Parts.py @@ -0,0 +1,159 @@ +#!/usr/bin/python3 +""" +Given a (singly) linked list with head node root, write a function to split the +linked list into k consecutive linked list "parts". + +The length of each part should be as equal as possible: no two parts should have +a size differing by more than 1. This may lead to some parts being null. + +The parts should be in order of occurrence in the input list, and parts +occurring earlier should always have a size greater than or equal parts +occurring later. + +Return a List of ListNode's representing the linked list parts that are formed. + +Examples 1->2->3->4, k = 5 // 5 equal parts [ [1], [2], [3], [4], null ] +Example 1: +Input: +root = [1, 2, 3], k = 5 +Output: [[1],[2],[3],[],[]] +Explanation: +The input and each element of the output are ListNodes, not arrays. +For example, the input root has root.val = 1, root.next.val = 2, +root.next.next.val = 3, and root.next.next.next = null. +The first element output[0] has output[0].val = 1, output[0].next = null. +The last element output[4] is null, but it's string representation as a ListNode +is []. + +Example 2: +Input: +root = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10], k = 3 +Output: [[1, 2, 3, 4], [5, 6, 7], [8, 9, 10]] +Explanation: +The input has been split into consecutive parts with size difference at most 1, +and earlier parts are a larger size than the later parts. +Note: + +The length of root will be in the range [0, 1000]. +Each value of a node in the input will be an integer in the range [0, 999]. +k will be an integer in the range [1, 50]. +""" +# Definition for singly-linked list. +class ListNode: + def __init__(self, x): + self.val = x + self.next = None + + +import math + + +class Solution: + def splitListToParts(self, root: ListNode, k: int) -> List[ListNode]: + """ + calculate the chunk/page size at a time + + [1,2,3,4,5,6,7] + 3 + + [[1,2,3],[4,5,6],[7]] # output + [[1,2,3],[4,5],[6,7]] # expected + """ + l = 0 + node = root + while node: + l += 1 + node = node.next + + + ret = [[] for _ in range(k)] + + short_chunk_l = l // k + long_chunk_l = short_chunk_l + 1 + n_long_chunk = l % k # key + n_short_chunk = l - n_long_chunk + + chunk_counter = 0 + cur_l = 0 + node = root + while node: + ret[chunk_counter].append(node.val) + cur_l += 1 + chunk_size = long_chunk_l if chunk_counter < n_long_chunk else short_chunk_l + if cur_l == chunk_size: + cur_l = 0 + chunk_counter += 1 + node = node.next + + return ret + + def splitListToParts_2(self, root: ListNode, k: int) -> List[ListNode]: + """ + [1,2,3,4,5,6,7] + 3 + + [[1,2,3],[4,5,6],[7]] # output + [[1,2,3],[4,5],[6,7]] # expected + + need to dynamical calculate part length on the fly + """ + l = 0 + node = root + while node: + l += 1 + node = node.next + + + ret = [[] for _ in range(k)] + node = root + counter = 0 + cur_l = 0 + i = 0 + part_l = math.ceil((l - counter) / k) + while node: + cur_l += 1 + counter += 1 + ret[i].append(node.val) + if cur_l == part_l: + k -= 1 + cur_l = 0 + i += 1 + if k != 0: + part_l = math.ceil((l - counter) / k) + + node = node.next + + return ret + + def splitListToParts_error(self, root: ListNode, k: int) -> List[ListNode]: + """ + mistake, the length should be dynamically calculated + + [1,2,3,4,5,6,7] + 3 + + [[1,2,3],[4,5,6],[7]] # output + [[1,2,3],[4,5],[6,7]] # expected + """ + l = 0 + node = root + while node: + l += 1 + node = node.next + + part_l = math.ceil(l / k) + ret = [[] for _ in range(k)] + + node = root + cur_l = 0 + i = 0 + while node: + cur_l += 1 + ret[i].append(node.val) + if cur_l == part_l: + cur_l = 0 + i += 1 + + node = node.next + + return ret diff --git a/729 My Calendar I.py b/729 My Calendar I.py new file mode 100644 index 0000000..0b5fb4c --- /dev/null +++ b/729 My Calendar I.py @@ -0,0 +1,95 @@ +#!/usr/bin/python3 +""" +Implement a MyCalendar class to store your events. A new event can be added if +adding the event will not cause a double booking. + +Your class will have the method, book(int start, int end). Formally, this +represents a booking on the half open interval [start, end), the range of real +numbers x such that start <= x < end. + +A double booking happens when two events have some non-empty intersection (ie., +there is some time that is common to both events.) + +For each call to the method MyCalendar.book, return true if the event can be +added to the calendar successfully without causing a double booking. Otherwise, +return false and do not add the event to the calendar. + +Your class will be called like this: MyCalendar cal = new MyCalendar(); +MyCalendar.book(start, end) +Example 1: + +MyCalendar(); +MyCalendar.book(10, 20); // returns true +MyCalendar.book(15, 25); // returns false +MyCalendar.book(20, 30); // returns true +Explanation: +The first event can be booked. The second can't because time 15 is already +booked by another event. +The third event can be booked, as the first event takes every time less than 20, +but not including 20. + + +Note: + +The number of calls to MyCalendar.book per test case will be at most 1000. +In calls to MyCalendar.book(start, end), start and end are integers in the range +[0, 10^9]. +""" + + +class Node: + def __init__(self, s, e): + self.s = s + self.e = e + self.left = None + self.right = None + + +class MyCalendar: + def __init__(self): + """ + binary search + disregard + end < new.start + start > new.end + need to find + end > new.start + start < new.end + + keep sorted, list insert O(n) + need a TreeMap + but python does not have -> BST although unbalanced + """ + self.root = None + + def insert(self, node: Node, s: int, e: int) -> Node: + if not node: + return Node(s, e) + + if e <= node.s: + left = self.insert(node.left, s, e) + if left is None: + return None + node.left = left + return node + elif s >= node.e: + right = self.insert(node.right, s, e) + if right is None: + return None + node.right = right + return node + else: + return None + + def book(self, start: int, end: int) -> bool: + ret = self.insert(self.root, start, end) + if ret is None: + return False + + self.root = ret + return True + + +# Your MyCalendar object will be instantiated and called as such: +# obj = MyCalendar() +# param_1 = obj.book(start,end) diff --git a/731 My Calendar II.py b/731 My Calendar II.py new file mode 100644 index 0000000..4cc2c51 --- /dev/null +++ b/731 My Calendar II.py @@ -0,0 +1,78 @@ +#!/usr/bin/python3 +""" +Implement a MyCalendarTwo class to store your events. A new event can be added +if adding the event will not cause a triple booking. + +Your class will have one method, book(int start, int end). Formally, this +represents a booking on the half open interval [start, end), the range of real +numbers x such that start <= x < end. + +A triple booking happens when three events have some non-empty intersection +(ie., there is some time that is common to all 3 events.) + +For each call to the method MyCalendar.book, return true if the event can be +added to the calendar successfully without causing a triple booking. Otherwise, +return false and do not add the event to the calendar. + +Your class will be called like this: MyCalendar cal = new MyCalendar(); +MyCalendar.book(start, end) +Example 1: + +MyCalendar(); +MyCalendar.book(10, 20); // returns true +MyCalendar.book(50, 60); // returns true +MyCalendar.book(10, 40); // returns true +MyCalendar.book(5, 15); // returns false +MyCalendar.book(5, 10); // returns true +MyCalendar.book(25, 55); // returns true +Explanation: +The first two events can be booked. The third event can be double booked. +The fourth event (5, 15) can't be booked, because it would result in a triple +booking. +The fifth event (5, 10) can be booked, as it does not use time 10 which is +already double booked. +The sixth event (25, 55) can be booked, as the time in [25, 40) will be double +booked with the third event; +the time [40, 50) will be single booked, and the time [50, 55) will be double +booked with the second event. + + +Note: + +The number of calls to MyCalendar.book per test case will be at most 1000. +In calls to MyCalendar.book(start, end), start and end are integers in the range +[0, 10^9]. +""" +import bisect + + +class MyCalendarTwo: + + def __init__(self): + """ + triple booking + boundary counting + bisect.insort + """ + self.lst = [] # can be TreeMap(), ordered map + + + def book(self, start: int, end: int) -> bool: + """ + O(lg n) + O(n) + """ + bisect.insort(self.lst, (start, "start")) + bisect.insort(self.lst, (end, "end")) + count = 0 + for _, flag in self.lst: + count += 1 if flag == "start" else -1 + if count > 2: + self.lst.remove((start, "start")) + self.lst.remove((end, "end")) + return False + + return True + +# Your MyCalendarTwo object will be instantiated and called as such: +# obj = MyCalendarTwo() +# param_1 = obj.book(start,end) diff --git a/732 My Calendar III.py b/732 My Calendar III.py new file mode 100644 index 0000000..20deae7 --- /dev/null +++ b/732 My Calendar III.py @@ -0,0 +1,66 @@ +#!/usr/bin/python3 +""" +Implement a MyCalendarThree class to store your events. A new event can always +be added. + +Your class will have one method, book(int start, int end). Formally, this +represents a booking on the half open interval [start, end), the range of real +numbers x such that start <= x < end. + +A K-booking happens when K events have some non-empty intersection (ie., there +is some time that is common to all K events.) + +For each call to the method MyCalendar.book, return an integer K representing +the largest integer such that there exists a K-booking in the calendar. + +Your class will be called like this: MyCalendarThree cal = new +MyCalendarThree(); MyCalendarThree.book(start, end) +Example 1: + +MyCalendarThree(); +MyCalendarThree.book(10, 20); // returns 1 +MyCalendarThree.book(50, 60); // returns 1 +MyCalendarThree.book(10, 40); // returns 2 +MyCalendarThree.book(5, 15); // returns 3 +MyCalendarThree.book(5, 10); // returns 3 +MyCalendarThree.book(25, 55); // returns 3 +Explanation: +The first two events can be booked and are disjoint, so the maximum K-booking +is a 1-booking. +The third event [10, 40) intersects the first event, and the maximum K-booking +is a 2-booking. +The remaining events cause the maximum K-booking to be only a 3-booking. +Note that the last event locally causes a 2-booking, but the answer is still 3 +because +eg. [10, 20), [10, 40), and [5, 15) are still triple booked. + + +Note: + +The number of calls to MyCalendarThree.book per test case will be at most 400. +In calls to MyCalendarThree.book(start, end), start and end are integers in the +range [0, 10^9]. +""" +import bisect + + +class MyCalendarThree: + + def __init__(self): + self.lst = [] + + def book(self, start: int, end: int) -> int: + bisect.insort(self.lst, (start, "start")) + bisect.insort(self.lst, (end, "end")) + ret = 0 + count = 0 + for _, flag in self.lst: + count += 1 if flag == "start" else -1 + ret = max(ret, count) + + return ret + + +# Your MyCalendarThree object will be instantiated and called as such: +# obj = MyCalendarThree() +# param_1 = obj.book(start,end) diff --git a/733 Flood Fill.py b/733 Flood Fill.py new file mode 100644 index 0000000..4350e4e --- /dev/null +++ b/733 Flood Fill.py @@ -0,0 +1,63 @@ +#!/usr/bin/python3 +""" +An image is represented by a 2-D array of integers, each integer representing +the pixel value of the image (from 0 to 65535). + +Given a coordinate (sr, sc) representing the starting pixel (row and column) of +the flood fill, and a pixel value newColor, "flood fill" the image. + +To perform a "flood fill", consider the starting pixel, plus any pixels +connected 4-directionally to the starting pixel of the same color as the +starting pixel, plus any pixels connected 4-directionally to those pixels (also +with the same color as the starting pixel), and so on. Replace the color of all +of the aforementioned pixels with the newColor. + +At the end, return the modified image. + +Example 1: +Input: +image = [[1,1,1],[1,1,0],[1,0,1]] +sr = 1, sc = 1, newColor = 2 +Output: [[2,2,2],[2,2,0],[2,0,1]] +Explanation: +From the center of the image (with position (sr, sc) = (1, 1)), all pixels +connected +by a path of the same color as the starting pixel are colored with the new +color. +Note the bottom corner is not colored 2, because it is not 4-directionally +connected +to the starting pixel. +Note: + +The length of image and image[0] will be in the range [1, 50]. +The given starting pixel will satisfy 0 <= sr < image.length and 0 <= sc < +image[0].length. +The value of each color in image[i][j] and newColor will be an integer in +[0, 65535]. +""" +from typing import List +dirs = ((-1, 0), (1, 0), (0, -1), (0, 1)) + + +class Solution: + def floodFill(self, image: List[List[int]], sr: int, sc: int, newColor: int) -> List[List[int]]: + """ + dfs fill + + mistake: corner case image == new color + """ + cur_color = image[sr][sc] + if cur_color == newColor: + return image + + self.dfs(image, sr, sc, cur_color, newColor) + return image + + def dfs(self, image, i, j, cur_color, new_color): + image[i][j] = new_color + m, n = len(image), len(image[0]) + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n and image[I][J] == cur_color: + self.dfs(image, I, J, cur_color, new_color) diff --git a/735 Asteroid Collision.py b/735 Asteroid Collision.py new file mode 100644 index 0000000..02a5399 --- /dev/null +++ b/735 Asteroid Collision.py @@ -0,0 +1,111 @@ +#!/usr/bin/python3 +""" +We are given an array asteroids of integers representing asteroids in a row. + +For each asteroid, the absolute value represents its size, and the sign +represents its direction (positive meaning right, negative meaning left). Each +asteroid moves at the same speed. + +Find out the state of the asteroids after all collisions. If two asteroids meet, +the smaller one will explode. If both are the same size, both will explode. Two +asteroids moving in the same direction will never meet. + +Example 1: +Input: +asteroids = [5, 10, -5] +Output: [5, 10] +Explanation: +The 10 and -5 collide resulting in 10. The 5 and 10 never collide. +Example 2: +Input: +asteroids = [8, -8] +Output: [] +Explanation: +The 8 and -8 collide exploding each other. +Example 3: +Input: +asteroids = [10, 2, -5] +Output: [10] +Explanation: +The 2 and -5 collide resulting in -5. The 10 and -5 collide resulting in 10. +Example 4: +Input: +asteroids = [-2, -1, 1, 2] +Output: [-2, -1, 1, 2] +Explanation: +The -2 and -1 are moving left, while the 1 and 2 are moving right. +Asteroids moving the same direction never meet, so no asteroids will meet each +other. +Note: + +The length of asteroids will be at most 10000. +Each asteroid will be a non-zero integer in the range [-1000, 1000].. +""" +from typing import List + + +class Solution: + def asteroidCollision(self, asteroids: List[int]) -> List[int]: + """ + simplified + + while-else: break statement break the entire while-else block + for-else: break statement break the entire for-else block + + stack from left to right, only -> <- will pop the stack + """ + stk = [] + for e in asteroids: + while stk and e < 0 < stk[-1]: + if abs(e) > abs(stk[-1]): + # -> exploded, <- continues + stk.pop() + elif abs(e) == abs(stk[-1]): + # -> <- both exploded + stk.pop() + break + else: + # <- exploded, -> continue + break + else: + stk.append(e) + + return stk + + def asteroidCollision_complex(self, asteroids: List[int]) -> List[int]: + """ + asteroids same speed + list of size + + stk of index + + only -> <- will collide + """ + stk = [] + n = len(asteroids) + for i in range(n-1, -1, -1): + cur = asteroids[i] + while stk and asteroids[stk[-1]] < 0 and cur > 0 and abs(asteroids[stk[-1]]) < abs(cur): + stk.pop() + + if stk and cur > 0 and asteroids[stk[-1]] == -cur: + stk.pop() + continue + + if not stk: + stk.append(i) + continue + + if not (asteroids[stk[-1]] < 0 and cur > 0) or abs(cur) > abs(asteroids[stk[-1]]): + stk.append(i) + + return [ + asteroids[i] + for i in stk[::-1] + ] + + +if __name__ == "__main__": + assert Solution().asteroidCollision([10, 2, -5]) == [10] + assert Solution().asteroidCollision([5, 10, -5]) == [5, 10] + assert Solution().asteroidCollision([8, -8]) == [] diff --git a/738 Monotone Increasing Digits.py b/738 Monotone Increasing Digits.py new file mode 100644 index 0000000..89888a4 --- /dev/null +++ b/738 Monotone Increasing Digits.py @@ -0,0 +1,46 @@ +#!/usr/bin/python3 +""" +Given a non-negative integer N, find the largest number that is less than or +equal to N with monotone increasing digits. + +(Recall that an integer has monotone increasing digits if and only if each pair +of adjacent digits x and y satisfy x <= y.) + +Example 1: +Input: N = 10 +Output: 9 +Example 2: +Input: N = 1234 +Output: 1234 +Example 3: +Input: N = 332 +Output: 299 +Note: N is an integer in the range [0, 10^9]. +""" + + +class Solution: + def monotoneIncreasingDigits(self, N: int) -> int: + """ + 332 + 322 + 222 + fill 9 + 299 + """ + digits = [int(e) for e in str(N)] + pointer = len(digits) + for i in range(len(digits) - 1, 0, -1): + if digits[i - 1] > digits[i]: + pointer = i + digits[i - 1] -= 1 + + for i in range(pointer, len(digits)): + digits[i] = 9 + + return int("".join(map(str, digits))) + + +if __name__ == "__main__": + assert Solution().monotoneIncreasingDigits(10) == 9 + assert Solution().monotoneIncreasingDigits(332) == 299 diff --git a/739 Daily Temperatures.py b/739 Daily Temperatures.py new file mode 100644 index 0000000..d2c4e74 --- /dev/null +++ b/739 Daily Temperatures.py @@ -0,0 +1,44 @@ +#!/usr/bin/python3 +""" +Given a list of daily temperatures T, return a list such that, for each day in +the input, tells you how many days you would have to wait until a warmer +temperature. If there is no future day for which this is possible, put 0 instead. + +For example, given the list of temperatures T = [73, 74, 75, 71, 69, 72, 76, 73], +your output should be [1, 1, 4, 2, 1, 1, 0, 0]. + +Note: The length of temperatures will be in the range [1, 30000]. Each +temperature will be an integer in the range [30, 100]. +""" +from typing import List +from collections import deque + + +class Solution: + def dailyTemperatures(self, T: List[int]) -> List[int]: + """ + maintain a stack of monotonously decresing from right to left + (i.e. monotonously increasing from left to right) + + Why stack? because you can disregard certain non-usefull information + + scanning from right + [73, 74, 75, 71, 69, 72, 76, 73] + """ + ret = deque() + stk = [] + for i in range(len(T) - 1, -1 , -1): + while stk and T[stk[-1]] <= T[i]: # disregard smaller ones + stk.pop() + + if stk: + ret.appendleft(stk[-1] - i) + else: + ret.appendleft(0) + stk.append(i) + + return list(ret) + + +if __name__ == "__main__": + assert Solution().dailyTemperatures([73, 74, 75, 71, 69, 72, 76, 73]) == [1, 1, 4, 2, 1, 1, 0, 0] diff --git a/740 Delete and Earn.py b/740 Delete and Earn.py new file mode 100644 index 0000000..bc4a040 --- /dev/null +++ b/740 Delete and Earn.py @@ -0,0 +1,121 @@ +#!/usr/bin/python3 +""" +Given an array nums of integers, you can perform operations on the array. + +In each operation, you pick any nums[i] and delete it to earn nums[i] points. +After, you must delete every element equal to nums[i] - 1 or nums[i] + 1. + +You start with 0 points. Return the maximum number of points you can earn by +applying such operations. + +Example 1: + +Input: nums = [3, 4, 2] +Output: 6 +Explanation: +Delete 4 to earn 4 points, consequently 3 is also deleted. +Then, delete 2 to earn 2 points. 6 total points are earned. + + +Example 2: + +Input: nums = [2, 2, 3, 3, 3, 4] +Output: 9 +Explanation: +Delete 3 to earn 3 points, deleting both 2's and the 4. +Then, delete 3 again to earn 3 points, and 3 again to earn 3 points. +9 total points are earned. + + +Note: + +The length of nums is at most 20000. +Each element nums[i] is an integer in the range [1, 10000]. +""" +from typing import List +from collections import defaultdict + + +class Solution: + def deleteAndEarn(self, nums: List[int]) -> int: + """ + reduce to house rob problem + whether to pick the number or not + F[n] = max + F[n-1] if not pick n + F[n-2] + reward if pick n + + """ + rewards = [0 for _ in range(10001)] + for num in nums: + rewards[num] += num + + # whether to pick the number or not + cur, prev = 0, 0 + for reward in rewards: + nxt = max(cur, prev + reward) + prev = cur + cur = nxt + + return cur + + def deleteAndEarn_dp(self, nums: List[int]) -> int: + """ + reduce to house rob problem + whether to pick the number or not + F[n] = max + F[n-1] if not pick n + F[n-2] + reward if pick n + + """ + counter = defaultdict(int) + for n in nums: + counter[n] += 1 + + F = [0 for _ in range(10000 + 3)] + for i in range(3, 10000 + 3): + cur = i - 2 + F[i] = max( + F[i-1], + F[i-2] + counter[cur] * cur + ) + return F[-1] + + def deleteAndEarn_slow(self, nums: List[int]) -> int: + """ + geedy + dp: chose to delete max or max - 1 + O(n lg n) + + O(n^2) + """ + nums.sort() + # transform to (num, count) + counter = [] + i = 0 + j = 0 + while i < len(nums): + while j < len(nums) and nums[i] == nums[j]: + j += 1 + counter.append((nums[i], j - i)) + i = j + + # F[i] be the max points delete counter[i] + F = [0 for _ in counter] + for i in range(len(counter)): + F[i] = counter[i][0] * counter[i][1] + F[i] += max( + [ + F[j] + for j in range(i) + if counter[j][0] != counter[i][0] - 1 + ] + or [0] + ) + + return max(F or [0]) + + +if __name__ == "__main__": + assert Solution().deleteAndEarn([1,1,1,2,4,5,5,5,6]) == 18 + assert Solution().deleteAndEarn([3, 4, 2]) == 6 + assert Solution().deleteAndEarn([2, 2, 3, 3, 3, 4]) == 9 diff --git a/741 Cherry Pickup.py b/741 Cherry Pickup.py new file mode 100644 index 0000000..bff2a84 --- /dev/null +++ b/741 Cherry Pickup.py @@ -0,0 +1,97 @@ +#!/usr/bin/python3 +""" +In a N x N grid representing a field of cherries, each cell is one of three +possible integers. + +0 means the cell is empty, so you can pass through; +1 means the cell contains a cherry, that you can pick up and pass through; +-1 means the cell contains a thorn that blocks your way. + +Your task is to collect maximum number of cherries possible by following the +rules below: + +Starting at the position (0, 0) and reaching (N-1, N-1) by moving right or down +through valid path cells (cells with value 0 or 1); +After reaching (N-1, N-1), returning to (0, 0) by moving left or up through +valid path cells; +When passing through a path cell containing a cherry, you pick it up and the +cell becomes an empty cell (0); +If there is no valid path between (0, 0) and (N-1, N-1), then no cherries can be +collected. + +Example 1: +Input: grid = +[[0, 1, -1], + [1, 0, -1], + [1, 1, 1]] +Output: 5 +Explanation: +The player started at (0, 0) and went down, down, right right to reach (2, 2). +4 cherries were picked up during this single trip, and the matrix becomes +[[0,1,-1],[0,0,-1],[0,0,0]]. +Then, the player went left, up, up, left to return home, picking up one more +cherry. +The total number of cherries picked up is 5, and this is the maximum possible. + +Note: +grid is an N by N 2D array, with 1 <= N <= 50. +Each grid[i][j] is an integer in the set {-1, 0, 1}. +It is guaranteed that grid[0][0] and grid[N-1][N-1] are not -1. +""" +from typing import List + + +class Solution: + def __init__(self): + self.cache = {} + + def cherryPickup(self, grid: List[List[int]]) -> int: + """ + DP go and back + Go back probably related - yes it is related + + Instead of walking from end to beginning, let's reverse the second leg + of the path, so we are only considering two paths from the beginning to + the end. + """ + return max(0, self.F(grid, 0, 0, 0)) + + def F(self, grid, r1, c1, r2): + n = len(grid) + if (r1, c1, r2) not in self.cache: + ret = float("-inf") + c2 = r1 + c1 - r2 # r1 + c1 == r2 + c2 + if 0 <= r1 < n and 0 <= c1 < n and 0 <= r2 < n and 0 <= c2 < n: + if grid[r1][c1] != -1 and grid[r2][c2] != -1: + ret = 0 + ret += grid[r1][c1] + if r1 != r2: + ret += grid[r2][c2] + + if r1 == n - 1 and c1 == n - 1: + pass # seed, otherwise -inf + else: + ret += max( + self.F(grid, r1+1, c1, r2+1), # down, down + self.F(grid, r1+1, c1, r2), # down, right + self.F(grid, r1, c1+1, r2+1), # right, down + self.F(grid, r1, c1+1, r2), # right, right + ) + + self.cache[r1, c1, r2] = ret + + return self.cache[r1, c1, r2] + + +if __name__ == "__main__": + assert Solution().cherryPickup( + [[0, 1, -1], + [1, 0, -1], + [1, 1, 1]] + ) == 5 + + assert Solution().cherryPickup( + [[1, 1, -1], + [1, -1, 1], + [-1, 1, 1]] + ) == 0 diff --git a/743 Network Delay Time.py b/743 Network Delay Time.py new file mode 100644 index 0000000..7f759ff --- /dev/null +++ b/743 Network Delay Time.py @@ -0,0 +1,51 @@ +#!/usr/bin/python3 +""" +There are N network nodes, labelled 1 to N. + +Given times, a list of travel times as directed edges times[i] = (u, v, w), +where u is the source node, v is the target node, and w is the time it takes for +a signal to travel from source to target. + +Now, we send a signal from a certain node K. How long will it take for all nodes +to receive the signal? If it is impossible, return -1. + +Note: + +N will be in the range [1, 100]. +K will be in the range [1, N]. +The length of times will be in the range [1, 6000]. +All edges times[i] = (u, v, w) will have 1 <= u, v <= N and 0 <= w <= 100. +""" +from typing import List +from collections import defaultdict +import heapq + + +class Solution: + def networkDelayTime(self, times: List[List[int]], N: int, K: int) -> int: + """ + Dijkstra's algorithm + """ + G = defaultdict(dict) + reach_time = [float('inf') for _ in range(N + 1)] + for u, v, w in times: + G[u][v] = w + + h = [(0, K)] + reach_time[K] = 0 + while h: + t, s = heapq.heappop(h) + if s in G: + for d, w in G[s].items(): + if t + w < reach_time[d]: + reach_time[d] = t + w + heapq.heappush(h, (t + w, d)) + + ret = max(reach_time[1:]) # notice reach_time[0] is dummy + if ret == float('inf'): + return -1 + return ret + + +if __name__ == "__main__": + assert Solution().networkDelayTime([[2,1,1],[2,3,1],[3,4,1]], 4, 2) == 2 diff --git a/746 Min Cost Climbing Stairs.py b/746 Min Cost Climbing Stairs.py new file mode 100644 index 0000000..792a61e --- /dev/null +++ b/746 Min Cost Climbing Stairs.py @@ -0,0 +1,49 @@ +#!/usr/bin/python3 +""" +On a staircase, the i-th step has some non-negative cost cost[i] assigned +(0 indexed). + +Once you pay the cost, you can either climb one or two steps. You need to find +minimum cost to reach the top of the floor, and you can either start from the +step with index 0, or the step with index 1. + +Example 1: +Input: cost = [10, 15, 20] +Output: 15 +Explanation: Cheapest is start on cost[1], pay that cost and go to the top. +Example 2: +Input: cost = [1, 100, 1, 1, 1, 100, 1, 1, 100, 1] +Output: 6 +Explanation: Cheapest is start on cost[0], and only step on 1s, skipping +cost[3]. +Note: +cost will have a length in the range [2, 1000]. +Every cost[i] will be an integer in the range [0, 999]. +""" +from typing import List + + +class Solution: + def minCostClimbingStairs(self, cost: List[int]) -> int: + """ + dp + let F[i] be the cost to reach i-th stair + F[i] = min + F[i-2] + cost[i-2] + F[i-1] + cost[i-1] + """ + n = len(cost) + F = [float('inf') for _ in range(n+1)] + F[0] = 0 + F[1] = 0 + for i in range(2, n+1): + F[i] = min( + F[i-2] + cost[i-2], + F[i-1] + cost[i-1] + ) + + return F[-1] + + +if __name__ == "__main__": + assert Solution().minCostClimbingStairs([10, 15, 20]) == 15 diff --git a/751 IP to CIDR.py b/751 IP to CIDR.py new file mode 100644 index 0000000..89e9e91 --- /dev/null +++ b/751 IP to CIDR.py @@ -0,0 +1,132 @@ +#!/usr/bin/python3 +""" +Given a start IP address ip and a number of ips we need to cover n, return a +representation of the range as a list (of smallest possible length) of CIDR +blocks. + +A CIDR block is a string consisting of an IP, followed by a slash, and then the +prefix length. For example: "123.45.67.89/20". That prefix length "20" +represents the number of common prefix bits in the specified range. + +Example 1: +Input: ip = "255.0.0.7", n = 10 +Output: ["255.0.0.7/32","255.0.0.8/29","255.0.0.16/32"] +Explanation: +The initial ip address, when converted to binary, looks like this (spaces added +for clarity): +255.0.0.7 -> 11111111 00000000 00000000 00000111 +The address "255.0.0.7/32" specifies all addresses with a common prefix of 32 +bits to the given address, +ie. just this one address. + +The address "255.0.0.8/29" specifies all addresses with a common prefix of 29 +bits to the given address: +255.0.0.8 -> 11111111 00000000 00000000 00001000 +Addresses with common prefix of 29 bits are: +11111111 00000000 00000000 00001000 +11111111 00000000 00000000 00001001 +11111111 00000000 00000000 00001010 +11111111 00000000 00000000 00001011 +11111111 00000000 00000000 00001100 +11111111 00000000 00000000 00001101 +11111111 00000000 00000000 00001110 +11111111 00000000 00000000 00001111 + +The address "255.0.0.16/32" specifies all addresses with a common prefix of 32 +bits to the given address, +ie. just 11111111 00000000 00000000 00010000. + +In total, the answer specifies the range of 10 ips starting with the address +255.0.0.7 . + +There were other representations, such as: +["255.0.0.7/32","255.0.0.8/30", "255.0.0.12/30", "255.0.0.16/32"], +but our answer was the shortest possible. + +Also note that a representation beginning with say, "255.0.0.7/30" would be +incorrect, +because it includes addresses like 255.0.0.4 = 11111111 00000000 00000000 +00000100 +that are outside the specified range. +Note: +ip will be a valid IPv4 address. +Every implied address ip + x (for x < n) will be a valid IPv4 address. +n will be an integer in the range [1, 1000]. +""" +from typing import List + + +# the weights of ip when converting to binary +weights = [ + 24, + 16, + 8, + 0, +] + + +class Solution: + def ipToCIDR(self, ip: str, n: int) -> List[str]: + """ + bit manipulation + + IP address, 8 bit, at each digit, total 32 bit, 8 byte + Follow the example + Input: ip = "255.0.0.7", n = 10 + Output: ["255.0.0.7/32","255.0.0.8/29","255.0.0.16/32"] + 255.0.0.7 -> 11111111 00000000 00000000 00000111 => cover 1 + 255.0.0.8 -> 11111111 00000000 00000000 00001000 => cover 8 + 255.0.0.16 -> 11111111 00000000 00000000 00010000 => cover 16 but only 32 + 32 means all bits as fixed prefix + + 111, then 32 to cover only one, depends on LSB + Greedy + To cover n, can have representation covers > n + + need helper functions, write the main function first + + Iterate LSB to the next LSB skipping 1's + num += lsb + """ + num_ip = self.to_bin(ip) + ret = [] + while n > 0: + lsb = self.get_lsb(num_ip) + while (1 << lsb) > n: + lsb -= 1 + + cur_cover = 1 << lsb + n -= cur_cover + ret.append( + self.to_ip(num_ip) + f"/{32-lsb}" + ) + num_ip += cur_cover + + return ret + + def to_bin(self, ip): + ret = 0 + for n, w in zip(map(int, ip.split(".")), weights): + ret += n << w + + return ret + + def to_ip(self, bin): + ret = [] + for w in weights: + ret.append( + (bin >> w) & 255 + ) + return ".".join(map(str, ret)) + + def get_lsb(self, n): + lsb = 0 + while (n >> lsb) & 1 == 0: + lsb += 1 + # n >>= lsb # error + return lsb + + +if __name__ == "__main__": + assert Solution().ipToCIDR("60.166.253.147", 12) == ["60.166.253.147/32","60.166.253.148/30","60.166.253.152/30","60.166.253.156/31","60.166.253.158/32"] + assert Solution().ipToCIDR("255.0.0.7", 10) == ["255.0.0.7/32","255.0.0.8/29","255.0.0.16/32"] diff --git a/752 Open the Lock.py b/752 Open the Lock.py new file mode 100644 index 0000000..5747071 --- /dev/null +++ b/752 Open the Lock.py @@ -0,0 +1,90 @@ +#!/usr/bin/python3 +""" +You have a lock in front of you with 4 circular wheels. Each wheel has 10 slots: +'0', '1', '2', '3', '4', '5', '6', '7', '8', '9'. The wheels can rotate freely +and wrap around: for example we can turn '9' to be '0', or '0' to be '9'. Each +move consists of turning one wheel one slot. + +The lock initially starts at '0000', a string representing the state of the 4 +wheels. + +You are given a list of deadends dead ends, meaning if the lock displays any of +these codes, the wheels of the lock will stop turning and you will be unable to +open it. + +Given a target representing the value of the wheels that will unlock the lock, +return the minimum total number of turns required to open the lock, or -1 if it +is impossible. + +Example 1: +Input: deadends = ["0201","0101","0102","1212","2002"], target = "0202" +Output: 6 +Explanation: +A sequence of valid moves would be "0000" -> "1000" -> "1100" -> "1200" -> +"1201" -> "1202" -> "0202". +Note that a sequence like "0000" -> "0001" -> "0002" -> "0102" -> "0202" would +be invalid, +because the wheels of the lock become stuck after the display becomes the dead +end "0102". +Example 2: +Input: deadends = ["8888"], target = "0009" +Output: 1 +Explanation: +We can turn the last wheel in reverse to move from "0000" -> "0009". +Example 3: +Input: deadends = ["8887","8889","8878","8898","8788","8988","7888","9888"], +target = "8888" +Output: -1 +Explanation: +We can't reach the target without getting stuck. +Example 4: +Input: deadends = ["0000"], target = "8888" +Output: -1 +Note: +The length of deadends will be in the range [1, 500]. +target will not be in the list deadends. +Every string in deadends and the string target will be a string of 4 digits from +the 10,000 possibilities '0000' to '9999'. +""" +from typing import List + + +class Solution: + def openLock(self, deadends: List[str], target: str) -> int: + """ + bfs + """ + destination = tuple(int(c) for c in target) + deadends_set = set( + tuple(int(c) for c in s) + for s in deadends + ) + q = [(0, 0, 0, 0)] + if q[0] in deadends_set: + return -1 + + step = 0 + visited = set(q) + while q: + cur_q = [] + for e in q: + if e == destination: + return step + for i in range(4): + for delta in (-1, 1): + nxt_lst = list(e) # copy + nxt_lst[i] = (nxt_lst[i] + delta) % 10 # forward or backward + nxt = tuple(nxt_lst) + if nxt not in visited and nxt not in deadends_set: + visited.add(nxt) + cur_q.append(nxt) + + step += 1 + q = cur_q + + return -1 + + +if __name__ == "__main__": + assert Solution().openLock(["8888"], "0009") == 1 + assert Solution().openLock(["8887","8889","8878","8898","8788","8988","7888","9888"], "8888") == -1 diff --git a/754 Reach a Number.py b/754 Reach a Number.py new file mode 100644 index 0000000..0769d80 --- /dev/null +++ b/754 Reach a Number.py @@ -0,0 +1,54 @@ +#!/usr/bin/python3 +""" +You are standing at position 0 on an infinite number line. There is a goal at +position target. + +On each move, you can either go left or right. During the n-th move (starting +from 1), you take n steps. + +Return the minimum number of steps required to reach the destination. + +Example 1: +Input: target = 3 +Output: 2 +Explanation: +On the first move we step from 0 to 1. +On the second step we step from 1 to 3. +Example 2: +Input: target = 2 +Output: 3 +Explanation: +On the first move we step from 0 to 1. +On the second move we step from 1 to -1. +On the third move we step from -1 to 2. +Note: +target will be a non-zero integer in the range [-10^9, 10^9]. +""" + + +class Solution: + def reachNumber(self, target: int) -> int: + """ + math + + put -/+ for 1, 2, 3, 4, ..., k + flip a sign change in even number + + if target negative, flip the sign. Thus, we can only consider positive + number + """ + target = abs(target) + s = 0 + k = 0 + while s < target: + k += 1 + s += k + + delta = s - target + if delta % 2 == 0: + return k + else: # delta is odd + if (k + 1) % 2 == 1: + return k + 1 + else: + return k + 2 diff --git a/755 Pour Water.py b/755 Pour Water.py new file mode 100644 index 0000000..ba6a884 --- /dev/null +++ b/755 Pour Water.py @@ -0,0 +1,155 @@ +#!/usr/bin/python3 +""" +We are given an elevation map, heights[i] representing the height of the terrain +at that index. The width at each index is 1. After V units of water fall at +index K, how much water is at each index? + +Water first drops at index K and rests on top of the highest terrain or water at +that index. Then, it flows according to the following rules: + +If the droplet would eventually fall by moving left, then move left. +Otherwise, if the droplet would eventually fall by moving right, then move right. +Otherwise, rise at it's current position. +Here, "eventually fall" means that the droplet will eventually be at a lower +level if it moves in that direction. Also, "level" means the height of the +terrain plus any water in that column. +We can assume there's infinitely high terrain on the two sides out of bounds of +the array. Also, there could not be partial water being spread out evenly on +more than 1 grid block - each unit of water has to be in exactly one block. + +Example 1: +Input: heights = [2,1,1,2,1,2,2], V = 4, K = 3 +Output: [2,2,2,3,2,2,2] +Explanation: +# # +# # +## # ### +######### + 0123456 <- index + +The first drop of water lands at index K = 3: + +# # +# w # +## # ### +######### + 0123456 + +When moving left or right, the water can only move to the same level or a lower +level. +(By level, we mean the total height of the terrain plus any water in that column.) +Since moving left will eventually make it fall, it moves left. +(A droplet "made to fall" means go to a lower height than it was at previously.) + +# # +# # +## w# ### +######### + 0123456 + +Since moving left will not make it fall, it stays in place. The next droplet +falls: + +# # +# w # +## w# ### +######### + 0123456 + +Since the new droplet moving left will eventually make it fall, it moves left. +Notice that the droplet still preferred to move left, +even though it could move right (and moving right makes it fall quicker.) + +# # +# w # +## w# ### +######### + 0123456 + +# # +# # +##ww# ### +######### + 0123456 + +After those steps, the third droplet falls. +Since moving left would not eventually make it fall, it tries to move right. +Since moving right would eventually make it fall, it moves right. + +# # +# w # +##ww# ### +######### + 0123456 + +# # +# # +##ww#w### +######### + 0123456 + +Finally, the fourth droplet falls. +Since moving left would not eventually make it fall, it tries to move right. +Since moving right would not eventually make it fall, it stays in place: + +# # +# w # +##ww#w### +######### + 0123456 + +The final answer is [2,2,2,3,2,2,2]: + + # + ####### + ####### + 0123456 +Example 2: +Input: heights = [1,2,3,4], V = 2, K = 2 +Output: [2,3,3,4] +Explanation: +The last droplet settles at index 1, since moving further left would not cause +it to eventually fall to a lower height. +Example 3: +Input: heights = [3,1,3], V = 5, K = 1 +Output: [4,4,4] +Note: + +heights will have length in [1, 100] and contain integers in [0, 99]. +V will be in range [0, 2000]. +K will be in range [0, heights.length - 1]. +""" +from typing import List + + +class Solution: + def pourWater(self, heights: List[int], V: int, K: int) -> List[int]: + """ + Simulation? + O(V * L) + """ + for _ in range(V): + s = K + # looking to the left + optimal = s + for i in range(s-1, -1, -1): + if heights[i] <= heights[i+1]: + if heights[i] < heights[optimal]: + optimal = i + else: + break + if optimal == s: + # looking to the right + for i in range(s+1, len(heights)): + if heights[i] <= heights[i-1]: + if heights[i] < heights[optimal]: + optimal = i + else: + break + heights[optimal] += 1 + + return heights + + +if __name__ == "__main__": + assert Solution().pourWater([2,1,1,2,1,2,2], 4, 3) == [2,2,2,3,2,2,2] diff --git a/756 Pyramid Transition Matrix.py b/756 Pyramid Transition Matrix.py new file mode 100644 index 0000000..b940516 --- /dev/null +++ b/756 Pyramid Transition Matrix.py @@ -0,0 +1,108 @@ +#!/usr/bin/python3 +""" +We are stacking blocks to form a pyramid. Each block has a color which is a one +letter string. + +We are allowed to place any color block C on top of two adjacent blocks of +colors A and B, if and only if ABC is an allowed triple. + +We start with a bottom row of bottom, represented as a single string. We also +start with a list of allowed triples allowed. Each allowed triple is represented +as a string of length 3. + +Return true if we can build the pyramid all the way to the top, otherwise false. + +Example 1: + +Input: bottom = "BCD", allowed = ["BCG", "CDE", "GEA", "FFF"] +Output: true +Explanation: +We can stack the pyramid like this: + A + / \ + G E + / \ / \ +B C D + +We are allowed to place G on top of B and C because BCG is an allowed triple. +Similarly, we can place E on top of C and D, then A on top of G and E. + + +Example 2: + +Input: bottom = "AABA", allowed = ["AAA", "AAB", "ABA", "ABB", "BAC"] +Output: false +Explanation: +We can't stack the pyramid to the top. +Note that there could be allowed triples (A, B, C) and (A, B, D) with C != D. + + +Note: + +bottom will be a string with length in range [2, 8]. +allowed will have length in range [0, 200]. +Letters in all strings will be chosen from the set {'A', 'B', 'C', 'D', 'E', +'F', 'G'}. +""" +import itertools +from typing import List +from collections import defaultdict + + +class Solution: + def pyramidTransition(self, bottom: str, allowed: List[str]) -> bool: + """ + Need search, since multiple placements are possible + The order of allowed matters + """ + T = defaultdict(set) # transition matrix + for a, b, c in allowed: + T[a, b].add(c) + + return self.dfs(T, bottom) + + def dfs(self, T, level) -> bool: + if len(level) == 1: + return True + + # for nxt_level in self.gen_nxt_level(T, level, 0): + for nxt_level in itertools.product( + *[T[a, b] for a, b in zip(level, level[1:])] + ): + if self.dfs(T, nxt_level): + return True + + return False + + def gen_nxt_level(self, T, level, lo): + """ + equiv to itertools.product - nested for-loops in a generator expression + Cartesian product + """ + if lo + 1 >= len(level): + yield "" + return + + for head in T[level[lo], level[lo + 1]]: + for tail in self.gen_nxt_level(T, level, lo + 1): + yield head + tail + + + def dfs_deep(self, T, level, lo, nxt_level) -> bool: + if lo + 1 == len(level): + return True + + for nxt in T[level[lo], level[lo + 1]]: + nxt_level.append(nxt) + if self.dfs(T, level, lo + 1, nxt_level): + # Too deep - check till top + if self.dfs(T, nxt_level, 0, []): + return True + nxt_level.pop() + + return False + + +if __name__ == "__main__": + assert Solution().pyramidTransition("BCD", ["BCG", "CDE", "GEA", "FFF"]) == True + assert Solution().pyramidTransition("AABA", ["AAA", "AAB", "ABA", "ABB", "BAC"]) == False diff --git a/759 Employee Free Time.py b/759 Employee Free Time.py new file mode 100644 index 0000000..8866a7c --- /dev/null +++ b/759 Employee Free Time.py @@ -0,0 +1,151 @@ +#!/usr/bin/python3 +""" +We are given a list schedule of employees, which represents the working time for +each employee. + +Each employee has a list of non-overlapping Intervals, and these intervals are +in sorted order. + +Return the list of finite intervals representing common, positive-length free +time for all employees, also in sorted order. + +Example 1: +Input: schedule = [[[1,2],[5,6]],[[1,3]],[[4,10]]] +Output: [[3,4]] +Explanation: +There are a total of three employees, and all common +free time intervals would be [-inf, 1], [3, 4], [10, inf]. +We discard any intervals that contain inf as they aren't finite. + + +Example 2: +Input: schedule = [[[1,3],[6,7]],[[2,4]],[[2,5],[9,12]]] +Output: [[5,6],[7,9]] + + +(Even though we are representing Intervals in the form [x, y], the objects +inside are Intervals, not lists or arrays. For example, schedule[0][0].start = 1 +, schedule[0][0].end = 2, and schedule[0][0][0] is not defined.) + +Also, we wouldn't include intervals like [5, 5] in our answer, as they have zero +length. + +Note: + +schedule and schedule[i] are lists with lengths in range [1, 50]. +0 <= schedule[i].start < schedule[i].end <= 10^8. +""" +from typing import List +import heapq + + +S = 0 +E = 1 + + +class Solution: + def employeeFreeTime(self, schedule: List[List[List[int]]]) -> List[List[int]]: + """ + Method 1 + Looking at the head of each list through iterator + Merge interval of heads, need to sort, then use heap + After merge, find the open interval + + No need to merge, find the max end time, and compare to the min start time + + Method 2 + Better algorithm to find the open interval + [s, e], we can think of this as two events: balance++ when time = s, and + balance-- when time = e. We want to know the regions where balance == 0. + + Similar to meeting rooms II + """ + cur_max_end = min( + itv[E] + for itvs in schedule + for itv in itvs + ) + q = [] + for i, itvs in enumerate(schedule): + # head + j = 0 + itv = itvs[j] + heapq.heappush(q, (itv[S], i, j)) + + ret = [] + while q: + _, i, j = heapq.heappop(q) + itv = schedule[i][j] + if cur_max_end < itv[S]: + ret.append([cur_max_end, itv[S]]) + + cur_max_end = max(cur_max_end, itv[E]) + + # next + j += 1 + if j < len(schedule[i]): + itv = schedule[i][j] + heapq.heappush(q, (itv[S], i, j)) + + return ret + + def employeeFreeTime(self, schedule: List[List[List[int]]]) -> List[List[int]]: + """ + Method 2 + """ + # flatten the nested list + lst = [] + for itvs in schedule: + for itv in itvs: + lst.append([itv[S], S]) + lst.append([itv[E], E]) + + lst.sort() + count = 0 + prev = None + ret = [] + for t, flag in lst: + if count == 0 and prev: + ret.append([prev, t]) + + if flag == S: + count += 1 + else: + prev = t + count -= 1 + + return ret + + def employeeFreeTime_error(self, schedule: List[List[List[int]]]) -> List[List[int]]: + """ + Cannot store iterator in the heap to compare + use index instead + """ + schedules = list(map(iter, schedule)) + cur_max_end = min( + itv[E] + for emp in schedule + for itv in emp + ) + q = [] + for emp_iter in schedules: + itv = next(emp_iter, None) + if itv: + heapq.heappush(q, (itv[S], itv, emp_iter)) + + ret = [] + while q: + _, itv, emp_iter = heapq.heappop(q) + if cur_max_end < itv[S]: + ret.append([cur_max_end, itv[S]]) + cur_max_end = max(cur_max_end, itv[E]) + itv = next(emp_iter, None) + if itv: + heapq.heappush(q, (itv[S], itv, emp_iter)) + + return ret + + +if __name__ == "__main__": + assert Solution().employeeFreeTime([[[1,2],[5,6]],[[1,3]],[[4,10]]]) == [[3,4]] + assert Solution().employeeFreeTime([[[4,16],[31,36],[42,50],[80,83],[95,96]],[[4,13],[14,19],[37,53],[64,66],[85,89]],[[17,24],[38,39],[49,51],[62,67],[79,81]],[[9,15],[17,24],[45,63],[65,68],[87,88]],[[17,33],[39,41],[43,57],[58,63],[70,84]]]) == [[36, 37], [68, 70], [84, 85], [89, 95]] diff --git a/763 Partition Labels py3.py b/763 Partition Labels py3.py new file mode 100644 index 0000000..b947b3f --- /dev/null +++ b/763 Partition Labels py3.py @@ -0,0 +1,45 @@ +#!/usr/bin/python3 +""" +A string S of lowercase letters is given. We want to partition this string into +as many parts as possible so that each letter appears in at most one part, and +return a list of integers representing the size of these parts. + +Example 1: +Input: S = "ababcbacadefegdehijhklij" +Output: [9,7,8] +Explanation: +The partition is "ababcbaca", "defegde", "hijhklij". +This is a partition so that each letter appears in at most one part. +A partition like "ababcbacadefegde", "hijhklij" is incorrect, because it splits +S into less parts. +Note: + +S will have length in range [1, 500]. +S will consist of lowercase letters ('a' to 'z') only. +""" +from typing import List + + +class Solution: + def partitionLabels(self, S: str) -> List[int]: + lasts = {} + n = len(S) + for i in range(n-1, -1, -1): + if S[i] not in lasts: + lasts[S[i]] = i + + indexes = [-1] # last partition ending index + cur_last = 0 + for i in range(n): + cur_last = max(cur_last, lasts[S[i]]) + if cur_last == i: + indexes.append(cur_last) + + ret = [] + for i in range(len(indexes) - 1): + ret.append(indexes[i+1] - indexes[i]) + return ret + + +if __name__ == "__main__": + assert Solution().partitionLabels("ababcbacadefegdehijhklij") == [9, 7, 8] diff --git a/764 Largest Plus Sign.py b/764 Largest Plus Sign.py new file mode 100644 index 0000000..acefa12 --- /dev/null +++ b/764 Largest Plus Sign.py @@ -0,0 +1,105 @@ +#!/usr/bin/python3 +""" +In a 2D grid from (0, 0) to (N-1, N-1), every cell contains a 1, except those +cells in the given list mines which are 0. What is the largest axis-aligned plus +sign of 1s contained in the grid? Return the order of the plus sign. If there is +none, return 0. + +An "axis-aligned plus sign of 1s of order k" has some center grid[x][y] = 1 +along with 4 arms of length k-1 going up, down, left, and right, and made of 1s. +This is demonstrated in the diagrams below. Note that there could be 0s or 1s +beyond the arms of the plus sign, only the relevant area of the plus sign is +checked for 1s. + +Examples of Axis-Aligned Plus Signs of Order k: + +Order 1: +000 +010 +000 + +Order 2: +00000 +00100 +01110 +00100 +00000 + +Order 3: +0000000 +0001000 +0001000 +0111110 +0001000 +0001000 +0000000 +Example 1: + +Input: N = 5, mines = [[4, 2]] +Output: 2 +Explanation: +11111 +11111 +11111 +11111 +11011 +In the above grid, the largest plus sign can only be order 2. One of them is +marked in bold. +Example 2: + +Input: N = 2, mines = [] +Output: 1 +Explanation: +There is no plus sign of order 2, but there is of order 1. +Example 3: + +Input: N = 1, mines = [[0, 0]] +Output: 0 +Explanation: +There is no plus sign, so return 0. +Note: + +N will be an integer in the range [1, 500]. +mines will have length at most 5000. +mines[i] will be length 2 and consist of integers in the range [0, N-1]. +(Additionally, programs submitted in C, C++, or C# will be judged with a +slightly smaller time limit.) +""" +from typing import List + + +class Solution: + def orderOfLargestPlusSign(self, N: int, mines: List[List[int]]) -> int: + """ + < ^ > V four directions + Let F[i][j][k] be the number of consecutive 1 including G[i][j] it self + """ + G = [[1 for _ in range(N)] for _ in range(N)] + for i, j in mines: + G[i][j] = 0 + + F = [[[G[i][j] for _ in range(4)] for j in range(N)] for i in range(N)] + for i in range(N): + for j in range(N): + if j - 1 >= 0 and G[i][j] == 1: + F[i][j][0] = F[i][j-1][0] + 1 + if i - 1 >= 0 and G[i][j] == 1: + F[i][j][1] = F[i-1][j][1] + 1 + + for i in range(N-1, -1, -1): + for j in range(N-1, -1, -1): + if j + 1 < N and G[i][j] == 1: + F[i][j][2] = F[i][j+1][2] + 1 + if i + 1 < N and G[i][j] == 1: + F[i][j][3] = F[i+1][j][3] + 1 + + ret = 0 + for i in range(N): + for j in range(N): + ret = max(ret, min(F[i][j])) + + return ret + + +if __name__ == "__main__": + assert Solution().orderOfLargestPlusSign(5, [[4, 2]]) == 2 diff --git a/766 Toeplitz Matrix.py b/766 Toeplitz Matrix.py new file mode 100644 index 0000000..5836530 --- /dev/null +++ b/766 Toeplitz Matrix.py @@ -0,0 +1,87 @@ +#!/usr/bin/python3 +""" +A matrix is Toeplitz if every diagonal from top-left to bottom-right has the +same element. + +Now given an M x N matrix, return True if and only if the matrix is Toeplitz. + + +Example 1: + +Input: +matrix = [ + [1,2,3,4], + [5,1,2,3], + [9,5,1,2] +] +Output: True +Explanation: +In the above grid, the diagonals are: +"[9]", "[5, 5]", "[1, 1, 1]", "[2, 2, 2]", "[3, 3]", "[4]". +In each diagonal all elements are the same, so the answer is True. +Example 2: + +Input: +matrix = [ + [1,2], + [2,2] +] +Output: False +Explanation: +The diagonal "[1, 2]" has different elements. + +Note: + +matrix will be a 2D array of integers. +matrix will have a number of rows and columns in range [1, 20]. +matrix[i][j] will be integers in range [0, 99]. + +Follow up: + +What if the matrix is stored on disk, and the memory is limited such that you +can only load at most one row of the matrix into the memory at once? +What if the matrix is so large that you can only load up a partial row into the +memory at once? +""" +from typing import List + + +class Solution: + def isToeplitzMatrix(self, matrix: List[List[int]]) -> bool: + m, n = len(matrix), len(matrix[0]) + for i in range(1, m): + for j in range(1, n): + if matrix[i][j] != matrix[i-1][j-1]: + return False + + return True + + def isToeplitzMatrix_complex(self, matrix: List[List[int]]) -> bool: + """ + Brute force iteration will work + + need a good way to go through the matrix + """ + m, n = len(matrix), len(matrix[0]) + for j in range(n): + r = 0 + c = j + cur = matrix[r][c] + while r < m and c < n: + if cur != matrix[r][c]: + return False + r += 1 + c += 1 + + for i in range(1, m): + r = i + c = 0 + cur = matrix[r][c] + while r < m and c < n: + if cur != matrix[r][c]: + return False + + r += 1 + c += 1 + + return True diff --git a/767 Reorganize String.py b/767 Reorganize String.py new file mode 100644 index 0000000..b608d73 --- /dev/null +++ b/767 Reorganize String.py @@ -0,0 +1,60 @@ +#!/usr/bin/python3 +""" +Given a string S, check if the letters can be rearranged so that two characters +that are adjacent to each other are not the same. + +If possible, output any possible result. If not possible, return the empty +string. + +Example 1: + +Input: S = "aab" +Output: "aba" +Example 2: + +Input: S = "aaab" +Output: "" +Note: + +S will consist of lowercase letters and have length in range [1, 500]. +""" +from collections import defaultdict + + +class Solution: + def reorganizeString(self, S: str) -> str: + """ + piles by max char and circular append + """ + counter = defaultdict(int) + for c in S: + counter[c] += 1 + + lst = [ + (-n, n, c) + for c, n in counter.items() + ] + lst.sort() + piles = [] + _, n, c = lst[0] + for i in range(n): + piles.append([c]) + + cnt = 0 + for _, n, c in lst[1:]: + for _ in range(n): + piles[cnt].append(c) + cnt = (cnt + 1) % len(piles) + + if len(piles) > 1 and len(piles[-2]) == 1: + return "" + + return "".join( + map(lambda x: "".join(x), piles) + ) + + +if __name__ == "__main__": + assert Solution().reorganizeString("vvvlo") == "vlvov" + assert Solution().reorganizeString("aab") == "aba" + assert Solution().reorganizeString("aaab") == "" diff --git a/768 Max Chunks To Make Sorted II.py b/768 Max Chunks To Make Sorted II.py new file mode 100644 index 0000000..3e6ac19 --- /dev/null +++ b/768 Max Chunks To Make Sorted II.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +This question is the same as "Max Chunks to Make Sorted" except the integers of +the given array are not necessarily distinct, the input array could be up to +length 2000, and the elements could be up to 10**8. + +Given an array arr of integers (not necessarily distinct), we split the array +into some number of "chunks" (partitions), and individually sort each chunk. +After concatenating them, the result equals the sorted array. + +What is the most number of chunks we could have made? + +Example 1: + +Input: arr = [5,4,3,2,1] +Output: 1 +Explanation: +Splitting into two or more chunks will not return the required result. +For example, splitting into [5, 4], [3, 2, 1] will result in [4, 5, 1, 2, 3], +which isn't sorted. +Example 2: + +Input: arr = [2,1,3,4,4] +Output: 4 +Explanation: +We can split into two chunks, such as [2, 1], [3, 4, 4]. +However, splitting into [2, 1], [3], [4], [4] is the highest number of chunks +possible. +Note: + +arr will have length in range [1, 2000]. +arr[i] will be an integer in range [0, 10**8]. +""" +from typing import List +from collections import defaultdict, deque + + +class Solution: + def maxChunksToSorted(self, arr: List[int]) -> int: + """ + not necessarily distinct + sort and assign index + For the smae element, the right ones should get larget assigned index + """ + A = sorted(arr) + hm = defaultdict(deque) + for i, e in enumerate(A): + hm[e].append(i) + + proxy = [] + for e in arr: + proxy.append(hm[e].popleft()) + + ret = 0 + cur_max_idx = 0 + for i, e in enumerate(proxy): + cur_max_idx = max(cur_max_idx, e) + if cur_max_idx == i: + ret += 1 + + return ret diff --git a/769 Max Chunks To Make Sorted.py b/769 Max Chunks To Make Sorted.py new file mode 100644 index 0000000..401cdf2 --- /dev/null +++ b/769 Max Chunks To Make Sorted.py @@ -0,0 +1,49 @@ +#!/usr/bin/python3 +""" +Given an array arr that is a permutation of [0, 1, ..., arr.length - 1], we +split the array into some number of "chunks" (partitions), and individually sort +each chunk. After concatenating them, the result equals the sorted array. + +What is the most number of chunks we could have made? + +Example 1: + +Input: arr = [4,3,2,1,0] +Output: 1 +Explanation: +Splitting into two or more chunks will not return the required result. +For example, splitting into [4, 3], [2, 1, 0] will result in [3, 4, 0, 1, 2], +which isn't sorted. +Example 2: + +Input: arr = [1,0,2,3,4] +Output: 4 +Explanation: +We can split into two chunks, such as [1, 0], [2, 3, 4]. +However, splitting into [1, 0], [2], [3], [4] is the highest number of chunks +possible. +Note: + +arr will have length in range [1, 10]. +arr[i] will be a permutation of [0, 1, ..., arr.length - 1]. +""" +from typing import List + + +class Solution: + def maxChunksToSorted(self, arr: List[int]) -> int: + """ + compared to the sorted + [0, 1, 2, 3, 4] + [1, 0, 2, 3, 4] + + The largest number in the chunk determines the ending index of the chunk + """ + ret = 0 + cur_max_idx = 0 + for i in range(len(arr)): + cur_max_idx = max(cur_max_idx, arr[i]) + if i == cur_max_idx: + ret += 1 + + return ret diff --git a/771 Jewels and Stones.py b/771 Jewels and Stones.py new file mode 100644 index 0000000..be29c81 --- /dev/null +++ b/771 Jewels and Stones.py @@ -0,0 +1,33 @@ +#!/usr/bin/python3 +""" +You're given strings J representing the types of stones that are jewels, and S +representing the stones you have. Each character in S is a type of stone you +have. You want to know how many of the stones you have are also jewels. + +The letters in J are guaranteed distinct, and all characters in J and S are +letters. Letters are case sensitive, so "a" is considered a different type of +stone from "A". + +Example 1: + +Input: J = "aA", S = "aAAbbbb" +Output: 3 +Example 2: + +Input: J = "z", S = "ZZ" +Output: 0 +""" + + +class Solution: + def numJewelsInStones(self, J: str, S: str) -> int: + """ + hash map + """ + targets = set(J) + ret = 0 + for c in S: + if c in targets: + ret += 1 + + return ret diff --git a/772 Basic Calculator III.py b/772 Basic Calculator III.py new file mode 100644 index 0000000..9d41e5a --- /dev/null +++ b/772 Basic Calculator III.py @@ -0,0 +1,74 @@ +#!/usr/bin/python3 +""" +Implement a basic calculator to evaluate a simple expression string. + +The expression string may contain open ( and closing parentheses ), the plus + +or minus sign -, non-negative integers and empty spaces . + +The expression string contains only non-negative integers, +, -, *, / operators +, open ( and closing parentheses ) and empty spaces . The integer division +should truncate toward zero. + +You may assume that the given expression is always valid. All intermediate +results will be in the range of [-2147483648, 2147483647]. + +Some examples: +"1 + 1" = 2 +" 6-4 / 2 " = 4 +"2*(5+5*2)/3+(6/2+8)" = 21 +"(2+6* 3+5- (3*14/7+2)*5)+3"=-12 + +Note: Do not use the eval built-in library function. +""" + + +class Solution: + def calculate(self, s: str) -> int: + """ + make +, - lower precedence operator as a unary operation + recursively handle bracket + """ + s = s + "\0" # signal the end + ret, _ = self.eval(s, 0, []) + return ret + + def eval(self, s, i, stk): + """ + return the cursor since the cursor advances in recursion + """ + operand = 0 + prev_op = "+" + while i < len(s): + c = s[i] + if c == " ": + pass # not continue since need trigger i += 1 + elif c.isdigit(): + operand = operand * 10 + int(c) + elif c in ("+", "-", "*", "/", ")", "\0"): # delimiter + if prev_op == "+": + stk.append(operand) + elif prev_op == "-": + stk.append(-operand) + elif prev_op == "*": + prev_operand = stk.pop() + stk.append(prev_operand * operand) + elif prev_op == "/": + prev_operand = stk.pop() + stk.append(int(prev_operand / operand)) + + if c in ("+", "-", "*", "/"): + operand = 0 + prev_op = c + elif c in (")", "\0"): + return sum(stk), i + elif c == "(": # "(" is not delimiter + operand, i = self.eval(s, i + 1, []) + else: + raise + + i += 1 + + +if __name__ == "__main__": + assert Solution().calculate("(( ( ( 4- 2)+ ( 6+ 10 ) )+ 1) /( ( ( 7 + 9 )* ( 5*8) )- ( 5 + ( 2 * 10 ) ) ) )") == 0 + assert Solution().calculate("(2+6* 3+5- (3*14/7+2)*5)+3") == -12 diff --git a/773 Sliding Puzzle.py b/773 Sliding Puzzle.py new file mode 100644 index 0000000..6ec2fda --- /dev/null +++ b/773 Sliding Puzzle.py @@ -0,0 +1,130 @@ +#!/usr/bin/python3 +""" +On a 2x3 board, there are 5 tiles represented by the integers 1 through 5, and +an empty square represented by 0. + +A move consists of choosing 0 and a 4-directionally adjacent number and swapping +it. + +The state of the board is solved if and only if the board is [[1,2,3],[4,5,0]]. + +Given a puzzle board, return the least number of moves required so that the +state of the board is solved. If it is impossible for the state of the board to +be solved, return -1. + +Examples: + +Input: board = [[1,2,3],[4,0,5]] +Output: 1 +Explanation: Swap the 0 and the 5 in one move. +Input: board = [[1,2,3],[5,4,0]] +Output: -1 +Explanation: No number of moves will make the board solved. +Input: board = [[4,1,2],[5,0,3]] +Output: 5 +Explanation: 5 is the smallest number of moves that solves the board. +An example path: +After move 0: [[4,1,2],[5,0,3]] +After move 1: [[4,1,2],[0,5,3]] +After move 2: [[0,1,2],[4,5,3]] +After move 3: [[1,0,2],[4,5,3]] +After move 4: [[1,2,0],[4,5,3]] +After move 5: [[1,2,3],[4,5,0]] +Input: board = [[3,2,4],[1,5,0]] +Output: 14 +Note: + +board will be a 2 x 3 array as described above. +board[i][j] will be a permutation of [0, 1, 2, 3, 4, 5]. +""" +from typing import List +from collections import defaultdict +from copy import deepcopy +import heapq + + +final_pos = { + 1: (0, 0), + 2: (0, 1), + 3: (0, 2), + 4: (1, 0), + 5: (1, 1), + 0: (1, 2), +} + +dirs = ( + (0, -1), + (0, 1), + (-1, 0), + (1, 0), +) + + +class Solution: + def slidingPuzzle(self, board: List[List[int]]) -> int: + """ + BFS + visited + + => A* + priority = current_dist + heuristic_dist + + Chain the matrix into 1d array. N = R * C + Complexity O(N * N!) + There are O(N!) possible board states. O(N) is the time to scan the board for the operations in the loop. + + Possible to reduce the 2D array in a 1D array and do %C and //C, where C is the size of the column + """ + visited = defaultdict(bool) + m, n = len(board), len(board[0]) + q = [(self.heuristic_dist(board) + 0, 0, board)] + target = [ + [1, 2, 3], + [4, 5, 0], + ] + while q: + heu, cur_dist, board = heapq.heappop(q) + visited[self.ser(board)] = True + if board == target: + return cur_dist + + cur_dist += 1 + i, j = self.zero_pos(board) + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n: + B = deepcopy(board) # need a copy in the queue + B[I][J], B[i][j] = B[i][j], B[I][J] + if not visited[self.ser(B)]: + heapq.heappush(q, (self.heuristic_dist(B) + cur_dist, cur_dist, B)) + return -1 + + def zero_pos(self, board): + for i, row in enumerate(board): + for j, v in enumerate(row): + if v == 0: + return i, j + raise + + def heuristic_dist(self, board): + """ + manhattan distance + """ + ret = 0 + for i, row in enumerate(board): + for j, v in enumerate(row): + if v != 0: + I, J = final_pos[v] + ret += abs(i - I) + abs(j - J) + return ret + + def ser(self, board): + return tuple( + tuple(row) + for row in board + ) + + +if __name__ == "__main__": + assert Solution().slidingPuzzle([[1,2,3],[4,0,5]]) == 1 + assert Solution().slidingPuzzle([[1,2,3],[5,4,0]]) == -1 diff --git a/779 K-th Symbol in Grammar.py b/779 K-th Symbol in Grammar.py new file mode 100644 index 0000000..e8b0d8a --- /dev/null +++ b/779 K-th Symbol in Grammar.py @@ -0,0 +1,82 @@ +#!/usr/bin/python3 +""" +On the first row, we write a 0. Now in every subsequent row, we look at the +previous row and replace each occurrence of 0 with 01, and each occurrence of 1 +with 10. + +Given row N and index K, return the K-th indexed symbol in row N. (The values of +K are 1-indexed.) (1 indexed). + +Examples: +Input: N = 1, K = 1 +Output: 0 + +Input: N = 2, K = 1 +Output: 0 + +Input: N = 2, K = 2 +Output: 1 + +Input: N = 4, K = 5 +Output: 1 + +Explanation: +row 1: 0 +row 2: 01 +row 3: 0110 +row 4: 01101001 +Note: + +N will be an integer in the range [1, 30]. +K will be an integer in the range [1, 2^(N-1)]. +""" + + +class Solution: + def kthGrammar(self, N: int, K: int) -> int: + """ + pattern + + 0 + 0 1 + 01 10 + 0110 1001 + recursive go thorugh the pattern + """ + return self.dfs(N, K, True) + + def dfs(self, N, K, not_flip): + if N == 1: + return 0 if not_flip else 1 + half_l = 2 ** (N - 1) // 2 + if K <= half_l: + return self.dfs(N - 1, K, not_flip) + else: + return self.dfs(N - 1, K - half_l, not not_flip) + + def kthGrammar_TLE(self, N: int, K: int) -> int: + """ + Find pattern + Precedence: Logic < Bitwise < Arithmetic operator < Unary + + 0 + 0 1 + 01 10 + 0110 1001 + Generating the actual string will TLE + """ + row = 0 + pos = 1 + for n in range(1, N): + row = (row << pos) + (~row & 2 ** pos - 1) + pos *= 2 + + ret = row >> pos - K & 1 + return ret + + +if __name__ == "__main__": + assert Solution().kthGrammar(1, 1) == 0 + assert Solution().kthGrammar(2, 1) == 0 + assert Solution().kthGrammar(2, 2) == 1 + assert Solution().kthGrammar(4, 5) == 1 diff --git a/783 Minimum Distance Between BST Nodes.py b/783 Minimum Distance Between BST Nodes.py new file mode 100644 index 0000000..46cddeb --- /dev/null +++ b/783 Minimum Distance Between BST Nodes.py @@ -0,0 +1,56 @@ +#!/usr/bin/python3 +""" +Given a Binary Search Tree (BST) with the root node root, return the minimum +difference between the values of any two different nodes in the tree. + +Example : + +Input: root = [4,2,6,1,3,null,null] +Output: 1 +Explanation: +Note that root is a TreeNode object, not an array. + +The given tree [4,2,6,1,3,null,null] is represented by the following diagram: + + 4 + / \ + 2 6 + / \ + 1 3 + +while the minimum difference in this tree is 1, it occurs between node 1 and +node 2, also between node 3 and node 2. +Note: + +The size of the BST will be between 2 and 100. +The BST is always valid, each node's value is an integer, and each node's value +is different. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.prev = None + self.ret = float('inf') + + def minDiffInBST(self, root: TreeNode) -> int: + """ + in-order traversal + """ + if not root: + return + + self.minDiffInBST(root.left) + if self.prev: + self.ret = min(self.ret, root.val - self.prev) + self.prev = root.val + self.minDiffInBST(root.right) + return self.ret diff --git a/784 Letter Case Permutation.py b/784 Letter Case Permutation.py new file mode 100644 index 0000000..1b5374f --- /dev/null +++ b/784 Letter Case Permutation.py @@ -0,0 +1,59 @@ +#!/usr/bin/python3 +""" +Given a string S, we can transform every letter individually to be lowercase or +uppercase to create another string. Return a list of all possible strings we +could create. + +Examples: +Input: S = "a1b2" +Output: ["a1b2", "a1B2", "A1b2", "A1B2"] + +Input: S = "3z4" +Output: ["3z4", "3Z4"] + +Input: S = "12345" +Output: ["12345"] +Note: + +S will be a string with length between 1 and 12. +S will consist only of letters or digits. +""" +from typing import List + + +class Solution: + def __init__(self): + self.ret = [] + + def letterCasePermutation(self, S: str) -> List[str]: + """ + dfs + """ + # S_lst = S.split() # error + S_lst = list(S) + self.dfs([], S_lst, 0) + return [ + "".join(e) + for e in self.ret + ] + + def dfs(self, lst, S_lst, i): + if len(lst) == len(S_lst): + self.ret.append(list(lst)) + return + + if S_lst[i].isdigit(): + lst.append(S_lst[i]) + self.dfs(lst, S_lst, i + 1) + lst.pop() + else: + lst.append(S_lst[i].lower()) + self.dfs(lst, S_lst, i + 1) + lst.pop() + lst.append(S_lst[i].upper()) + self.dfs(lst, S_lst, i + 1) + lst.pop() + + +if __name__ == "__main__": + assert Solution().letterCasePermutation("a1b2") == ['a1b2', 'a1B2', 'A1b2', 'A1B2'] diff --git a/785 Is Graph Bipartite.py b/785 Is Graph Bipartite.py new file mode 100644 index 0000000..c440f79 --- /dev/null +++ b/785 Is Graph Bipartite.py @@ -0,0 +1,103 @@ +#!/usr/bin/python3 +""" +Given an undirected graph, return true if and only if it is bipartite. + +Recall that a graph is bipartite if we can split it's set of nodes into two +independent subsets A and B such that every edge in the graph has one node in A +and another node in B. + +The graph is given in the following form: graph[i] is a list of indexes j for +which the edge between nodes i and j exists. Each node is an integer between 0 +and graph.length - 1. There are no self edges or parallel edges: graph[i] does +not contain i, and it doesn't contain any element twice. + +Example 1: +Input: [[1,3], [0,2], [1,3], [0,2]] +Output: true +Explanation: +The graph looks like this: +0----1 +| | +| | +3----2 +We can divide the vertices into two groups: {0, 2} and {1, 3}. +Example 2: +Input: [[1,2,3], [0,2], [0,1,3], [0,2]] +Output: false +Explanation: +The graph looks like this: +0----1 +| \ | +| \ | +3----2 +We cannot find a way to divide the set of nodes into two independent subsets. + + +Note: + +graph will have length in range [1, 100]. +graph[i] will contain integers in range [0, graph.length - 1]. +graph[i] will not contain i or duplicate values. +The graph is undirected: if any element j is in graph[i], then i will be in +graph[j]. +""" +from collections import defaultdict + + +class Solution: + def isBipartite(self, graph: List[List[int]]) -> bool: + """ + coloring the graph + dfs coloring + """ + G = graph + color = defaultdict(int) + for k in range(len(G)): + if k not in color: + color[k] = 0 + if not self.dfs(G, k, color): + return False + # if colored, don't vist + + return True + + def dfs(self, G, u, color): + for nbr in G[u]: + if nbr in color: + if color[nbr] == color[u]: + return False + else: + color[nbr] = 1 - color[u] # can be (0, 1) or (-1, 1) + if not self.dfs(G, nbr, color): + return False + + return True + + +class SolutionError: + def isBipartite(self, graph: List[List[int]]) -> bool: + G = graph + A, B = set(), set() + visited = defaultdict(bool) + for k in range(len(G)): + if not visited[k]: + if not self.dfs(G, visited, k, A, B, True): + return False + + return True + + def dfs(self, G, visited, u, A, B, is_A): + visited[u] = True + if is_A: + A.add(u) + else: + B.add(u) + + for nbr in G[u]: + if nbr in A if is_A else B: + return False + if not visited[nbr]: + if not self.dfs(G, visited, nbr, A, B, False): + return False + + return True diff --git a/787 Cheapest Flights Within K Stops.py b/787 Cheapest Flights Within K Stops.py new file mode 100644 index 0000000..d0e4826 --- /dev/null +++ b/787 Cheapest Flights Within K Stops.py @@ -0,0 +1,69 @@ +#!/usr/bin/python3 +""" +There are n cities connected by m flights. Each fight starts from city u and +arrives at v with a price w. + +Now given all the cities and flights, together with starting city src and the +destination dst, your task is to find the cheapest price from src to dst with up +to k stops. If there is no such route, output -1. + +Example 1: +Input: +n = 3, edges = [[0,1,100],[1,2,100],[0,2,500]] +src = 0, dst = 2, k = 1 +Output: 200 +Explanation: +The graph looks like this: + + +The cheapest price from city 0 to city 2 with at most 1 stop costs 200, as +marked red in the picture. +Example 2: +Input: +n = 3, edges = [[0,1,100],[1,2,100],[0,2,500]] +src = 0, dst = 2, k = 0 +Output: 500 +Explanation: +The graph looks like this: + + +The cheapest price from city 0 to city 2 with at most 0 stop costs 500, as +marked blue in the picture. +Note: + +The number of nodes n will be in range [1, 100], with nodes labeled from 0 to +n - 1. + +The size of flights will be in range [0, n * (n - 1) / 2]. +The format of each flight will be (src, dst, price). +The price of each flight will be in the range [1, 10000]. +k is in the range of [0, n - 1]. +There will not be any duplicated flights or self cycles. +""" +from collections import defaultdict +import heapq + + +class Solution: + def findCheapestPrice(self, n: int, flights: List[List[int]], src: int, dst: int, K: int) -> int: + """ + dijkstra + """ + G = defaultdict(dict) + visited = defaultdict(bool) + for u, v, w in flights: + G[u][v] = w + + pq = [(0, 0, src)] # (cost, step, city) + while pq: + cost, k, u = heapq.heappop(pq) + if u == dst: + return cost + + stops = k - 1 + 1 + if stops <= K: + for v, w in G[u].items(): + heapq.heappush(pq, (cost + w, k + 1, v)) + + + return -1 diff --git a/792 Number of Matching Subsequences.py b/792 Number of Matching Subsequences.py new file mode 100644 index 0000000..9d464d6 --- /dev/null +++ b/792 Number of Matching Subsequences.py @@ -0,0 +1,69 @@ +#!/usr/bin/python3 +""" +Given string S and a dictionary of words words, find the number of words[i] that +is a subsequence of S. + +Example : +Input: +S = "abcde" +words = ["a", "bb", "acd", "ace"] +Output: 3 +Explanation: There are three words in words that are a subsequence of S: "a", +"acd", "ace". +Note: + +All words in words and S will only consists of lowercase letters. +The length of S will be in the range of [1, 50000]. +The length of words will be in the range of [1, 5000]. +The length of words[i] will be in the range of [1, 50]. +""" +from typing import List +from collections import defaultdict + + +class Solution: + def numMatchingSubseq(self, S: str, words: List[str]) -> int: + """ + Linear O(|S| + sum(|word|)) + no need to if-check + + HashMap + Iterator + """ + itrs_m = defaultdict(list) + for w in words: + itrs_m[w[0]].append( + iter(w[1:]) + ) + for a in S: + itrs = itrs_m.pop(a, []) + for itr in itrs: + v = next(itr, None) + itrs_m[v].append(itr) + + return len(itrs_m[None]) + + def numMatchingSubseq_TLE(self, S: str, words: List[str]) -> int: + """ + Brute force O(|S| |Words| M) + + Is a better way to check subsequence? No + Can we parallel the works? Yes + + go through all words parallel + O(|S| |Words|) + """ + I = [0 for _ in words] + for a in S: + for wi, i in enumerate(I): + if i < len(words[wi]) and words[wi][i] == a: + I[wi] += 1 + + return sum( + 1 + for wi, i in enumerate(I) + if i == len(words[wi]) + ) + + +if __name__ == "__main__": + assert Solution().numMatchingSubseq("abcde", ["a", "bb", "acd", "ace"]) == 3 diff --git a/795 Number of Subarrays with Bounded Maximum.py b/795 Number of Subarrays with Bounded Maximum.py new file mode 100644 index 0000000..76ab6e7 --- /dev/null +++ b/795 Number of Subarrays with Bounded Maximum.py @@ -0,0 +1,73 @@ +#!/usr/bin/python3 +""" +We are given an array A of positive integers, and two positive integers L and R +(L <= R). + +Return the number of (contiguous, non-empty) subarrays such that the value of +the maximum array element in that subarray is at least L and at most R. + +Example : +Input: +A = [2, 1, 4, 3] +L = 2 +R = 3 +Output: 3 +Explanation: There are three subarrays that meet the requirements: [2], [2, 1], +[3]. +Note: + +L, R and A[i] will be an integer in the range [0, 10^9]. +The length of A will be in the range of [1, 50000]. +""" +from typing import List + + +class Solution: + def numSubarrayBoundedMax(self, A: List[int], L: int, R: int) -> int: + """ + DP: Let F[i] be the num subarray with bounded max at A[i] + if L <= A[i] <= R: F[i] = i - prev, where prev is previously invalid F[prev] = 0 + if A[i] > R: F[i] = 0 + if A[i] < L: F[i] = F[i-1] # append itself to every array in F[i-1] + + memory optimization - one counter F is enough + """ + F = 0 + ret = 0 + prev = -1 + for i, a in enumerate(A): + if L <= a <= R: + F = i - prev + ret += F + elif a > R: + F = 0 + prev = i + else: + # F = F + ret += F + + return ret + + def numSubarrayBoundedMax_error(self, A: List[int], L: int, R: int) -> int: + """ + DP: Let F[i] be the num subarray with bounded max at A[i] + if L <= A[i] <= R: F[i] = F[i-1] + 1 # append itself to every array in F[i-1] and one more itself + ^ ERROR + if A[i] > R: F[i] = 0 + if A[i] < L: F[i] = F[i-1] # append itself to every array in F[i-1] + + memory optimization - one counter F is enough + """ + F = 0 + ret = 0 + for a in A: + if L <= a <= R: + F += 1 # error + ret += F + elif a > R: + F = 0 + else: + # F = F + ret += F + + return ret diff --git a/796 Rotate String.py b/796 Rotate String.py new file mode 100644 index 0000000..457c04f --- /dev/null +++ b/796 Rotate String.py @@ -0,0 +1,41 @@ +#!/usr/bin/python3 +""" +We are given two strings, A and B. + +A shift on A consists of taking string A and moving the leftmost character to +the rightmost position. For example, if A = 'abcde', then it will be 'bcdea' +after one shift on A. Return True if and only if A can become B after some +number of shifts on A. + +Example 1: +Input: A = 'abcde', B = 'cdeab' +Output: true + +Example 2: +Input: A = 'abcde', B = 'abced' +Output: false +Note: + +A and B will have length at most 100. +""" + + +class Solution: + def rotateString(self, A: str, B: str) -> bool: + """ + brute force O(n^2), shift and compare but short circuit + """ + if len(A) != len(B): + return False + + if not A and not B: + return True + + for i in range(1, len(A)): + for j in range(len(B)): + if A[(i + j) % len(A)] != B[j]: + break + else: + return True + + return False diff --git a/797 All Paths From Source to Target.py b/797 All Paths From Source to Target.py new file mode 100644 index 0000000..9bd6a8f --- /dev/null +++ b/797 All Paths From Source to Target.py @@ -0,0 +1,47 @@ +#!/usr/bin/python3 +""" +Given a directed, acyclic graph of N nodes. Find all possible paths from node 0 +to node N-1, and return them in any order. + +The graph is given as follows: the nodes are 0, 1, ..., graph.length - 1. +graph[i] is a list of all nodes j for which the edge (i, j) exists. + +Example: +Input: [[1,2], [3], [3], []] +Output: [[0,1,3],[0,2,3]] +Explanation: The graph looks like this: +0--->1 +| | +v v +2--->3 +There are two paths: 0 -> 1 -> 3 and 0 -> 2 -> 3. +Note: + +The number of nodes in the graph will be in the range [2, 15]. +You can print different paths in any order, but you should keep the order of +nodes inside one path. +""" +from typing import List + + +class Solution: + def allPathsSourceTarget(self, graph: List[List[int]]) -> List[List[int]]: + G = graph + ret = [] + visited = [False for _ in G] + self.dfs(G, 0, len(G) - 1, [0], visited, ret) + return ret + + def dfs(self, G, cur, d, cur_path, visited, ret): + if cur == d: + ret.append(list(cur_path)) + return + + for nbr in G[cur]: + if not visited[nbr]: + visited[nbr] = True + cur_path.append(nbr) + # pre-check + self.dfs(G, nbr, d, cur_path, visited, ret) + cur_path.pop() + visited[nbr] = False diff --git a/799 Champagne Tower.py b/799 Champagne Tower.py new file mode 100644 index 0000000..692fb86 --- /dev/null +++ b/799 Champagne Tower.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +We stack glasses in a pyramid, where the first row has 1 glass, the second row +has 2 glasses, and so on until the 100th row. Each glass holds one cup (250ml) +of champagne. + +Then, some champagne is poured in the first glass at the top. When the top most +glass is full, any excess liquid poured will fall equally to the glass +immediately to the left and right of it. When those glasses become full, any +excess champagne will fall equally to the left and right of those glasses, and +so on. (A glass at the bottom row has it's excess champagne fall on the floor.) + +For example, after one cup of champagne is poured, the top most glass is full. +After two cups of champagne are poured, the two glasses on the second row are +half full. After three cups of champagne are poured, those two cups become full +- there are 3 full glasses total now. After four cups of champagne are poured, +the third row has the middle glass half full, and the two outside glasses are a +quarter full, as pictured below. + + + +Now after pouring some non-negative integer cups of champagne, return how full +the j-th glass in the i-th row is (both i and j are 0 indexed.) + + + +Example 1: +Input: poured = 1, query_glass = 1, query_row = 1 +Output: 0.0 +Explanation: We poured 1 cup of champange to the top glass of the tower +(which is indexed as (0, 0)). There will be no excess liquid so all the glasses +under the top glass will remain empty. + +Example 2: +Input: poured = 2, query_glass = 1, query_row = 1 +Output: 0.5 +Explanation: We poured 2 cups of champange to the top glass of the tower +(which is indexed as (0, 0)). There is one cup of excess liquid. The glass +indexed as (1, 0) and the glass indexed as (1, 1) will share the excess liquid +equally, and each will get half cup of champange. + + +Note: + +poured will be in the range of [0, 10 ^ 9]. +query_glass and query_row will be in the range of [0, 99]. +""" +from collections import defaultdict + + +class Solution: + def champagneTower(self, poured: int, query_row: int, query_glass: int) -> float: + """ + Simulation + Instead of keeping track of how much champagne should end up in a + glass, keep track of the total amount of champagne that flows through a + glass. + """ + G = defaultdict(lambda: defaultdict(int)) + G[0][0] = poured + for i in range(query_row): + for j in range(i+1): # i + 1 glasses at row i + excess = max(0, G[i][j] - 1) + G[i+1][j] += excess / 2 + G[i+1][j+1] += excess / 2 + + return min(1, G[query_row][query_glass]) diff --git a/801 Minimum Swaps To Make Sequences Increasing.py b/801 Minimum Swaps To Make Sequences Increasing.py new file mode 100644 index 0000000..9a0f0bd --- /dev/null +++ b/801 Minimum Swaps To Make Sequences Increasing.py @@ -0,0 +1,83 @@ +#!/usr/bin/python3 +""" +We have two integer sequences A and B of the same non-zero length. + +We are allowed to swap elements A[i] and B[i]. Note that both elements are in +the same index position in their respective sequences. + +At the end of some number of swaps, A and B are both strictly increasing. +(A sequence is strictly increasing if and only if A[0] < A[1] < A[2] < ... < +A[A.length - 1].) + +Given A and B, return the minimum number of swaps to make both sequences +strictly increasing. It is guaranteed that the given input always makes it +possible. + +Example: +Input: A = [1,3,5,4], B = [1,2,3,7] +Output: 1 +Explanation: +Swap A[3] and B[3]. Then the sequences are: +A = [1, 3, 5, 7] and B = [1, 2, 3, 4] +which are both strictly increasing. +Note: + +A, B are arrays with the same length, and that length will be in the range +[1, 1000]. +A[i], B[i] are integer values in the range [0, 2000]. +""" + + +class Solution: + def minSwap(self, A: List[int], B: List[int]) -> int: + """ + Let F[0][i] be number of swaps to make satisfy if not swap A[i], B[i] + Let F[1][i] be ... if swap A[i], B[i] + + There is a binary array [0, 1, ...] to denote whether to swap A[i], B[i] + without actually swapping the array + """ + n = len(A) + F = [[0 for _ in range(n)] for _ in range(2)] + F[1][0] = 1 + for i in range(1, n): + if A[i] > max(A[i-1], B[i-1]) and B[i] > max(A[i-1], B[i-1]): + # freedom of two options - swap or not swap + F[0][i] = min(F[0][i-1], F[1][i-1]) + F[1][i] = min(F[0][i-1], F[1][i-1]) + 1 + elif A[i] > A[i-1] and B[i] > B[i-1]: + # elif meaning that has to stick with previous swap choice + # A[i] <= B[i-1] and B[i] <=A[i-1], cannot flip + F[0][i] = F[0][i-1] + F[1][i] = F[1][i-1] + 1 + else: + # has to swap, flip + F[0][i] = F[1][i-1] + F[1][i] = F[0][i-1] + 1 + + return min(F[0][n-1], F[1][n-1]) + + def minSwap_error(self, A: List[int], B: List[int]) -> int: + """ + for length 2 + swap A[0] and B[0] is the same as swapping A[1], B[2] + for length 3 + it is different + 1 10 19 + 3 2 8 + swap can be length - times (swap the other) + """ + t = 0 + for i in range(1, len(A)): + if A[i] <= A[i-1] or B[i] <= B[i-1]: + t += 1 + if t < i + 1 - t: + A[i], B[i] = B[i], A[i] + else: + t = i + 1 - t + + return t + + +if __name__ == "__main__": + assert Solution().minSwap([0,4,4,5,9], [0,1,6,8,10]) diff --git a/802 Find Eventual Safe States.py b/802 Find Eventual Safe States.py new file mode 100644 index 0000000..8356933 --- /dev/null +++ b/802 Find Eventual Safe States.py @@ -0,0 +1,75 @@ +#!/usr/bin/python3 +""" +In a directed graph, we start at some node and every turn, walk along a directed +edge of the graph. If we reach a node that is terminal (that is, it has no +outgoing directed edges), we stop. + +Now, say our starting node is eventually safe if and only if we must eventually +walk to a terminal node. More specifically, there exists a natural number K so +that for any choice of where to walk, we must have stopped at a terminal node in +less than K steps. + +Which nodes are eventually safe? Return them as an array in sorted order. + +The directed graph has N nodes with labels 0, 1, ..., N-1, where N is the length +of graph. The graph is given in the following form: graph[i] is a list of +labels j such that (i, j) is a directed edge of the graph. + +Example: +Input: graph = [[1,2],[2,3],[5],[0],[5],[],[]] +Output: [2,4,5,6] +Here is a diagram of the above graph. + +Illustration of graph + +Note: + +graph will have length at most 10000. +The number of edges in the graph will not exceed 32000. +Each graph[i] will be a sorted list of different integers, chosen within the +range [0, graph.length - 1]. +""" +from typing import List, Set + + +class Solution: + def eventualSafeNodes(self, graph: List[List[int]]) -> List[int]: + """ + detect cycle in the node + prune by nodes with no cycle + """ + visit: List[int] = [0 for _ in graph] # 0 not visted, 1 processing, 2 visited + acyclic: Set[int] = set() + for u in range(len(graph)): + if visit[u] == 0: + self.dfs(graph, u, visit, acyclic) + + return [ + u + for u in range(len(graph)) + if u in acyclic + ] + + def dfs(self, graph, cur, visit, acyclic): + visit[cur] = 1 + for nbr in graph[cur]: + if visit[nbr] == 2: + if nbr in acyclic: + continue + else: + break + if visit[nbr] == 1: + break + if visit[nbr] == 0 and not self.dfs(graph, nbr, visit, acyclic): + break + else: + acyclic.add(cur) + visit[cur] = 2 + return True + + visit[cur] = 2 + return False + + +if __name__ == "__main__": + assert Solution().eventualSafeNodes([[1,2],[2,3],[5],[0],[5],[],[]]) == [2,4,5,6] diff --git a/807 Max Increase to Keep City Skyline.py b/807 Max Increase to Keep City Skyline.py new file mode 100644 index 0000000..ab6c9b0 --- /dev/null +++ b/807 Max Increase to Keep City Skyline.py @@ -0,0 +1,71 @@ +#!/usr/bin/python3 +""" +In a 2 dimensional array grid, each value grid[i][j] represents the height of a +building located there. We are allowed to increase the height of any number of +buildings, by any amount (the amounts can be different for different buildings). +Height 0 is considered to be a building as well. + +At the end, the "skyline" when viewed from all four directions of the grid, i.e. +top, bottom, left, and right, must be the same as the skyline of the original +grid. A city's skyline is the outer contour of the rectangles formed by all the +buildings when viewed from a distance. See the following example. + +What is the maximum total sum that the height of the buildings can be increased? + +Example: +Input: grid = [[3,0,8,4],[2,4,5,7],[9,2,6,3],[0,3,1,0]] +Output: 35 +Explanation: +The grid is: +[ [3, 0, 8, 4], + [2, 4, 5, 7], + [9, 2, 6, 3], + [0, 3, 1, 0] ] + +The skyline viewed from top or bottom is: [9, 4, 8, 7] +The skyline viewed from left or right is: [8, 7, 9, 3] + +The grid after increasing the height of buildings without affecting skylines is: + +gridNew = [ [8, 4, 8, 7], + [7, 4, 7, 7], + [9, 4, 8, 7], + [3, 3, 3, 3] ] + +Notes: + +1 < grid.length = grid[0].length <= 50. +All heights grid[i][j] are in the range [0, 100]. +All buildings in grid[i][j] occupy the entire grid cell: that is, they are a +1 x 1 x grid[i][j] rectangular prism. +""" +from typing import List + + +class Solution: + def maxIncreaseKeepingSkyline(self, grid: List[List[int]]) -> int: + """ + grow the to limit constraint by 2D skyline + """ + m, n = len(grid), len(grid[0]) + # left to right projection + lr = [ + max(row) + for row in grid + ] + # top to bottom projection + tb = [ + max( + grid[i][j] + for i in range(m) + ) + for j in range(n) + ] + + ret = 0 + for i in range(m): + for j in range(n): + diff = min(lr[i], tb[j]) - grid[i][j] + ret += diff + + return ret diff --git a/813 Largest Sum of Averages.py b/813 Largest Sum of Averages.py new file mode 100644 index 0000000..4d01080 --- /dev/null +++ b/813 Largest Sum of Averages.py @@ -0,0 +1,99 @@ +#!/usr/bin/python3 +""" +We partition a row of numbers A into at most K adjacent (non-empty) groups, then +our score is the sum of the average of each group. What is the largest score we +can achieve? + +Note that our partition must use every number in A, and that scores are not +necessarily integers. + +Example: +Input: +A = [9,1,2,3,9] +K = 3 +Output: 20 +Explanation: +The best choice is to partition A into [9], [1, 2, 3], [9]. The answer is +9 + (1 + 2 + 3) / 3 + 9 = 20. +We could have also partitioned A into [9, 1], [2], [3, 9], for example. +That partition would lead to a score of 5 + 2 + 6 = 13, which is worse. + + +Note: + +1 <= A.length <= 100. +1 <= A[i] <= 10000. +1 <= K <= A.length. +Answers within 10^-6 of the correct answer will be accepted as correct. +""" +from typing import List + + +class Solution: + def largestSumOfAverages(self, A: List[int], K: int) -> float: + """ + Memoized Backtracking + Prefix sum + My first hunch is correct + Complexity O(N^2 * K), mark sum and different way of forming groups + (inserting dividers) + + calculating each F[l, k] will need O(N) time, thus total O(n^2 k) + """ + n = len(A) + prefix_sum = [0 for _ in range(n+1)] + for i in range(1, n+1): + prefix_sum[i] = prefix_sum[i-1] + A[i-1] + + F = {} + self.dfs(A, n, prefix_sum, F, K) + return F[n, K] + + def dfs(self, A, l, prefix_sum, F, k): + """ + dfs search divide + make A[:l] k groups + """ + if l < k: + return -float('inf') + + if (l, k) not in F: + if k == 1: + ret = prefix_sum[l] / l + else: + n = len(A) + ret = -float('inf') + for j in range(l-1, -1, -1): + trail = (prefix_sum[l] - prefix_sum[j]) / (l - j) + ret = max( + ret, + self.dfs(A, j, prefix_sum, F, k-1) + trail + ) + + F[l, k] = ret + + return F[l, k] + + def dfs_error(self, A, i, prefix_sum, F, k): + """ + inconvenient + + dfs search divide + make A[:i] 1 group + make A[i:] k - 1 group + """ + if (i, k) not in F: + ret = 0 + avg = prefix_sum[i] / i + ret += avg + ret += max( + # error + self.dfs(A, j, prefix_sum, F, k - 1) + for j in range(i, len(A)) + ) + F[i, k] = ret + + return F[i, k] + + +if __name__ == "__main__": + assert Solution().largestSumOfAverages([9,1,2,3,9], 3) == 20 diff --git a/814 Binary Tree Pruning.py b/814 Binary Tree Pruning.py new file mode 100644 index 0000000..7a969e1 --- /dev/null +++ b/814 Binary Tree Pruning.py @@ -0,0 +1,65 @@ +#!/usr/bin/python3 +""" +We are given the head node root of a binary tree, where additionally every +node's value is either a 0 or a 1. + +Return the same tree where every subtree (of the given tree) not containing a 1 +has been removed. + +(Recall that the subtree of a node X is X, plus every node that is a descendant +of X.) + +Example 1: +Input: [1,null,0,0,1] +Output: [1,null,0,null,1] + +Explanation: +Only the red nodes satisfy the property "every subtree not containing a 1". +The diagram on the right represents the answer. + + +Example 2: +Input: [1,0,1,0,0,0,1] +Output: [1,null,1,null,1] + + + +Example 3: +Input: [1,1,0,1,1,0,1,0] +Output: [1,1,0,1,1,null,1] + + + +Note: + +The binary tree will have at most 100 nodes. +The value of each node will only be 0 or 1. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +from typing import Tuple + + +class Solution: + def pruneTree(self, root: TreeNode) -> TreeNode: + root, _ = self.prune(root) + return root + + def prune(self, node) -> Tuple[TreeNode, bool]: + if not node: + return None, False + + node.left, contain_left = self.prune(node.left) + node.right, contain_right = self.prune(node.right) + if not contain_left and not contain_right and node.val == 0: + return None, False + + return node, True diff --git a/815 Bus Routes.py b/815 Bus Routes.py new file mode 100644 index 0000000..8209712 --- /dev/null +++ b/815 Bus Routes.py @@ -0,0 +1,110 @@ +#!/usr/bin/python3 +""" +We have a list of bus routes. Each routes[i] is a bus route that the i-th bus +repeats forever. For example if routes[0] = [1, 5, 7], this means that the first +bus (0-th indexed) travels in the sequence 1->5->7->1->5->7->1->... forever. + +We start at bus stop S (initially not on a bus), and we want to go to bus stop +T. Travelling by buses only, what is the least number of buses we must take to +reach our destination? Return -1 if it is not possible. + +Example: +Input: +routes = [[1, 2, 7], [3, 6, 7]] +S = 1 +T = 6 +Output: 2 +Explanation: +The best strategy is take the first bus to the bus stop 7, then take the second +bus to the bus stop 6. + +Note: +1 <= routes.length <= 500. +1 <= routes[i].length <= 500. +0 <= routes[i][j] < 10 ^ 6. +""" +from typing import List +from collections import defaultdict + + +class Solution: + def numBusesToDestination(self, routes: List[List[int]], S: int, T: int) -> int: + """ + BFS + bus based nodes rather than stop based nodes + + BFS = O(|V| + |E|) = O(N + N^2), where N is number of routes + Construction = O (N^2 * S), where S is number of stops + """ + if S == T: + return 0 + + routes = [set(e) for e in routes] + G = defaultdict(set) + for i in range(len(routes)): + for j in range(i + 1, len(routes)): + stops_1, stops_2 = routes[i], routes[j] # bus represented by stops + for stop in stops_1: # any(stop in stops_2 for stop in stops_1) + if stop in stops_2: + G[i].add(j) + G[j].add(i) + break + + q = [i for i, stops in enumerate(routes) if S in stops] + target_set = set([i for i, stops in enumerate(routes) if T in stops]) + visited = defaultdict(bool) + for i in q: + visited[i] = True + step = 1 + while q: + cur_q = [] + for e in q: + if e in target_set: + return step + for nbr in G[e]: + if not visited[nbr]: + visited[nbr] = True + cur_q.append(nbr) + + step += 1 + q = cur_q + + return -1 + + def numBusesToDestination_TLE(self, routes: List[List[int]], S: int, T: int) -> int: + """ + BFS + Lest number of buses rather than bus stops + + Connect stops within in bus use one edge in G + """ + G = defaultdict(set) + for stops in routes: + for i in range(len(stops)): + for j in range(i + 1, len(stops)): + u, v = stops[i], stops[j] + G[u].add(v) + G[v].add(u) + + q = [S] + step = 0 + visited = defaultdict(bool) + visited[S] = True # avoid add duplicate + while q: + cur_q = [] + for e in q: + if e == T: + return step + for nbr in G[e]: + if not visited[nbr]: + visited[nbr] = True + cur_q.append(nbr) + + step += 1 + q = cur_q + + return -1 + + +if __name__ == "__main__": + assert Solution().numBusesToDestination([[1, 2, 7], [3, 6, 7]], 1, 6) == 2 diff --git a/820 Short Encoding of Words.py b/820 Short Encoding of Words.py new file mode 100644 index 0000000..3f9affa --- /dev/null +++ b/820 Short Encoding of Words.py @@ -0,0 +1,57 @@ +#!/usr/bin/python3 +""" +Given a list of words, we may encode it by writing a reference string S and a +list of indexes A. + +For example, if the list of words is ["time", "me", "bell"], we can write it as +S = "time#bell#" and indexes = [0, 2, 5]. + +Then for each index, we will recover the word by reading from the reference +string from that index until we reach a "#" character. + +What is the length of the shortest reference string S possible that encodes the +given words? + +Example: + +Input: words = ["time", "me", "bell"] +Output: 10 +Explanation: S = "time#bell#" and indexes = [0, 2, 5]. + +Note: + +1 <= words.length <= 2000. +1 <= words[i].length <= 7. +Each word has only lowercase letters. +""" +from typing import List + + +class Solution: + def minimumLengthEncoding(self, words: List[str]) -> int: + """ + suffix trie + only suffix matters + + fast trie with dict + """ + root = {} + ends = [] + for word in set(words): + cur = root + for c in word[::-1]: + nxt = cur.get(c, {}) + cur[c] = nxt + cur = nxt + + ends.append((cur, len(word))) + + return sum( + l + 1 + for node, l in ends + if len(node) == 0 # no child + ) + + +if __name__ == "__main__": + assert Solution().minimumLengthEncoding(["time", "me", "bell"]) == 10 diff --git a/821 Shortest Distance to a Character.py b/821 Shortest Distance to a Character.py new file mode 100644 index 0000000..27f3cb5 --- /dev/null +++ b/821 Shortest Distance to a Character.py @@ -0,0 +1,40 @@ +#!/usr/bin/python3 +""" +Given a string S and a character C, return an array of integers representing the +shortest distance from the character C in the string. + +Example 1: + +Input: S = "loveleetcode", C = 'e' +Output: [3, 2, 1, 0, 1, 0, 0, 1, 2, 2, 1, 0] + + +Note: + +S string length is in [1, 10000]. +C is a single character, and guaranteed to be in string S. +All letters in S and C are lowercase. +""" +from typing import List + + +class Solution: + def shortestToChar(self, S: str, C: str) -> List[int]: + """ + get the sorted indexes of C + """ + idx = [ + i + for i in range(len(S)) + if S[i] == C + ] + idx = [-float("inf")] + idx + [float("inf")] + ret = [] + i = 0 + for j in range(len(S)): + while not idx[i] <= j < idx[i+1]: + i += 1 + + ret.append(min(j - idx[i], idx[i+1] - j)) + + return ret diff --git a/823 Binary Trees With Factors.py b/823 Binary Trees With Factors.py new file mode 100644 index 0000000..efdad53 --- /dev/null +++ b/823 Binary Trees With Factors.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +Given an array of unique integers, each integer is strictly greater than 1. + +We make a binary tree using these integers and each number may be used for any +number of times. + +Each non-leaf node's value should be equal to the product of the values of it's +children. + +How many binary trees can we make? Return the answer modulo 10 ** 9 + 7. + +Example 1: + +Input: A = [2, 4] +Output: 3 +Explanation: We can make these trees: [2], [4], [4, 2, 2] +Example 2: + +Input: A = [2, 4, 5, 10] +Output: 7 +Explanation: We can make these trees: [2], [4], [5], [10], [4, 2, 2], +[10, 2, 5], [10, 5, 2]. + +Note: + +1 <= A.length <= 1000. +2 <= A[i] <= 10 ^ 9. +""" +from typing import List + + +MOD = 10 ** 9 + 7 + + +class Solution: + def numFactoredBinaryTrees(self, A: List[int]) -> int: + """ + Let F[i] be the number of factored binary tree rooted at i + """ + A.sort() + F = {} + for i in range(len(A)): + F[A[i]] = 1 + for j in range(i): + if A[i] % A[j] == 0 and A[i] // A[j] in F: + F[A[i]] += F[A[j]] * F[A[i] // A[j]] # #left * #right + F[A[i]] %= MOD + + return sum(F.values()) % MOD diff --git a/826 Most Profit Assigning Work.py b/826 Most Profit Assigning Work.py new file mode 100644 index 0000000..042886a --- /dev/null +++ b/826 Most Profit Assigning Work.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +We have jobs: difficulty[i] is the difficulty of the ith job, and profit[i] is +the profit of the ith job. + +Now we have some workers. worker[i] is the ability of the ith worker, which +means that this worker can only complete a job with difficulty at most worker[i]. + +Every worker can be assigned at most one job, but one job can be completed +multiple times. + +For example, if 3 people attempt the same job that pays $1, then the total +profit will be $3. If a worker cannot complete any job, his profit is $0. + +What is the most profit we can make? + +Example 1: + +Input: difficulty = [2,4,6,8,10], profit = [10,20,30,40,50], worker = [4,5,6,7] +Output: 100 +Explanation: Workers are assigned jobs of difficulty [4,4,6,6] and they get +profit of [20,20,30,30] seperately. +Notes: + +1 <= difficulty.length = profit.length <= 10000 +1 <= worker.length <= 10000 +difficulty[i], profit[i], worker[i] are in range [1, 10^5] +""" +from typing import List + + +class Solution: + def maxProfitAssignment(self, difficulty: List[int], profit: List[int], worker: List[int]) -> int: + """ + Greedy? Sort by profit + """ + tasks = list(sorted(zip(profit, difficulty))) + worker.sort() + i = len(tasks) - 1 + j = len(worker) - 1 + ret = 0 + while i >= 0 and j >= 0: + pro, diff = tasks[i] + if worker[j] >= diff: + ret += pro + j -= 1 + else: + i -= 1 + + return ret diff --git a/829 Consecutive Numbers Sum.py b/829 Consecutive Numbers Sum.py new file mode 100644 index 0000000..dc015b5 --- /dev/null +++ b/829 Consecutive Numbers Sum.py @@ -0,0 +1,88 @@ +#!/usr/bin/python3 +""" +Given a positive integer N, how many ways can we write it as a sum of consecutive +positive integers? + +Example 1: + +Input: 5 +Output: 2 +Explanation: 5 = 5 = 2 + 3 +Example 2: + +Input: 9 +Output: 3 +Explanation: 9 = 9 = 4 + 5 = 2 + 3 + 4 +Example 3: + +Input: 15 +Output: 4 +Explanation: 15 = 15 = 8 + 7 = 4 + 5 + 6 = 1 + 2 + 3 + 4 + 5 +Note: 1 <= N <= 10 ^ 9. +""" + + +class Solution: + def consecutiveNumbersSum(self, N: int) -> int: + """ + Arithmetic Array + math + + (x0 + xn) * (xn - x0 + 1) / 2 = N + xn = x0 + k - 1 + (2x0 + k - 1) * k / 2 = N + 2x0 = 2N / k - k + 1 + + x0 * k = N - k * (k - 1) / 2 + # assure for divisibility + """ + cnt = 0 + k = 0 + while True: + k += 1 + x0k = N - k * (k - 1) // 2 + if x0k <= 0 : + break + if x0k % k == 0: + cnt += 1 + + return cnt + + def consecutiveNumbersSum_error(self, N: int) -> int: + """ + Arithmetic Array + math + + (x0 + xn) * (xn - x0 + 1) / 2 = N + xn = x0 + k - 1 + (2x0 + k - 1) * k / 2 = N + 2x0 = 2N / k - k + 1 + + x0 * k = N - k * (k - 1) / 2 + # assure for divisibility + """ + cnt = 0 + for k in range(1, int(N ** 0.5)): # error + x0k = N - k * (k - 1) // 2 + if x0k % k == 0: + cnt += 1 + + return cnt + + def consecutiveNumbersSum_error(self, N: int) -> int: + """ + factor related + 9 / 3 = 3 + """ + if N == 1: + return 1 + + cnt = 0 + for i in range(1, N): + d = N // i + r = N % i + if r == 0 and d - i // 2 > 0: + cnt += 1 + elif r == 1 and N == (d + d + 1) * i // 2: + cnt += 1 + return cnt diff --git a/830 Positions of Large Groups.py b/830 Positions of Large Groups.py new file mode 100644 index 0000000..ee987bf --- /dev/null +++ b/830 Positions of Large Groups.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +In a string S of lowercase letters, these letters form consecutive groups of the +same character. + +For example, a string like S = "abbxxxxzyy" has the groups "a", "bb", "xxxx", +"z" and "yy". + +Call a group large if it has 3 or more characters. We would like the starting +and ending positions of every large group. + +The final answer should be in lexicographic order. + + + +Example 1: + +Input: "abbxxxxzzy" +Output: [[3,6]] +Explanation: "xxxx" is the single large group with starting 3 and ending +positions 6. +Example 2: + +Input: "abc" +Output: [] +Explanation: We have "a","b" and "c" but no large group. +Example 3: + +Input: "abcdddeeeeaabbbcd" +Output: [[3,5],[6,9],[12,14]] + +Note: 1 <= S.length <= 1000 +""" +from typing import List + + +class Solution: + def largeGroupPositions(self, S: str) -> List[List[int]]: + i = 0 + j = 0 + ret = [] + n = len(S) + while j < n: + while j < n and S[i] == S[j]: + j += 1 + if j - i >= 3: + ret.append([i, j - 1]) + i = j + + return ret diff --git a/832 Flipping an Image.py b/832 Flipping an Image.py new file mode 100644 index 0000000..c016d85 --- /dev/null +++ b/832 Flipping an Image.py @@ -0,0 +1,42 @@ +#!/usr/bin/python3 +""" +Given a binary matrix A, we want to flip the image horizontally, then invert it +, and return the resulting image. + +To flip an image horizontally means that each row of the image is reversed. +For example, flipping [1, 1, 0] horizontally results in [0, 1, 1]. + +To invert an image means that each 0 is replaced by 1, and each 1 is replaced by +0. For example, inverting [0, 1, 1] results in [1, 0, 0]. + +Example 1: + +Input: [[1,1,0],[1,0,1],[0,0,0]] +Output: [[1,0,0],[0,1,0],[1,1,1]] +Explanation: First reverse each row: [[0,1,1],[1,0,1],[0,0,0]]. +Then, invert the image: [[1,0,0],[0,1,0],[1,1,1]] +Example 2: + +Input: [[1,1,0,0],[1,0,0,1],[0,1,1,1],[1,0,1,0]] +Output: [[1,1,0,0],[0,1,1,0],[0,0,0,1],[1,0,1,0]] +Explanation: First reverse each row: [[0,0,1,1],[1,0,0,1],[1,1,1,0],[0,1,0,1]]. +Then invert the image: [[1,1,0,0],[0,1,1,0],[0,0,0,1],[1,0,1,0]] +Notes: + +1 <= A.length = A[0].length <= 20 +0 <= A[i][j] <= 1 +""" +from typing import List + + +class Solution: + def flipAndInvertImage(self, A: List[List[int]]) -> List[List[int]]: + """ + one pass + """ + for row in A: + prev = list(row) + for i in range(len(row)): + row[i] = prev[-1-i] ^ 1 + + return A diff --git a/835 Image Overlap.py b/835 Image Overlap.py new file mode 100644 index 0000000..902802a --- /dev/null +++ b/835 Image Overlap.py @@ -0,0 +1,67 @@ +""" +You are given two images, img1 and img2, represented as binary, square matrices of size n x n. A binary matrix has only 0s and 1s as values. + +We translate one image however we choose by sliding all the 1 bits left, right, up, and/or down any number of units. We then place it on top of the other image. We can then calculate the overlap by counting the number of positions that have a 1 in both images. + +Note also that a translation does not include any kind of rotation. Any 1 bits that are translated outside of the matrix borders are erased. + +Return the largest possible overlap. + + + +Example 1: + + +Input: img1 = [[1,1,0],[0,1,0],[0,1,0]], img2 = [[0,0,0],[0,1,1],[0,0,1]] +Output: 3 +Explanation: We translate img1 to right by 1 unit and down by 1 unit. + +The number of positions that have a 1 in both images is 3 (shown in red). + +Example 2: + +Input: img1 = [[1]], img2 = [[1]] +Output: 1 +Example 3: + +Input: img1 = [[0]], img2 = [[0]] +Output: 0 + + +Constraints: + +n == img1.length == img1[i].length +n == img2.length == img2[i].length +1 <= n <= 30 +img1[i][j] is either 0 or 1. +img2[i][j] is either 0 or 1. +""" +class Solution: + def largestOverlap(self, img1: List[List[int]], img2: List[List[int]]) -> int: + """ + sliding - 4 dirs any offset + sliding outside - the relative position doesn't change + + brute force: starting from any position of img1, and img2, dfs + O(N^2 * N^2 * N) + + better brute force: + Chekc Overlap O(N^2) + Offset - sliding 2N horizontailly, 2N vertically + """ + M = len(img1) + N = len(img1[0]) + maxa = 0 + for di in range(-M+1, M): + for dj in range(-N+1, N): + cur = 0 + for i in range(M): + for j in range(N): + I = i + di + J = j + dj + if 0 <= I < M and 0 <= J < N: + if img1[I][J] == img2[i][j] and img1[I][J] == 1: + cur += 1 + maxa = max(maxa, cur) + + return maxa \ No newline at end of file diff --git a/836 Rectangle Overlap.py b/836 Rectangle Overlap.py new file mode 100644 index 0000000..f7f2011 --- /dev/null +++ b/836 Rectangle Overlap.py @@ -0,0 +1,55 @@ +#!/usr/bin/python3 +""" +A rectangle is represented as a list [x1, y1, x2, y2], where (x1, y1) are the +coordinates of its bottom-left corner, and (x2, y2) are the coordinates of its +top-right corner. + +Two rectangles overlap if the area of their intersection is positive. To be +clear, two rectangles that only touch at the corner or edges do not overlap. + +Given two (axis-aligned) rectangles, return whether they overlap. + +Example 1: + +Input: rec1 = [0,0,2,2], rec2 = [1,1,3,3] +Output: true +Example 2: + +Input: rec1 = [0,0,1,1], rec2 = [1,0,2,1] +Output: false +Notes: + +Both rectangles rec1 and rec2 are lists of 4 integers. +All coordinates in rectangles will be between -10^9 and 10^9. +""" +from typing import List + + +class Solution: + def isRectangleOverlap(self, rec1: List[int], rec2: List[int]) -> bool: + """ + De Morgan's Law + 0 1 2 3 + [left_x, left_y, right_x, right_y] + + Non-overlap if on the left, right, top, bottom + """ + return not ( + rec1[2] <= rec2[0] or # left + rec1[0] >= rec2[2] or # right + rec1[1] >= rec2[3] or # top + rec1[3] <= rec2[1] # bottom + ) + + + def isRectangleOverlap_error(self, rec1: List[int], rec2: List[int]) -> bool: + if rec1[0] > rec2[0]: + return self.isRectangleOverlap(rec2, rec1) + + return ( + rect1[0] < rect2[0] < rec1[2] and + ( + rec2[1] < rect1[3] < rect2[3] or + rec2[3] < rect1[3] < rect2[1] + ) + ) diff --git a/837 New 21 Game.py b/837 New 21 Game.py new file mode 100644 index 0000000..fbff914 --- /dev/null +++ b/837 New 21 Game.py @@ -0,0 +1,91 @@ +#!/usr/bin/python3 +""" +Alice plays the following game, loosely based on the card game "21". + +Alice starts with 0 points, and draws numbers while she has less than K points. +During each draw, she gains an integer number of points randomly from the range +[1, W], where W is an integer. Each draw is independent and the outcomes have +equal probabilities. + +Alice stops drawing numbers when she gets K or more points. What is the +probability that she has N or less points? + +Example 1: + +Input: N = 10, K = 1, W = 10 +Output: 1.00000 +Explanation: Alice gets a single card, then stops. +Example 2: + +Input: N = 6, K = 1, W = 10 +Output: 0.60000 +Explanation: Alice gets a single card, then stops. +In 6 out of W = 10 possibilities, she is at or below N = 6 points. +Example 3: + +Input: N = 21, K = 17, W = 10 +Output: 0.73278 +Note: + +0 <= K <= N <= 10000 +1 <= W <= 10000 +Answers will be accepted as correct if they are within 10^-5 of the correct +answer. +The judging time limit has been reduced for this question. +""" + + +class Solution: + def new21Game(self, N: int, K: int, W: int) -> float: + """ + F[i]: probability of get points i + F[i] = F[j] * (1 / W) for every i - j <= W + => O(N*W) + F[i] = sum(last W dp values) * (1 / W) + To get cur_sum, where cur_sum = sum(last W dp values), we can maintain a + sliding window with size at most K. + => O(N) + """ + if K == 0: + return 1 + + F = [0 for _ in range(N+1)] + F[0] = 1 + cur_sum = F[0] + ret = 0 + for i in range(1, N+1): + F[i] = cur_sum * (1/W) + if i >= K: + ret += F[i] + # stop + else: + cur_sum += F[i] + + if i - W >= 0: + cur_sum -= F[i - W] + + return ret + + def new21Game_error(self, N: int, K: int, W: int) -> float: + """ + DP + Let F[i] be the probability of reaching point i + + O(N^2) + """ + F = [0 for _ in range(K+W+1)] + F[0] = 1 + for i in range(1, K+W+1): + for j in range(W, 0, -1): + if i - j >= K: + break + if i - j >= 0: + F[i] += F[i-j] * 1 / W + + ret = sum(F[1:N+1]) # error + print(F, ret) + return ret + + +if __name__ == "__main__": + assert Solution().new21Game(6, 1, 10) == 0.6 diff --git a/838 Push Dominoes.py b/838 Push Dominoes.py new file mode 100644 index 0000000..f49adf6 --- /dev/null +++ b/838 Push Dominoes.py @@ -0,0 +1,87 @@ +#!/usr/bin/python3 +""" +There are N dominoes in a line, and we place each domino vertically upright. + +In the beginning, we simultaneously push some of the dominoes either to the left +or to the right. + + + +After each second, each domino that is falling to the left pushes the adjacent +domino on the left. + +Similarly, the dominoes falling to the right push their adjacent dominoes +standing on the right. + +When a vertical domino has dominoes falling on it from both sides, it stays +still due to the balance of the forces. + +For the purposes of this question, we will consider that a falling domino +expends no additional force to a falling or already fallen domino. + +Given a string "S" representing the initial state. S[i] = 'L', if the i-th +domino has been pushed to the left; S[i] = 'R', if the i-th domino has been pushed to the right; S[i] = '.', if the i-th domino has not been pushed. + +Return a string representing the final state. + +Example 1: + +Input: ".L.R...LR..L.." +Output: "LL.RR.LLRRLL.." +Example 2: + +Input: "RR.L" +Output: "RR.L" +Explanation: The first domino expends no additional force on the second domino. +Note: + +0 <= N <= 10^5 +String dominoes contains only 'L', 'R' and '.' +""" + + +class Solution: + def pushDominoes(self, dominoes: str) -> str: + """ + DP L & R from both ends + Let L[i] be the distance to the "L" from the right + + we will consider that a falling domino expends no additional force + """ + n = len(dominoes) + L = [float("inf") for i in range(n)] + R = [float("inf") for i in range(n)] + for i in range(n-1, -1, -1): + if dominoes[i] == "L": + L[i] = 0 + elif dominoes[i] == "R": + L[i] = float("inf") + elif i + 1 < n: + L[i] = L[i+1] + 1 + + for i in range(n): + if dominoes[i] == "R": + R[i] = 0 + elif dominoes[i] == "L": + R[i] = float("inf") + elif i - 1 >= 0: + R[i] = R[i-1] + 1 + + ret = [] + for i in range(n): + d = min(R[i], L[i]) + if d == float("inf"): + cur = "." + elif R[i] == L[i]: + cur = "." + elif d == R[i]: + cur = "R" + else: + cur = "L" + ret.append(cur) + + return "".join(ret) + + +if __name__ == "__main__": + assert Solution().pushDominoes(".L.R...LR..L..") == "LL.RR.LLRRLL.." diff --git a/840 Magic Squares In Grid.py b/840 Magic Squares In Grid.py new file mode 100644 index 0000000..b7b35bd --- /dev/null +++ b/840 Magic Squares In Grid.py @@ -0,0 +1,90 @@ +""" +A 3 x 3 magic square is a 3 x 3 grid filled with distinct numbers from 1 to 9 such that each row, column, and both diagonals all have the same sum. + +Given a row x col grid of integers, how many 3 x 3 magic square subgrids are there? + +Note: while a magic square can only contain numbers from 1 to 9, grid may contain numbers up to 15. + + + +Example 1: + + +Input: grid = [[4,3,8,4],[9,5,1,9],[2,7,6,2]] +Output: 1 +Explanation: +The following subgrid is a 3 x 3 magic square: + +while this one is not: + +In total, there is only one magic square inside the given grid. +Example 2: + +Input: grid = [[8]] +Output: 0 + + +Constraints: + +row == grid.length +col == grid[i].length +1 <= row, col <= 10 +0 <= grid[i][j] <= 15 +""" +class Solution: + def numMagicSquaresInside(self, grid: List[List[int]]) -> int: + """ + brute force O(N^2) * O(N^2) + + sliding submatrix + + O(N^2) * O(N) + """ + M = len(grid) + N = len(grid[0]) + + magics = [ + [ + [4, 9, 2], + [3, 5, 7], + [8, 1, 6]], + [ + [2, 7, 6], + [9, 5, 1], + [4, 3, 8]], + [ + [6, 1, 8], + [7, 5, 3], + [2, 9, 4]], + [ + [8, 3, 4], + [1, 5, 9], + [6, 7, 2]], + [ + [4, 3, 8], + [9, 5, 1], + [2, 7, 6]], + [ + [2, 9, 4], + [7, 5, 3], + [6, 1, 8]], + [ + [6, 7, 2], + [1, 5, 9], + [8, 3, 4]], + [ + [8, 1, 6], + [3, 5, 7], + [4, 9, 2]] + ] + + cnt = 0 + for r in range(M - 2): + for c in range(N - 2): + subgrid = [ + grid[r + i][c:c + 3] + for i in range(3) + ] + if subgrid in magics: + cnt += 1 + return cnt diff --git a/841 Keys and Rooms.py b/841 Keys and Rooms.py new file mode 100644 index 0000000..bf91493 --- /dev/null +++ b/841 Keys and Rooms.py @@ -0,0 +1,61 @@ +#!/usr/bin/python3 +""" +There are N rooms and you start in room 0. Each room has a distinct number in +0, 1, 2, ..., N-1, and each room may have some keys to access the next room. + +Formally, each room i has a list of keys rooms[i], and each key rooms[i][j] is +an integer in [0, 1, ..., N-1] where N = rooms.length. A key rooms[i][j] = v +opens the room with number v. + +Initially, all the rooms start locked (except for room 0). + +You can walk back and forth between rooms freely. + +Return true if and only if you can enter every room. + +Example 1: + +Input: [[1],[2],[3],[]] +Output: true +Explanation: +We start in room 0, and pick up key 1. +We then go to room 1, and pick up key 2. +We then go to room 2, and pick up key 3. +We then go to room 3. Since we were able to go to every room, we return true. +Example 2: + +Input: [[1,3],[3,0,1],[2],[0]] +Output: false +Explanation: We can't enter the room with number 2. +Note: + +1 <= rooms.length <= 1000 +0 <= rooms[i].length <= 1000 +The number of keys in all rooms combined is at most 3000. +""" +from typing import List + + +class Solution: + def canVisitAllRooms(self, G: List[List[int]]) -> bool: + """ + starting from 0 + + need a queue to keep track of processing nodes? Implicitly handle by dfs + stacks + """ + n = len(G) + visited = [0 for _ in range(n)] # 0 locked, 1 visited + self.dfs(G, 0, visited) + return all(e == 1 for e in visited) + + def dfs(self, G, u, visited): + visited[u] = 1 + for nbr in G[u]: + if not visited[nbr]: + self.dfs(G, nbr, visited) + + +if __name__ == "__main__": + assert Solution().canVisitAllRooms([[1],[2],[3],[]]) == True + assert Solution().canVisitAllRooms([[1,3],[3,0,1],[2],[0]]) == False diff --git a/842 Split Array into Fibonacci Sequence.py b/842 Split Array into Fibonacci Sequence.py new file mode 100644 index 0000000..5d93d4f --- /dev/null +++ b/842 Split Array into Fibonacci Sequence.py @@ -0,0 +1,103 @@ +#!/usr/bin/python3 +""" +Given a string S of digits, such as S = "123456579", we can split it into a +Fibonacci-like sequence [123, 456, 579]. + +Formally, a Fibonacci-like sequence is a list F of non-negative integers such +that: + +0 <= F[i] <= 2^31 - 1, (that is, each integer fits a 32-bit signed integer +type); +F.length >= 3; +and F[i] + F[i+1] = F[i+2] for all 0 <= i < F.length - 2. +Also, note that when splitting the string into pieces, each piece must not have +extra leading zeroes, except if the piece is the number 0 itself. + +Return any Fibonacci-like sequence split from S, or return [] if it cannot be +done. + +Example 1: + +Input: "123456579" +Output: [123,456,579] +Example 2: + +Input: "11235813" +Output: [1,1,2,3,5,8,13] +Example 3: + +Input: "112358130" +Output: [] +Explanation: The task is impossible. +Example 4: + +Input: "0123" +Output: [] +Explanation: Leading zeroes are not allowed, so "01", "2", "3" is not valid. +Example 5: + +Input: "1101111" +Output: [110, 1, 111] +Explanation: The output [11, 0, 11, 11] would also be accepted. +Note: + +1 <= S.length <= 200 +S contains only digits. +""" +from typing import List + + +MAX = 2 ** 31 - 1 + + +class Solution: + def splitIntoFibonacci(self, S: str) -> List[int]: + """ + The first two elements of the array uniquely determine the rest of the + sequence. + + 2^31 - 1 is length 10 + brute force + """ + l = len(S) + for i in range(1, l + 1): + num_str = S[:i] + if len(num_str) > 1 and num_str.startswith("0"): + continue + + num = int(num_str) + if num > MAX: + break + + for j in range(i + 1, l + 1): + num2_str = S[i:j] + if len(num2_str) > 1 and num2_str.startswith("0"): + continue + + num2 = int(num2_str) + if num2 > MAX: + break + + ret = [num, num2] + k = j + while k < l: + nxt = ret[-1] + ret[-2] + if nxt > MAX: + break + + nxt_str = str(nxt) + if S[k:k+len(nxt_str)] == nxt_str: + k = k + len(nxt_str) + ret.append(nxt) + else: + break + else: + if k == l and len(ret) >= 3: + return ret + + return [] + + +if __name__ == "__main__": + assert Solution().splitIntoFibonacci("123456579") == [123,456,579] + assert Solution().splitIntoFibonacci("01123581321345589") == [0,1,1,2,3,5,8,13,21,34,55,89] diff --git a/843 Guess the Word.py b/843 Guess the Word.py new file mode 100644 index 0000000..e6f703f --- /dev/null +++ b/843 Guess the Word.py @@ -0,0 +1,54 @@ +#!/usr/bin/python3 +""" +This problem is an interactive problem new to the LeetCode platform. + +We are given a word list of unique words, each word is 6 letters long, and one +word in this list is chosen as secret. + +You may call master.guess(word) to guess a word. The guessed word should have +type string and must be from the original list with 6 lowercase letters. + +This function returns an integer type, representing the number of exact matches +(value and position) of your guess to the secret word. Also, if your guess is +not in the given wordlist, it will return -1 instead. + +For each test case, you have 10 guesses to guess the word. At the end of any +number of calls, if you have made 10 or less calls to master.guess and at least +one of these guesses was the secret, you pass the testcase. + +Besides the example test case below, there will be 5 additional test cases, each +with 100 words in the word list. The letters of each word in those testcases +were chosen independently at random from 'a' to 'z', such that every word in the +given word lists is unique. + +Example 1: +Input: secret = "acckzz", wordlist = ["acckzz","ccbazz","eiowzz","abcczz"] + +Explanation: + +master.guess("aaaaaa") returns -1, because "aaaaaa" is not in wordlist. +master.guess("acckzz") returns 6, because "acckzz" is secret and has all 6 +matches. +master.guess("ccbazz") returns 3, because "ccbazz" has 3 matches. +master.guess("eiowzz") returns 2, because "eiowzz" has 2 matches. +master.guess("abcczz") returns 4, because "abcczz" has 4 matches. + +We made 5 calls to master.guess and one of them was the secret, so we pass the +test case. +""" + +""" +This is Master's API interface. +You should not implement it, or speculate about its implementation +""" +class Master: + def guess(self, word: str) -> int: + pass + + +class Solution: + def findSecretWord(self, wordlist: List[str], master: Master) -> None: + """ + 10 guesses + at least one of these guesses was the secret, you pass the testcase. + """ diff --git a/844 Backspace String Compare.py b/844 Backspace String Compare.py new file mode 100644 index 0000000..9be425a --- /dev/null +++ b/844 Backspace String Compare.py @@ -0,0 +1,58 @@ +#!/usr/bin/python3 +""" +Given two strings S and T, return if they are equal when both are typed into +empty text editors. # means a backspace character. + +Example 1: + +Input: S = "ab#c", T = "ad#c" +Output: true +Explanation: Both S and T become "ac". +Example 2: + +Input: S = "ab##", T = "c#d#" +Output: true +Explanation: Both S and T become "". +Example 3: + +Input: S = "a##c", T = "#a#c" +Output: true +Explanation: Both S and T become "c". +Example 4: + +Input: S = "a#c", T = "b" +Output: false +Explanation: S becomes "c" while T becomes "b". +Note: + +1 <= S.length <= 200 +1 <= T.length <= 200 +S and T only contain lowercase letters and '#' characters. +Follow up: + +Can you solve it in O(N) time and O(1) space? +""" + + +class Solution: + def backspaceCompare(self, S: str, T: str) -> bool: + """ + stk + use a stk to build the string + + Another approach: + Iterate the string reversely. When encountering "#", count, and skip + the chars based on skip count. + """ + return self.make_stk(S) == self.make_stk(T) + + def make_stk(self, S): + stk = [] + for s in S: + if s == "#": + if stk: + stk.pop() + else: + stk.append(s) + + return stk diff --git a/845 Longest Mountain in Array.py b/845 Longest Mountain in Array.py new file mode 100644 index 0000000..e8de2c3 --- /dev/null +++ b/845 Longest Mountain in Array.py @@ -0,0 +1,114 @@ +#!/usr/bin/python3 +""" +Let's call any (contiguous) subarray B (of A) a mountain if the following +properties hold: + +B.length >= 3 +There exists some 0 < i < B.length - 1 such that B[0] < B[1] < ... B[i-1] < +B[i] > B[i+1] > ... > B[B.length - 1] +(Note that B could be any subarray of A, including the entire array A.) + +Given an array A of integers, return the length of the longest mountain. + +Return 0 if there is no mountain. + +Example 1: + +Input: [2,1,4,7,3,2,5] +Output: 5 +Explanation: The largest mountain is [1,4,7,3,2] which has length 5. +Example 2: + +Input: [2,2,2] +Output: 0 +Explanation: There is no mountain. +Note: + +0 <= A.length <= 10000 +0 <= A[i] <= 10000 +Follow up: + +Can you solve it using only one pass? +Can you solve it in O(1) space? +""" +from typing import List + + +class Solution: + def longestMountain(self, A: List[int]) -> int: + """ + dp + """ + ret = 0 + up_cnt = 0 + down_cnt = 0 + for i in range(1, len(A)): + if down_cnt and A[i] >= A[i-1]: + up_cnt = 0 + down_cnt = 0 + if A[i] > A[i-1]: + up_cnt += 1 + elif A[i] < A[i-1]: + down_cnt += 1 + if up_cnt and down_cnt: + ret = max(ret, up_cnt + down_cnt + 1) + + return ret + + def longestMountain(self, A: List[int]) -> int: + """ + dp + """ + n = len(A) + U = [0 for _ in A] # up counter from left to right + D = [0 for _ in A] # down counter from right to left + for i in range(1, n): + if A[i] > A[i-1]: + U[i] = U[i-1] + 1 + for i in range(n-2, -1, -1): + if A[i] > A[i+1]: + D[i] = D[i+1] + 1 + + ret = 0 + for i in range(n): + if U[i] > 0 and D[i] > 0: + ret = max(ret, U[i] + D[i] + 1) + + return ret + + def longestMountain_complicated(self, A: List[int]) -> int: + """ + a flag to indicate expecting increase or decrease + one-pass can + """ + ret = 0 + l = 1 + expect_incr = True + for i in range(1, len(A)): + if expect_incr: + if A[i] > A[i-1]: + l += 1 + elif A[i] < A[i-1] and l >= 2: + expect_incr = False + l += 1 + ret = max(ret, l) + else: + l = 1 + + else: + if A[i] < A[i-1]: + l += 1 + ret = max(ret, l) + elif A[i] == A[i-1]: + expect_incr = True + l = 1 + else: + expect_incr = True + l = 2 + + return ret if ret >= 3 else 0 + + +if __name__ == "__main__": + assert Solution().longestMountain([2,1,4,7,3,2,5]) == 5 + assert Solution().longestMountain([9,8,7,6,5,4,3,2,1,0]) == 0 diff --git a/846 Hand of Straights.py b/846 Hand of Straights.py new file mode 100644 index 0000000..4e538a9 --- /dev/null +++ b/846 Hand of Straights.py @@ -0,0 +1,95 @@ +#!/usr/bin/python3 +""" +Alice has a hand of cards, given as an array of integers. + +Now she wants to rearrange the cards into groups so that each group is size W, +and consists of W consecutive cards. + +Return true if and only if she can. + + + +Example 1: + +Input: hand = [1,2,3,6,2,3,4,7,8], W = 3 +Output: true +Explanation: Alice's hand can be rearranged as [1,2,3],[2,3,4],[6,7,8]. +Example 2: + +Input: hand = [1,2,3,4,5], W = 4 +Output: false +Explanation: Alice's hand can't be rearranged into groups of 4. + + +Note: + +1 <= hand.length <= 10000 +0 <= hand[i] <= 10^9 +1 <= W <= hand.length +""" +from typing import List +from collections import Counter, deque +import heapq + + +class Solution: + def isNStraightHand(self, A: List[int], W: int) -> bool: + """ + sort + queue + + prev = previous value + prev_cnt = previous value count + """ + q = deque() + counter = Counter(A) + prev = 0 + prev_cnt = 0 + for k in sorted(counter): # sorted by key + if prev_cnt > counter[k] or prev_cnt > 0 and k > prev + 1: + return False + + q.append(counter[k] - prev_cnt) + prev, prev_cnt = k, counter[k] + if len(q) == W: + c = q.popleft() + prev_cnt -= c + + return prev_cnt == 0 + + def isNStraightHand_heap(self, A: List[int], W: int) -> bool: + """ + sort + heap + O(N log N + N log N) + """ + A.sort() + if len(A) % W != 0: + return False + if W == 1: + return True + + + h = [] # tuple of (-3, [1, 2, 3]) + for a in A: + if not h: + h = [(a, [a])] + continue + + if a == h[0][1][-1]: + heapq.heappush(h, (a, [a])) + elif a == h[0][1][-1] + 1: + _, lst = heapq.heappop(h) + lst.append(a) + if len(lst) < W: + heapq.heappush(h, (a, lst)) + else: + return False + + if h: + return False + + return True + + +if __name__ == "__main__": + assert Solution().isNStraightHand([1,2,3,6,2,3,4,7,8], 3) == True + assert Solution().isNStraightHand([1,1,2,2,3,3], 3) == True diff --git a/848 Shifting Letters.py b/848 Shifting Letters.py new file mode 100644 index 0000000..be6eab9 --- /dev/null +++ b/848 Shifting Letters.py @@ -0,0 +1,51 @@ +#!/usr/bin/python3 +""" +We have a string S of lowercase letters, and an integer array shifts. + +Call the shift of a letter, the next letter in the alphabet, (wrapping around so +that 'z' becomes 'a'). + +For example, shift('a') = 'b', shift('t') = 'u', and shift('z') = 'a'. + +Now for each shifts[i] = x, we want to shift the first i+1 letters of S, x times. + +Return the final string after all such shifts to S are applied. + +Example 1: + +Input: S = "abc", shifts = [3,5,9] +Output: "rpl" +Explanation: +We start with "abc". +After shifting the first 1 letters of S by 3, we have "dbc". +After shifting the first 2 letters of S by 5, we have "igc". +After shifting the first 3 letters of S by 9, we have "rpl", the answer. +Note: + +1 <= S.length = shifts.length <= 20000 +0 <= shifts[i] <= 10 ^ 9 +""" +from typing import List + + +class Solution: + def shiftingLetters(self, S: str, shifts: List[int]) -> str: + """ + preprocess shifts + """ + n = len(shifts) + for i in range(n-2, -1, -1): + shifts[i] += shifts[i+1] + shifts[i] %= 26 + + ret = [] + for i, s in enumerate(S): + b = (ord(s) + shifts[i] - ord('a')) % 26 + ord('a') + b = chr(b) + ret.append(b) + + return "".join(ret) + + +if __name__ == "__main__": + assert Solution().shiftingLetters("abc", [3, 5, 9]) == "rpl" diff --git a/849 Maximize Distance to Closest Person.py b/849 Maximize Distance to Closest Person.py new file mode 100644 index 0000000..a538ed4 --- /dev/null +++ b/849 Maximize Distance to Closest Person.py @@ -0,0 +1,90 @@ +#!/usr/bin/python3 +""" +In a row of seats, 1 represents a person sitting in that seat, and 0 represents +that the seat is empty. + +There is at least one empty seat, and at least one person sitting. + +Alex wants to sit in the seat such that the distance between him and the closest +person to him is maximized. + +Return that maximum distance to closest person. + +Example 1: + +Input: [1,0,0,0,1,0,1] +Output: 2 +Explanation: +If Alex sits in the second open seat (seats[2]), then the closest person has +distance 2. +If Alex sits in any other open seat, the closest person has distance 1. +Thus, the maximum distance to the closest person is 2. +Example 2: + +Input: [1,0,0,0] +Output: 3 +Explanation: +If Alex sits in the last seat, the closest person is 3 seats away. +This is the maximum distance possible, so the answer is 3. +Note: + +1 <= seats.length <= 20000 +seats contains only 0s or 1s, at least one 0, and at least one 1. +""" +from typing import List + + +class Solution: + def maxDistToClosest(self, seats: List[int]) -> int: + """ + DP from left and right - next array + Let L[i] be the distant to the left 1 at A[i] + Let R[i] ... + """ + n = len(seats) + L = [float("inf") for _ in range(n)] + R = [float("inf") for _ in range(n)] + for i in range(n): + if seats[i] == 1: + L[i] = 0 + elif i - 1 >= 0: + L[i] = L[i-1] + 1 + for i in range(n-1, -1 , -1): + if seats[i] == 1: + R[i] = 0 + elif i + 1 < n: + R[i] = R[i+1] + 1 + + return max( + min(L[i], R[i]) + for i in range(n) + ) + + def maxDistToClosest2(self, seats: List[int]) -> int: + """ + maintain a sorrted index array + """ + idxes = [] + for i, e in enumerate(seats): + if e == 1: + idxes.append(i) + + ret = [-float("inf"), 0] + n = len(seats) + # two ends + for i, j in zip((0, n-1), (0, -1)): + dist = abs(i - idxes[j]) + if dist > ret[0]: + ret = [dist, i] + + for j in range(len(idxes) - 1): + i = (idxes[j] + idxes[j+1]) // 2 + dist = min(abs(i - idxes[j]), abs(i - idxes[j+1])) + if dist > ret[0]: + ret = [dist, i] + + return ret[0] + + +if __name__ == "__main__": + assert Solution().maxDistToClosest([1,0,0,0,1,0,1]) == 2 diff --git a/853 Car Fleet.py b/853 Car Fleet.py new file mode 100644 index 0000000..6d874b3 --- /dev/null +++ b/853 Car Fleet.py @@ -0,0 +1,77 @@ +""" +There are n cars at given miles away from the starting mile 0, traveling to reach the mile target. + +You are given two integer array position and speed, both of length n, where position[i] is the starting mile of the ith car and speed[i] is the speed of the ith car in miles per hour. + +A car cannot pass another car, but it can catch up and then travel next to it at the speed of the slower car. + +A car fleet is a car or cars driving next to each other. The speed of the car fleet is the minimum speed of any car in the fleet. + +If a car catches up to a car fleet at the mile target, it will still be considered as part of the car fleet. + +Return the number of car fleets that will arrive at the destination. + + + +Example 1: + +Input: target = 12, position = [10,8,0,5,3], speed = [2,4,1,1,3] + +Output: 3 + +Explanation: + +The cars starting at 10 (speed 2) and 8 (speed 4) become a fleet, meeting each other at 12. The fleet forms at target. +The car starting at 0 (speed 1) does not catch up to any other car, so it is a fleet by itself. +The cars starting at 5 (speed 1) and 3 (speed 3) become a fleet, meeting each other at 6. The fleet moves at speed 1 until it reaches target. +Example 2: + +Input: target = 10, position = [3], speed = [3] + +Output: 1 + +Explanation: + +There is only one car, hence there is only one fleet. +Example 3: + +Input: target = 100, position = [0,2,4], speed = [4,2,1] + +Output: 1 + +Explanation: + +The cars starting at 0 (speed 4) and 2 (speed 2) become a fleet, meeting each other at 4. The car starting at 4 (speed 1) travels to 5. +Then, the fleet at 4 (speed 2) and the car at position 5 (speed 1) become one fleet, meeting each other at 6. The fleet moves at speed 1 until it reaches target. + + +Constraints: + +n == position.length == speed.length +1 <= n <= 10^5 +0 < target <= 10^6 +0 <= position[i] < target +All the values of position are unique. +0 < speed[i] <= 10^6 +""" +class Solution: + def carFleet(self, target: int, position: List[int], speed: List[int]) -> int: + """ + Epoch by epoch? + Physics simulation? + + Front car will dominate - either reach the destination itself or lead the car fleet + Know speed and distance - use time to check car behind will catch up + """ + fleets = 0 + objs = list(zip(position, speed)) + objs.sort(reverse=True) + + t = 0 # current fleet arrival time + for o, v in objs: # origin, velociy + cur = (target - o) / v + if cur > t: + fleets += 1 # new fleet + t = cur + + return fleets diff --git a/855 Exam Room.py b/855 Exam Room.py new file mode 100644 index 0000000..49ddc49 --- /dev/null +++ b/855 Exam Room.py @@ -0,0 +1,87 @@ +#!/usr/bin/python3 +""" +In an exam room, there are N seats in a single row, numbered 0, 1, 2, ..., N-1. + +When a student enters the room, they must sit in the seat that maximizes the +distance to the closest person. If there are multiple such seats, they sit in +the seat with the lowest number. (Also, if no one is in the room, then the +student sits at seat number 0.) + +Return a class ExamRoom(int N) that exposes two functions: ExamRoom.seat() +returning an int representing what seat the student sat in, and +ExamRoom.leave(int p) representing that the student in seat number p now leaves +the room. It is guaranteed that any calls to ExamRoom.leave(p) have a student +sitting in seat p. + +Example 1: + +Input: ["ExamRoom","seat","seat","seat","seat","leave","seat"], +[[10],[],[],[],[],[4],[]] +Output: [null,0,9,4,2,null,5] +Explanation: +ExamRoom(10) -> null +seat() -> 0, no one is in the room, then the student sits at seat number 0. +seat() -> 9, the student sits at the last seat number 9. +seat() -> 4, the student sits at the last seat number 4. +seat() -> 2, the student sits at the last seat number 2. +leave(4) -> null +seat() -> 5, the student sits at the last seat number 5. +​​​​​​​ +Note: + +1 <= N <= 10^9 +ExamRoom.seat() and ExamRoom.leave() will be called at most 10^4 times across +all test cases. +Calls to ExamRoom.leave(p) are guaranteed to have a student currently sitting in +seat number p. +""" +import bisect + + +class ExamRoom: + def __init__(self, N: int): + """ + Maintain a sorted array of index. BST + BST -> bisect sort + O(N) per query + """ + self.N = N + self.idxes = [] # sorted arry of taken idx + + def seat(self) -> int: + """ + similar to 849 + """ + if not self.idxes: + ret_idx = 0 + else: + max_dist, ret_idx = 0, 0 + # begin + dist = self.idxes[0] - 0 + if dist > max_dist: + max_dist = dist + ret_idx = 0 + # middle + for j in range(len(self.idxes)-1): + i = (self.idxes[j] + self.idxes[j+1]) // 2 + dist = min(abs(self.idxes[j] - i), abs(self.idxes[j+1] - i)) + if dist > max_dist: + max_dist = dist + ret_idx = i + # end + dist = self.N-1 - self.idxes[-1] + if dist > max_dist: + max_dist = dist + ret_idx = self.N-1 + + bisect.insort(self.idxes, ret_idx) + return ret_idx + + def leave(self, p: int) -> None: + self.idxes.remove(p) + + +# Your ExamRoom object will be instantiated and called as such: +# obj = ExamRoom(N) +# param_1 = obj.seat() +# obj.leave(p) diff --git a/856 Score of Parentheses.py b/856 Score of Parentheses.py new file mode 100644 index 0000000..764f01c --- /dev/null +++ b/856 Score of Parentheses.py @@ -0,0 +1,84 @@ +#!/usr/bin/python3 +""" +Given a balanced parentheses string S, compute the score of the string based on +the following rule: + +() has score 1 +AB has score A + B, where A and B are balanced parentheses strings. +(A) has score 2 * A, where A is a balanced parentheses string. + + +Example 1: + +Input: "()" +Output: 1 +Example 2: + +Input: "(())" +Output: 2 +Example 3: + +Input: "()()" +Output: 2 +Example 4: + +Input: "(()(()))" +Output: 6 + + +Note: + +S is a balanced parentheses string, containing only ( and ). +2 <= S.length <= 50 +""" + + +class Solution: + def scoreOfParentheses(self, S: str) -> int: + """ + stk + + Every position in the string has a depth - some number of matching + parentheses surrounding it + """ + stk = [] + ret = 0 + for s in S: + if s == "(": + stk.append(0) + else: + cur = stk.pop() + score = max(2 * cur, 1) + if stk: + stk[-1] += score + else: + ret += score + + return ret + + def scoreOfParentheses_error(self, S: str) -> int: + """ + stk + """ + ret = 0 + cur_stk = [] + for s in S: + if s == "(": + cur_stk.append(0) + stk.append(s) + else: + stk.pop() + if cur_stk[-1] == 0: + cur_stk[-1] = 1 + else: + cur_stk[-1] *= 2 + if not stk: + ret += cur + cur = 0 + + return ret + + +if __name__ == "__main__": + assert Solution().scoreOfParentheses("(())") == 2 + assert Solution().scoreOfParentheses("(()(()))") == 6 diff --git a/859 Buddy Strings.py b/859 Buddy Strings.py new file mode 100644 index 0000000..5cbddb0 --- /dev/null +++ b/859 Buddy Strings.py @@ -0,0 +1,70 @@ +#!/usr/bin/python3 +""" +Given two strings A and B of lowercase letters, return true if and only if we +can swap two letters in A so that the result equals B. + + + +Example 1: + +Input: A = "ab", B = "ba" +Output: true +Example 2: + +Input: A = "ab", B = "ab" +Output: false +Example 3: + +Input: A = "aa", B = "aa" +Output: true +Example 4: + +Input: A = "aaaaaaabc", B = "aaaaaaacb" +Output: true +Example 5: + +Input: A = "", B = "aa" +Output: false + + +Note: + +0 <= A.length <= 20000 +0 <= B.length <= 20000 +A and B consist only of lowercase letters. +""" +USED = True + + +class Solution: + def buddyStrings(self, A: str, B: str) -> bool: + """ + iterate + """ + if len(A) != len(B): + return False + if A == B: + # find dup + seen = set() + for a in A: + if a in seen: + return True + seen.add(a) + else: + return False + + # Find a pair + pair = None + for i in range(len(A)): + if A[i] != B[i]: + if not pair: + pair = (A[i], B[i]) + elif pair == (B[i], A[i]): + pair = USED + else: + return False + + if pair is None or pair is USED: + return True + + return False diff --git a/860 Lemonade Change.py b/860 Lemonade Change.py new file mode 100644 index 0000000..35d44c4 --- /dev/null +++ b/860 Lemonade Change.py @@ -0,0 +1,77 @@ +#!/usr/bin/python3 +""" +At a lemonade stand, each lemonade costs $5. + +Customers are standing in a queue to buy from you, and order one at a time + (in the order specified by bills). + +Each customer will only buy one lemonade and pay with either a $5, $10, or $20 +bill. You must provide the correct change to each customer, so that the net +transaction is that the customer pays $5. + +Note that you don't have any change in hand at first. + +Return true if and only if you can provide every customer with correct change. + + + +Example 1: + +Input: [5,5,5,10,20] +Output: true +Explanation: +From the first 3 customers, we collect three $5 bills in order. +From the fourth customer, we collect a $10 bill and give back a $5. +From the fifth customer, we give a $10 bill and a $5 bill. +Since all customers got correct change, we output true. +Example 2: + +Input: [5,5,10] +Output: true +Example 3: + +Input: [10,10] +Output: false +Example 4: + +Input: [5,5,10,10,20] +Output: false +Explanation: +From the first two customers in order, we collect two $5 bills. +For the next two customers in order, we collect a $10 bill and give back a $5 +bill. +For the last customer, we can't give change of $15 back because we only have two +$10 bills. +Since not every customer received correct change, the answer is false. + +Note: + +0 <= bills.length <= 10000 +bills[i] will be either 5, 10, or 20. +""" + + +class Solution: + def lemonadeChange(self, bills: List[int]) -> bool: + """ + count + """ + five, ten, twenty = 0, 0, 0 + for b in bills: + if b == 5: + five += 1 + elif b == 10: + if five < 1: + return False + five -= 1 + ten += 1 + else: # 20 + if ten >= 1 and five >= 1: + ten -= 1 # ten first + five -= 1 + elif five >= 3: + five -= 3 + else: + return False + + return True diff --git a/861 Score After Flipping Matrix.py b/861 Score After Flipping Matrix.py new file mode 100644 index 0000000..55a30c9 --- /dev/null +++ b/861 Score After Flipping Matrix.py @@ -0,0 +1,51 @@ +#!/usr/bin/python3 +""" +We have a two dimensional matrix A where each value is 0 or 1. + +A move consists of choosing any row or column, and toggling each value in that +row or column: changing all 0s to 1s, and all 1s to 0s. + +After making any number of moves, every row of this matrix is interpreted as a +binary number, and the score of the matrix is the sum of these numbers. + +Return the highest possible score. + +Example 1: + +Input: [[0,0,1,1],[1,0,1,0],[1,1,0,0]] +Output: 39 +Explanation: +Toggled to [[1,1,1,1],[1,0,0,1],[1,1,1,1]]. +0b1111 + 0b1001 + 0b1111 = 15 + 9 + 15 = 39 + +Note: + +1 <= A.length <= 20 +1 <= A[0].length <= 20 +A[i][j] is 0 or 1. +""" +from typing import List + + +class Solution: + def matrixScore(self, A: List[List[int]]) -> int: + """ + MSB > sum of remaining digit + => Toggle rows to set MSB to 1 + Then we cannot toggle row anymore + Toggle the col if #0's < #1's + """ + m, n = len(A), len(A[0]) + ret = 0 + ret += (1 << (n-1)) * m # all rows with MSB being 1 + for j in range(1, n): + cnt = 0 + for i in range(m): + if A[i][j] == A[i][0]: + cnt += 1 # number of 1's + + # toggle + cnt = max(cnt, m-cnt) + ret += (1 << (n-1-j)) * cnt + + return ret diff --git a/863 All Nodes Distance K in Binary Tree.py b/863 All Nodes Distance K in Binary Tree.py new file mode 100644 index 0000000..13bdcea --- /dev/null +++ b/863 All Nodes Distance K in Binary Tree.py @@ -0,0 +1,140 @@ +#!/usr/bin/python3 +""" +We are given a binary tree (with root node root), a target node, and an integer +value K. + +Return a list of the values of all nodes that have a distance K from the target +node. The answer can be returned in any order. + + + +Example 1: + +Input: root = [3,5,1,6,2,0,8,null,null,7,4], target = 5, K = 2 + +Output: [7,4,1] + +Explanation: +The nodes that are a distance 2 from the target node (with value 5) +have values 7, 4, and 1. + + + +Note that the inputs "root" and "target" are actually TreeNodes. +The descriptions of the inputs above are just serializations of these objects. + + +Note: + +The given tree is non-empty. +Each node in the tree has unique values 0 <= node.val <= 500. +The target node is a node in the tree. +0 <= K <= 1000. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def distanceK(self, root: TreeNode, target: TreeNode, K: int) -> List[int]: + """ + similar to SolutionComplicated + get its ancestor's distance, but at the same down go down through the tree + + O(N), vist each node 2 times + """ + ret = [] + self.ancestor_dist(root, K, target, ret) + return ret + + def dfs_down(self, node, d, ret): + """ + same as dfs1 + """ + if not node: + return + if d == 0: + ret.append(node.val) + else: + self.dfs_down(node.left, d - 1, ret) + self.dfs_down(node.right, d - 1, ret) + + def ancestor_dist(self, node, K, target, ret): + if not node: + return float('inf') + + if node.val == target.val: + # d = 0 + self.dfs_down(node, K, ret) + return 0 + else: + l = self.ancestor_dist(node.left, K, target, ret) + r = self.ancestor_dist(node.right, K, target, ret) + d = min(l, r) + 1 + if d == K: + ret.append(node.val) + elif l == float('inf'): + self.dfs_down(node.left, K - d - 1, ret) + else: # r == float('inf') + self.dfs_down(node.right, K - d - 1, ret) + return d + + +class SolutionComplicated: + def distanceK(self, root: TreeNode, target: TreeNode, K: int) -> List[int]: + """ + break the problem into two part + 1st problem: target's subtree - easy to solve + 2nd problem: mark parent, ancestor path length + """ + ret = [] + self.dfs1(target, K, ret) + hm = {} + self.ancestor_dist(root, target, hm) + self.dfs2(root, target, K, float("inf"), hm, ret) + return ret + + def dfs1(self, node, K, ret): + """1st problem""" + if not node: + return + + if K == 0: + ret.append(node.val) + else: + self.dfs1(node.left, K-1, ret) + self.dfs1(node.right, K-1, ret) + + def ancestor_dist(self, node, target, hm): + if not node: + return float('inf') + + if node.val == target.val: + hm[node.val] = 0 + else: + left = self.ancestor_dist(node.left, target, hm) + right = self.ancestor_dist(node.right, target, hm) + hm[node.val] = min(left, right) + 1 + + return hm[node.val] + + def dfs2(self, node, target, K, dist, hm, ret): + """2nd problem""" + if not node: + return + + if node.val == target.val: + return + + dist = min(dist, hm[node.val]) + if dist == K: + ret.append(node.val) + + self.dfs2(node.left, target, K, dist + 1, hm, ret) + self.dfs2(node.right, target, K, dist + 1, hm, ret) diff --git a/865 Smallest Subtree with all the Deepest Nodes.py b/865 Smallest Subtree with all the Deepest Nodes.py new file mode 100644 index 0000000..c60f411 --- /dev/null +++ b/865 Smallest Subtree with all the Deepest Nodes.py @@ -0,0 +1,78 @@ +#!/usr/bin/python3 +""" +Given a binary tree rooted at root, the depth of each node is the shortest distance to the root. + +A node is deepest if it has the largest depth possible among any node in the entire tree. + +The subtree of a node is that node, plus the set of all descendants of that node. + +Return the node with the largest depth such that it contains all the deepest nodes in its subtree. + + + +Example 1: + +Input: [3,5,1,6,2,0,8,null,null,7,4] +Output: [2,7,4] +Explanation: + + +We return the node with value 2, colored in yellow in the diagram. +The nodes colored in blue are the deepest nodes of the tree. +The input "[3, 5, 1, 6, 2, 0, 8, null, null, 7, 4]" is a serialization of the given tree. +The output "[2, 7, 4]" is a serialization of the subtree rooted at the node with value 2. +Both the input and output have TreeNode type. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.deepest = -1 + self.deepest_nodes = None + self.ret = None + + def subtreeWithAllDeepest(self, root: TreeNode) -> TreeNode: + """ + lowest common ancestor of deepest node + """ + self.down(root, 0) + if len(self.deepest_nodes) == 1: + return self.deepest_nodes.pop() + + self.count(root) + return self.ret + + def down(self, node: TreeNode, d: int) -> None: + if not node: + return + + if d > self.deepest: + self.deepest = d + self.deepest_nodes = set([node]) + elif d == self.deepest: + self.deepest_nodes.add(node) + + self.down(node.left, d + 1) + self.down(node.right, d + 1) + + def count(self, node: TreeNode) -> int: + if not node: + return 0 + + l = self.count(node.left) + r = self.count(node.right) + if l != 0 and r != 0 and l + r == len(self.deepest_nodes): + self.ret = node + + count = l + r + if node in self.deepest_nodes: + count += 1 + return count diff --git a/869 Reordered Power of 2.py b/869 Reordered Power of 2.py new file mode 100644 index 0000000..6b4500d --- /dev/null +++ b/869 Reordered Power of 2.py @@ -0,0 +1,48 @@ +#!/usr/bin/python3 +""" +Starting with a positive integer N, we reorder the digits in any order (including the original order) such that the leading digit is not zero. + +Return true if and only if we can do this in a way such that the resulting number is a power of 2. + + + +Example 1: + +Input: 1 +Output: true +Example 2: + +Input: 10 +Output: false +Example 3: + +Input: 16 +Output: true +Example 4: + +Input: 24 +Output: false +Example 5: + +Input: 46 +Output: true + + +Note: + +1 <= N <= 10^9 +""" +from collections import Counter + + +class Solution: + def reorderedPowerOf2(self, N: int) -> bool: + """ + count the digit and compare + """ + counts = Counter(str(N)) + for i in range(31): # 32 bit unsighed int + if counts == Counter(str(1 << i)): + return True + else: + return False diff --git a/870 Advantage Shuffle.py b/870 Advantage Shuffle.py new file mode 100644 index 0000000..2d73718 --- /dev/null +++ b/870 Advantage Shuffle.py @@ -0,0 +1,68 @@ +#!/usr/bin/python3 +""" +Given two arrays A and B of equal size, the advantage of A with respect to B is +the number of indices i for which A[i] > B[i]. + +Return any permutation of A that maximizes its advantage with respect to B. + +Example 1: + +Input: A = [2,7,11,15], B = [1,10,4,11] +Output: [2,11,7,15] +Example 2: + +Input: A = [12,24,8,32], B = [13,25,32,11] +Output: [24,32,8,12] + + +Note: + +1 <= A.length = B.length <= 10000 +0 <= A[i] <= 10^9 +0 <= B[i] <= 10^9 +""" +from typing import List +from collections import defaultdict + + +class Solution: + def advantageCount(self, A: List[int], B: List[int]) -> List[int]: + """ + Gready select the smallest larger number + Then we need sort A + Iterate B and do a bisect on A? Hard to remove the chosen element on A + unless using a balanced BST + How about we sort B also? + Like a merge sort, compare both sorted A and sorted B + But we need to record the position of B's element since sorting break the + position + Keep a reverse index mapping is not enough, since duplicate in B + then keep a list + """ + idxes = defaultdict(list) + for i, b in enumerate(B): + idxes[b].append(i) + + n = len(A) + A.sort() + B.sort() + ret = [None for _ in range(n)] + not_used = [] + j = 0 + for a in A: + if a > B[j]: + i = idxes[B[j]].pop() + ret[i] = a + j += 1 + else: + not_used.append(a) + + for i in range(n): + if ret[i] is None: + ret[i] = not_used.pop() + + return ret + + +if __name__ == "__main__": + assert Solution().advantageCount([2,7,11,15], [1,10,4,11]) == [2,11,7,15] diff --git a/872 Leaf-Similar Trees.py b/872 Leaf-Similar Trees.py new file mode 100644 index 0000000..ef4888a --- /dev/null +++ b/872 Leaf-Similar Trees.py @@ -0,0 +1,57 @@ +#!/usr/bin/python3 +""" +Consider all the leaves of a binary tree. From left to right order, the values +of those leaves form a leaf value sequence. + +For example, in the given tree above, the leaf value sequence is (6, 7, 4, 9, +8). + +Two binary trees are considered leaf-similar if their leaf value sequence is the +same. + +Return true if and only if the two given trees with head nodes root1 and root2 +are leaf-similar. + +Note: + +Both of the given trees will have between 1 and 100 nodes. +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def leafSimilar(self, root1: TreeNode, root2: TreeNode) -> bool: + """ + brute force, get all the leaf and then compare + to save space, use generator + O(lg n) space for the stack + """ + itr1 = self.dfs(root1) + itr2 = self.dfs(root2) + while True: + a = next(itr1, None) + b = next(itr2, None) + if a != b: + return False + if a is None and b is None: + break + return True + + def dfs(self, node): + stk = [node] + # pre-order + while stk: + cur = stk.pop() + if not cur: + continue + if not cur.left and not cur.right: + yield cur.val + else: + stk.append(cur.right) + stk.append(cur.left) diff --git a/873 Length of Longest Fibonacci Subsequence.py b/873 Length of Longest Fibonacci Subsequence.py new file mode 100644 index 0000000..ce860b7 --- /dev/null +++ b/873 Length of Longest Fibonacci Subsequence.py @@ -0,0 +1,108 @@ +#!/usr/bin/python3 +""" +A sequence X_1, X_2, ..., X_n is fibonacci-like if: + +n >= 3 +X_i + X_{i+1} = X_{i+2} for all i + 2 <= n +Given a strictly increasing array A of positive integers forming a sequence, +find the length of the longest fibonacci-like subsequence of A. If one does not +exist, return 0. + +(Recall that a subsequence is derived from another sequence A by deleting any +number of elements (including none) from A, without changing the order of the +remaining elements. For example, [3, 5, 8] is a subsequence of [3, 4, 5, 6, 7, 8].) + + + +Example 1: + +Input: [1,2,3,4,5,6,7,8] +Output: 5 +Explanation: +The longest subsequence that is fibonacci-like: [1,2,3,5,8]. +Example 2: + +Input: [1,3,7,11,12,14,18] +Output: 3 +Explanation: +The longest subsequence that is fibonacci-like: +[1,11,12], [3,11,14] or [7,11,18]. + + +Note: + +3 <= A.length <= 1000 +1 <= A[0] < A[1] < ... < A[A.length - 1] <= 10^9 +(The time limit has been reduced by 50% for submissions in Java, C, and C++.) +""" +from typing import List + + +class Solution: + def lenLongestFibSubseq(self, A: List[int]) -> int: + """ + F[i][j] longest fib subsequence ending at A[i] with 2nd last element + A[j] + + F[k][i] = F[i][j] + 1 if A[i] + A[j] = A[k] + + O(N^2) * O(N) = O(N^3) + + can be optimized to O(N^2) by look forward + """ + n = len(A) + F = [[0 for _ in range(n)] for _ in range(n)] + for i in range(n): + F[i][i] = 1 + for j in range(i): + F[i][j] = 2 + + idxes = {} + for i in range(n): + idxes[A[i]] = i + + for i in range(n): + for j in range(i): + Ak = A[i] + A[j] + if Ak in idxes: + k = idxes[Ak] + F[k][i] = max(F[k][i], F[i][j] + 1) + + return max( + F[i][j] if F[i][j] > 2 else 0 + for i in range(n) + for j in range(i) + ) + + def lenLongestFibSubseq_TLE(self, A: List[int]) -> int: + """ + F[i][j] longest fib subsequence ending at A[i] with 2nd last element + A[j] + + F[k][i] = F[i][j] + 1 if A[i] + A[j] = A[k] + + O(N^2) * O(N) = O(N^3) + + can be optimized to O(N^2) by look forward + """ + n = len(A) + F = [[0 for _ in range(n)] for _ in range(n)] + for i in range(n): + F[i][i] = 1 + for j in range(i): + F[i][j] = 2 + + for k in range(n): + for i in range(k): + for j in range(i): + if A[i] + A[j] == A[k]: + F[k][i] = max(F[k][i], F[i][j] + 1) + + return max( + F[i][j] if F[i][j] > 2 else 0 + for i in range(n) + for j in range(i) + ) + +if __name__ == "__main__": + assert Solution().lenLongestFibSubseq([1,2,3,4,5,6,7,8]) == 5 diff --git a/875 Koko Eating Bananas.py b/875 Koko Eating Bananas.py new file mode 100644 index 0000000..74a0eff --- /dev/null +++ b/875 Koko Eating Bananas.py @@ -0,0 +1,72 @@ +#!/usr/bin/python3 +""" +Koko loves to eat bananas. There are N piles of bananas, the i-th pile has +piles[i] bananas. The guards have gone and will come back in H hours. + +Koko can decide her bananas-per-hour eating speed of K. Each hour, she chooses +some pile of bananas, and eats K bananas from that pile. If the pile has less +than K bananas, she eats all of them instead, and won't eat any more bananas +during this hour. + +Koko likes to eat slowly, but still wants to finish eating all the bananas +before the guards come back. + +Return the minimum integer K such that she can eat all the bananas within H hours. + + + +Example 1: + +Input: piles = [3,6,7,11], H = 8 +Output: 4 +Example 2: + +Input: piles = [30,11,23,4,20], H = 5 +Output: 30 +Example 3: + +Input: piles = [30,11,23,4,20], H = 6 +Output: 23 + +Note: + +1 <= piles.length <= 10^4 +piles.length <= H <= 10^9 +1 <= piles[i] <= 10^9 +""" +from typing import List +import math + + +class Solution: + def minEatingSpeed(self, piles: List[int], H: int) -> int: + """ + validation: + each piles ceil(n/K) + + sum(ceil(piles[i]/K)) <= H + binary search + + O(log n * n) + """ + if len(piles) > H: + return None + + n = len(piles) + hi = max(piles) + 1 + lo = 1 + while lo < hi: + mid = (lo + hi) // 2 + if sum( + math.ceil(piles[i] / mid) + for i in range(n) + ) > H: + lo = mid + 1 + else: + hi = mid + + return lo + + +if __name__ == "__main__": + assert Solution().minEatingSpeed([3,6,7,11], 8) == 4 diff --git a/876 Middle of the Linked List.py b/876 Middle of the Linked List.py new file mode 100644 index 0000000..2077e3a --- /dev/null +++ b/876 Middle of the Linked List.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +Given a non-empty, singly linked list with head node head, return a middle node +of linked list. + +If there are two middle nodes, return the second middle node. + +Example 1: + +Input: [1,2,3,4,5] +Output: Node 3 from this list (Serialization: [3,4,5]) +The returned node has value 3. (The judge's serialization of this node is [3,4,5]). +Note that we returned a ListNode object ans, such that: +ans.val = 3, ans.next.val = 4, ans.next.next.val = 5, and ans.next.next.next = NULL. +Example 2: + +Input: [1,2,3,4,5,6] +Output: Node 4 from this list (Serialization: [4,5,6]) +Since the list has two middle nodes with values 3 and 4, we return the second one. + +Note: + +The number of nodes in the given list will be between 1 and 100. +""" + + +# Definition for singly-linked list. +class ListNode: + def __init__(self, x): + self.val = x + self.next = None + + +class Solution: + def middleNode(self, head: ListNode) -> ListNode: + """ + """ + l = 0 + cur = head + while cur: + l += 1 + cur = cur.next + + mid = l // 2 + 1 + cur_l = 0 + cur = head + while cur: + cur_l += 1 + if cur_l == mid: + return cur + cur = cur.next + + return None diff --git a/880 Decoded String at Index.py b/880 Decoded String at Index.py new file mode 100644 index 0000000..a03eda4 --- /dev/null +++ b/880 Decoded String at Index.py @@ -0,0 +1,103 @@ +#!/usr/bin/python3 +""" +An encoded string S is given. To find and write the decoded string to a tape, +the encoded string is read one character at a time and the following steps are +taken: + +If the character read is a letter, that letter is written onto the tape. +If the character read is a digit (say d), the entire current tape is repeatedly +written d-1 more times in total. +Now for some encoded string S, and an index K, find and return the K-th letter +(1 indexed) in the decoded string. + +Example 1: + +Input: S = "leet2code3", K = 10 +Output: "o" +Explanation: +The decoded string is "leetleetcodeleetleetcodeleetleetcode". +The 10th letter in the string is "o". +Example 2: + +Input: S = "ha22", K = 5 +Output: "h" +Explanation: +The decoded string is "hahahaha". The 5th letter is "h". +Example 3: + +Input: S = "a2345678999999999999999", K = 1 +Output: "a" +Explanation: +The decoded string is "a" repeated 8301530446056247680 times. The 1st letter is "a". + + +Note: + +2 <= S.length <= 100 +S will only contain lowercase letters and digits 2 through 9. +S starts with a letter. +1 <= K <= 10^9 +The decoded string is guaranteed to have less than 2^63 letters. +""" + + +class Solution: + def decodeAtIndex(self, S: str, K: int) -> str: + """ + walk backward + """ + l = 0 + for s in S: + if s.isdigit(): + l *= int(s) + else: + l += 1 + + # walk backward + for s in reversed(S): + K %= l + if K == 0 and s.isalpha(): + # K == l * n, return the last chr + return s + if s.isdigit(): + l //= int(s) + else: + l -= 1 + + raise + + def decodeAtIndex_error(self, S: str, K: int) -> str: + """ + don't generate the final string, too memory expensive + two pointer + + understanding error, one digit will make the entire str repeated + """ + K -= 1 # 0-indexed + i = 0 + j = 0 + last = None + n = len(S) + while j < n: + if S[j].isdigit(): + if not last: + last = j + + d = int(S[j]) + l = last - i + while K >= l and d > 0: + K -= l + d -= 1 + if d > 0: + return S[i + K] + elif last: + i = j + last = None + + j += 1 + + return S[i+K] + + +if __name__ == "__main__": + assert Solution().decodeAtIndex("ha22", 5) == "h" diff --git a/881 Boats to Save People.py b/881 Boats to Save People.py new file mode 100644 index 0000000..b8c025e --- /dev/null +++ b/881 Boats to Save People.py @@ -0,0 +1,49 @@ +#!/usr/bin/python3 +""" +The i-th person has weight people[i], and each boat can carry a maximum weight +of limit. + +Each boat carries at most 2 people at the same time, provided the sum of the +weight of those people is at most limit. + +Return the minimum number of boats to carry every given person. (It is +guaranteed each person can be carried by a boat.) + +Example 1: + +Input: people = [1,2], limit = 3 +Output: 1 +Explanation: 1 boat (1, 2) +Example 2: + +Input: people = [3,2,2,1], limit = 3 +Output: 3 +Explanation: 3 boats (1, 2), (2) and (3) +Example 3: + +Input: people = [3,5,3,4], limit = 5 +Output: 4 +Explanation: 4 boats (3), (3), (4), (5) +Note: + +1 <= people.length <= 50000 +1 <= people[i] <= limit <= 30000 +""" +from typing import List +from collections import deque + + +class Solution: + def numRescueBoats(self, people: List[int], limit: int) -> int: + """ + sort + gready + """ + ret = 0 + q = deque(sorted(people)) + while q: + tail = q.pop() + ret += 1 + if q and q[0] + tail <= limit: + q.popleft() + + return ret diff --git a/884 Uncommon Words from Two Sentences.py b/884 Uncommon Words from Two Sentences.py new file mode 100644 index 0000000..f79e524 --- /dev/null +++ b/884 Uncommon Words from Two Sentences.py @@ -0,0 +1,71 @@ +#!/usr/bin/python3 +""" +We are given two sentences A and B. (A sentence is a string of space separated +words. Each word consists only of lowercase letters.) + +A word is uncommon if it appears exactly once in one of the sentences, and does +not appear in the other sentence. + +Return a list of all uncommon words. + +You may return the list in any order. + + + +Example 1: + +Input: A = "this apple is sweet", B = "this apple is sour" +Output: ["sweet","sour"] +Example 2: + +Input: A = "apple apple", B = "banana" +Output: ["banana"] + + +Note: + +0 <= A.length <= 200 +0 <= B.length <= 200 +A and B both contain only spaces and lowercase letters. +""" +from typing import List +from collections import Counter + + +class Solution: + def uncommonFromSentences(self, A: str, B: str) -> List[str]: + """ + need counter, only need to appear once + """ + c = Counter(A.split()) + Counter(B.split()) + ret = [ + k + for k, v in c.items() + if v == 1 + ] + return ret + + def uncommonFromSentences_complext(self, A: str, B: str) -> List[str]: + """ + need counter + """ + c_A, c_B = Counter(A.split()), Counter(B.split()) + ret = [] + for k, v in c_A.items(): + if v == 1 and k not in c_B: + ret.append(k) + + for k, v in c_B.items(): + if v == 1 and k not in c_A: + ret.append(k) + + return ret + + def uncommonFromSentences_error(self, A: str, B: str) -> List[str]: + """ + set difference + """ + s_A, s_B = set(A.split()), set(B.split()) + return list( + (s_A - s_B) | (s_B - s_A) + ) diff --git a/886 Possible Bipartition.py b/886 Possible Bipartition.py new file mode 100644 index 0000000..70873bf --- /dev/null +++ b/886 Possible Bipartition.py @@ -0,0 +1,72 @@ +#!/usr/bin/python3 +""" +Given a set of N people (numbered 1, 2, ..., N), we would like to split +everyone into two groups of any size. + +Each person may dislike some other people, and they should not go into the same +group. + +Formally, if dislikes[i] = [a, b], it means it is not allowed to put the people +numbered a and b into the same group. + +Return true if and only if it is possible to split everyone into two groups in +this way. + +Example 1: + +Input: N = 4, dislikes = [[1,2],[1,3],[2,4]] +Output: true +Explanation: group1 [1,4], group2 [2,3] +Example 2: + +Input: N = 3, dislikes = [[1,2],[1,3],[2,3]] +Output: false +Example 3: + +Input: N = 5, dislikes = [[1,2],[2,3],[3,4],[4,5],[1,5]] +Output: false + +Note: + +1 <= N <= 2000 +0 <= dislikes.length <= 10000 +1 <= dislikes[i][j] <= N +dislikes[i][0] < dislikes[i][1] +There does not exist i != j for which dislikes[i] == dislikes[j]. +""" +from typing import List +from collections import defaultdict + + +class Solution: + def possibleBipartition(self, N: int, dislikes: List[List[int]]) -> bool: + """ + If given likes, then we can use union-find. But this is dislikes. + Two bipartition, A, B. For each dislike, do a dfs on A, B. + O(N * M) + + DFS + coloring do a dfs all on nodes O(N) + O(M) + """ + G = defaultdict(list) + for u, v in dislikes: + G[u].append(v) + G[v].append(u) + + visited = {} # 0 color red, 1 color blue + for u in range(1, N+1): + if u not in visited: + if not self.dfs(u, G, visited, 0): + return False + return True + + def dfs(self, u, G, visited, color): + visited[u] = color + for nbr in G[u]: + if nbr in visited: + if visited[nbr] == color: + return False + else: + if not self.dfs(nbr, G, visited, color ^ 1): + return False + + return True diff --git a/888 Fair Candy Swap.py b/888 Fair Candy Swap.py new file mode 100644 index 0000000..d17a687 --- /dev/null +++ b/888 Fair Candy Swap.py @@ -0,0 +1,82 @@ +#!/usr/bin/python3 +""" +Alice and Bob have candy bars of different sizes: A[i] is the size of the i-th +bar of candy that Alice has, and B[j] is the size of the j-th bar of candy that +Bob has. + +Since they are friends, they would like to exchange one candy bar each so that +after the exchange, they both have the same total amount of candy. (The total +amount of candy a person has is the sum of the sizes of candy bars they have.) + +Return an integer array ans where ans[0] is the size of the candy bar that Alice +must exchange, and ans[1] is the size of the candy bar that Bob must exchange. + +If there are multiple answers, you may return any one of them. It is guaranteed +an answer exists. + +Example 1: + +Input: A = [1,1], B = [2,2] +Output: [1,2] +Example 2: + +Input: A = [1,2], B = [2,3] +Output: [1,2] +Example 3: + +Input: A = [2], B = [1,3] +Output: [2,3] +Example 4: + +Input: A = [1,2,5], B = [2,4] +Output: [5,4] + +Note: + +1 <= A.length <= 10000 +1 <= B.length <= 10000 +1 <= A[i] <= 100000 +1 <= B[i] <= 100000 +It is guaranteed that Alice and Bob have different total amounts of candy. +It is guaranteed there exists an answer. +""" +from typing import List +import bisect + + +class Solution: + def fairCandySwap(self, A: List[int], B: List[int]) -> List[int]: + """ + It is a search problem. Use set as search. + """ + sum_A = sum(A) + sum_B = sum(B) + diff = (sum_B - sum_A) // 2 # it can be negative or positive + set_B = set(B) + for a in A: + if a + diff in set_B: + return [a, a + diff] + + raise + + def fairCandySwap_complex(self, A: List[int], B: List[int]) -> List[int]: + """ + sum, to figure out the target O(N) + exchange one + exchange is (sum - target) + constant + it is a search problem + """ + sum_A = sum(A) + sum_B = sum(B) + if sum_A > sum_B: + return self.fairCandySwap(B, A)[::-1] + + A.sort() + B.sort() + diff = (sum_B - sum_A) // 2 + for a in A: + i = bisect.bisect_left(B, a + diff) + if i < len(B) and B[i] == a + diff: + return [a, a + diff] + + raise diff --git a/889 Construct Binary Tree from Preorder and Postorder Traversal.py b/889 Construct Binary Tree from Preorder and Postorder Traversal.py new file mode 100644 index 0000000..5c15210 --- /dev/null +++ b/889 Construct Binary Tree from Preorder and Postorder Traversal.py @@ -0,0 +1,94 @@ +#!/usr/bin/python3 +""" +Return any binary tree that matches the given preorder and postorder traversals. + +Values in the traversals pre and post are distinct positive integers. + + + +Example 1: + +Input: pre = [1,2,4,5,3,6,7], post = [4,5,2,6,7,3,1] +Output: [1,2,3,4,5,6,7] + + +Note: + +1 <= pre.length == post.length <= 30 +pre[] and post[] are both permutations of 1, 2, ..., pre.length. +It is guaranteed an answer exists. If there exists multiple answers, you can +return any of them. +""" +from typing import List + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def constructFromPrePost(self, pre: List[int], post: List[int]) -> TreeNode: + """ + use stack + Preorder generate TreeNodes, push them to stack and postorder pop them out. + + Compare the stk[-1] with the currently scanning element in postorder, if + same, it means its subtree finish construction, pop it out. + + O(N) + """ + stk = [] + popped = None + j = 0 + for e in pre: + stk.append(TreeNode(e)) + while stk and stk[-1].val == post[j]: + popped = stk.pop() + j += 1 + if stk: + if not stk[-1].left: + stk[-1].left = popped + else: + stk[-1].right = popped + + assert j == len(post) + return popped # root is the last popped element + + def constructFromPrePost_complex(self, pre: List[int], post: List[int]) -> TreeNode: + """ + draw a full tree + pre order & post order + then see the pattern + + F(N) = 2 F(N/2) + O(N), then it is O(N logN) + """ + if not pre or not post: + return None + + root = TreeNode(pre[0]) + if len(pre) == 1: + return root + + if pre[1] == post[-2]: + # multiple answers + left = None + right = self.constructFromPrePost(pre[1:], post[:-1]) + else: + l = 0 + for a in post: + l += 1 + if a == pre[1]: + break + else: + raise + + left = self.constructFromPrePost(pre[1:1+l], post[:l]) + right = self.constructFromPrePost(pre[1+l:], post[l:-1]) + + root.left = left + root.right = right + return root diff --git a/890 Find and Replace Pattern.py b/890 Find and Replace Pattern.py new file mode 100644 index 0000000..de9a279 --- /dev/null +++ b/890 Find and Replace Pattern.py @@ -0,0 +1,60 @@ +#!/usr/bin/python3 +""" +You have a list of words and a pattern, and you want to know which words in +words matches the pattern. + +A word matches the pattern if there exists a permutation of letters p so that +after replacing every letter x in the pattern with p(x), we get the desired word. + +(Recall that a permutation of letters is a bijection from letters to letters: +every letter maps to another letter, and no two letters map to the same letter.) + +Return a list of the words in words that match the given pattern. + +You may return the answer in any order. + + + +Example 1: + +Input: words = ["abc","deq","mee","aqq","dkd","ccc"], pattern = "abb" +Output: ["mee","aqq"] +Explanation: "mee" matches the pattern because there is a permutation {a -> m, +b -> e, ...}. +"ccc" does not match the pattern because {a -> c, b -> c, ...} is not a +permutation, +since a and b map to the same letter. + +Note: + +1 <= words.length <= 50 +1 <= pattern.length = words[i].length <= 20 +""" +from typing import List + + +class Solution: + def findAndReplacePattern(self, words: List[str], pattern: str) -> List[str]: + """ + mapping + """ + ret = [] + for w in words: + if self.match(w, pattern): + ret.append(w) + return ret + + def match(self, word, pattern): + if len(word) != len(pattern): + return False + + m = {} + m_inv = {} # bijection + for i in range(len(word)): + if word[i] not in m and pattern[i] not in m_inv: + m[word[i]] = pattern[i] + m_inv[pattern[i]] = word[i] + elif word[i] not in m or m[word[i]] != pattern[i]: + return False + else: + return True diff --git a/894 All Possible Full Binary Trees.py b/894 All Possible Full Binary Trees.py new file mode 100644 index 0000000..7b85a8c --- /dev/null +++ b/894 All Possible Full Binary Trees.py @@ -0,0 +1,57 @@ +#!/usr/bin/python3 +""" +A full binary tree is a binary tree where each node has exactly 0 or 2 children. + +Return a list of all possible full binary trees with N nodes. Each element of +the answer is the root node of one possible tree. + +Each node of each tree in the answer must have node.val = 0. + +You may return the final list of trees in any order. + + + +Example 1: + +Input: 7 +Output: [[0,0,0,null,null,0,0,null,null,0,0],[0,0,0,null,null,0,0,0,0], +[0,0,0,0,0,0,0],[0,0,0,0,0,null,null,null,null,0,0],[0,0,0,0,0,null,null,0,0]] +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.cache = {} + + def allPossibleFBT(self, N: int) -> List[TreeNode]: + """ + recursive + memoization + """ + if N not in self.cache: + if N == 0: + ret = [] + elif N == 1: + ret = [TreeNode(0)] + else: + ret = [] + for i in range(N): + lefts = self.allPossibleFBT(i) + rights = self.allPossibleFBT(N-1-i) + # 0 or 2 child, cannot have only 1 + if lefts and rights: + for left in lefts: + for right in rights: + node = TreeNode(0) + node.left = left + node.right = right + ret.append(node) + self.cache[N] = ret + + return self.cache[N] diff --git a/896 Monotonic Array.py b/896 Monotonic Array.py new file mode 100644 index 0000000..2833bc5 --- /dev/null +++ b/896 Monotonic Array.py @@ -0,0 +1,58 @@ +#!/usr/bin/python3 +""" +An array is monotonic if it is either monotone increasing or monotone +decreasing. + +An array A is monotone increasing if for all i <= j, A[i] <= A[j]. An array A +is monotone decreasing if for all i <= j, A[i] >= A[j]. + +Return true if and only if the given array A is monotonic. + + + +Example 1: + +Input: [1,2,2,3] +Output: true +Example 2: + +Input: [6,5,4,4] +Output: true +Example 3: + +Input: [1,3,2] +Output: false +Example 4: + +Input: [1,2,4,5] +Output: true +Example 5: + +Input: [1,1,1] +Output: true + + +Note: + +1 <= A.length <= 50000 +-100000 <= A[i] <= 100000 +""" +from typing import List + + +class Solution: + def isMonotonic(self, A: List[int]) -> bool: + mono = 0 # 0 undecided, 1 decr, 2 incr + for i in range(1, len(A)): + if mono == 0: + if A[i] > A[i-1]: + mono = 2 + elif A[i] < A[i-1]: + mono = 1 + else: + if A[i] > A[i-1] and mono == 1: + return False + elif A[i] < A[i-1] and mono == 2: + return False + else: + return True diff --git a/897 Increasing Order Search Tree.py b/897 Increasing Order Search Tree.py new file mode 100644 index 0000000..aa58cad --- /dev/null +++ b/897 Increasing Order Search Tree.py @@ -0,0 +1,77 @@ +#!/usr/bin/python3 +""" +Given a tree, rearrange the tree in in-order so that the leftmost node in the +tree is now the root of the tree, and every node has no left child and only 1 +right child. + +Example 1: +Input: [5,3,6,2,4,null,8,1,null,null,null,7,9] + + 5 + / \ + 3 6 + / \ \ + 2 4 8 + / / \ +1 7 9 + +Output: [1,null,2,null,3,null,4,null,5,null,6,null,7,null,8,null,9] + + 1 + \ + 2 + \ + 3 + \ + 4 + \ + 5 + \ + 6 + \ + 7 + \ + 8 + \ + 9 +Note: + +The number of nodes in the given tree will be between 1 and 100. +Each node will have a unique integer value from 0 to 1000. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.prev = None + self.root = None + + def increasingBST(self, root: TreeNode) -> TreeNode: + """ + keep a previous index + in-order is easy + """ + self.dfs(root) + return self.root + + def dfs(self, node): + if not node: + return + + self.dfs(node.left) + if not self.prev: + self.root = node + else: + self.prev.right = node + node.left = None # need test case to test it + + self.prev = node + self.dfs(node.right) diff --git a/898 Bitwise ORs of Subarrays.py b/898 Bitwise ORs of Subarrays.py new file mode 100644 index 0000000..e686977 --- /dev/null +++ b/898 Bitwise ORs of Subarrays.py @@ -0,0 +1,60 @@ +#!/usr/bin/python3 +""" +We have an array A of non-negative integers. + +For every (contiguous) subarray B = [A[i], A[i+1], ..., A[j]] (with i <= j), we +take the bitwise OR of all the elements in B, obtaining a result A[i] | A[i+1] +| ... | A[j]. + +Return the number of possible results. (Results that occur more than once are +only counted once in the final answer.) + + + +Example 1: + +Input: [0] +Output: 1 +Explanation: +There is only one possible result: 0. +Example 2: + +Input: [1,1,2] +Output: 3 +Explanation: +The possible subarrays are [1], [1], [2], [1, 1], [1, 2], [1, 1, 2]. +These yield the results 1, 1, 2, 1, 3, 3. +There are 3 unique values, so the answer is 3. +Example 3: + +Input: [1,2,4] +Output: 6 +Explanation: +The possible results are 1, 2, 3, 4, 6, and 7. + + +Note: + +1 <= A.length <= 50000 +0 <= A[i] <= 10^9 +""" + +class Solution: + def subarrayBitwiseORs(self, A: List[int]) -> int: + """ + Use a dp array to record OR + F[i][j] + O(N^2) TLE + + F[i][j] records the list of the results + #F[i][j] >= #F[i+1][j] >= #F[i+2][j] since it is monotonously increasing + The increasing part is by having one more 1 in the bit of any 32 bit of int + then F[i][j] is at most O(32) + """ + ret = set() + cur = set() # F[0][i] + for a in A: + cur = {a | e for e in cur} | {a} + ret |= cur + + return len(ret) diff --git a/900 RLE Iterator.py b/900 RLE Iterator.py new file mode 100644 index 0000000..ef4d780 --- /dev/null +++ b/900 RLE Iterator.py @@ -0,0 +1,72 @@ +#!/usr/bin/python3 +""" +Write an iterator that iterates through a run-length encoded sequence. + +The iterator is initialized by RLEIterator(int[] A), where A is a run-length +encoding of some sequence. More specifically, for all even i, A[i] tells us the +number of times that the non-negative integer value A[i+1] is repeated in the +sequence. + +The iterator supports one function: next(int n), which exhausts the next n +elements (n >= 1) and returns the last element exhausted in this way. If there +is no element left to exhaust, next returns -1 instead. + +For example, we start with A = [3,8,0,9,2,5], which is a run-length encoding of +the sequence [8,8,8,5,5]. This is because the sequence can be read as "three +eights, zero nines, two fives". + +Example 1: + +Input: ["RLEIterator","next","next","next","next"], [[[3,8,0,9,2,5]],[2],[1], +[1],[2]] +Output: [null,8,8,5,-1] +Explanation: +RLEIterator is initialized with RLEIterator([3,8,0,9,2,5]). +This maps to the sequence [8,8,8,5,5]. +RLEIterator.next is then called 4 times: + +.next(2) exhausts 2 terms of the sequence, returning 8. The remaining sequence +is now [8, 5, 5]. + +.next(1) exhausts 1 term of the sequence, returning 8. The remaining sequence +is now [5, 5]. + +.next(1) exhausts 1 term of the sequence, returning 5. The remaining sequence +is now [5]. + +.next(2) exhausts 2 terms, returning -1. This is because the first term +exhausted was 5, +but the second term did not exist. Since the last term exhausted does not +exist, we return -1. + +Note: + +0 <= A.length <= 1000 +A.length is an even integer. +0 <= A[i] <= 10^9 +There are at most 1000 calls to RLEIterator.next(int n) per test case. +Each call to RLEIterator.next(int n) will have 1 <= n <= 10^9. +""" +from typing import List + + +class RLEIterator: + def __init__(self, A: List[int]): + """ + counter + """ + self.cur_i = 0 + self.cur_used = 0 + self.A = A + + def next(self, n: int) -> int: + run = self.cur_used + n + while self.cur_i < len(self.A) and run > self.A[self.cur_i]: + run -= self.A[self.cur_i] + self.cur_i += 2 + + if self.cur_i >= len(self.A): + return -1 + + self.cur_used = run + return self.A[self.cur_i + 1] diff --git a/901 Online Stock Span.py b/901 Online Stock Span.py new file mode 100644 index 0000000..6eae8d8 --- /dev/null +++ b/901 Online Stock Span.py @@ -0,0 +1,64 @@ +#!/usr/bin/python3 +""" +Write a class StockSpanner which collects daily price quotes for some stock, and +returns the span of that stock's price for the current day. + +The span of the stock's price today is defined as the maximum number of +consecutive days (starting from today and going backwards) for which the price +of the stock was less than or equal to today's price. + +For example, if the price of a stock over the next 7 days were [100, 80, 60, 70, +60, 75, 85], then the stock spans would be [1, 1, 1, 2, 1, 4, 6]. + +Example 1: + +Input: ["StockSpanner","next","next","next","next","next","next","next"], [[], +[100],[80],[60],[70],[60],[75],[85]] +Output: [null,1,1,1,2,1,4,6] +Explanation: +First, S = StockSpanner() is initialized. Then: +S.next(100) is called and returns 1, +S.next(80) is called and returns 1, +S.next(60) is called and returns 1, +S.next(70) is called and returns 2, +S.next(60) is called and returns 1, +S.next(75) is called and returns 4, +S.next(85) is called and returns 6. + +Note that (for example) S.next(75) returned 4, because the last 4 prices +(including today's price of 75) were less than or equal to today's price. + +Note: + +Calls to StockSpanner.next(int price) will have 1 <= price <= 10^5. +There will be at most 10000 calls to StockSpanner.next per test case. +There will be at most 150000 calls to StockSpanner.next across all test cases. +The total time limit for this problem has been reduced by 75% for C++, and 50% +for all other languages. +""" + + +class StockSpanner: + def __init__(self): + """ + Consecutive Backward <= + insort? O(n) or O(log n) using BST. Probably not for consecutive days + + Only interested in consecutive backwards <=, then only keep the + previously >. A stack to maintain a list ">" (decreasing) elements + """ + self.stk = [] # [(price, span)] + + def next(self, price: int) -> int: + cur_span = 1 + while self.stk and self.stk[-1][0] <= price: + _, span = self.stk.pop() + cur_span += span + self.stk.append((price, cur_span)) + return cur_span + + + +# Your StockSpanner object will be instantiated and called as such: +# obj = StockSpanner() +# param_1 = obj.next(price) diff --git a/905 Sort Array By Parity.py b/905 Sort Array By Parity.py new file mode 100644 index 0000000..40f754b --- /dev/null +++ b/905 Sort Array By Parity.py @@ -0,0 +1,36 @@ +#!/usr/bin/python3 +""" +Given an array A of non-negative integers, return an array consisting of all the +even elements of A, followed by all the odd elements of A. + +You may return any answer array that satisfies this condition. + + + +Example 1: + +Input: [3,1,2,4] +Output: [2,4,3,1] +The outputs [4,2,3,1], [2,4,1,3], and [4,2,1,3] would also be accepted. + + +Note: + +1 <= A.length <= 5000 +0 <= A[i] <= 5000 +""" +from typing import List + + +class Solution: + def sortArrayByParity(self, A: List[int]) -> List[int]: + """ + pointer + """ + closed = -1 + for i in range(len(A)): + if A[i] % 2 == 0: + closed += 1 + A[closed], A[i] = A[i], A[closed] + + return A diff --git a/907 Sum of Subarray Minimums.py b/907 Sum of Subarray Minimums.py new file mode 100644 index 0000000..7d6db3f --- /dev/null +++ b/907 Sum of Subarray Minimums.py @@ -0,0 +1,104 @@ +#!/usr/bin/python3 +""" +Given an array of integers A, find the sum of min(B), where B ranges over every +(contiguous) subarray of A. + +Since the answer may be large, return the answer modulo 10^9 + 7. + + + +Example 1: + +Input: [3,1,2,4] +Output: 17 +Explanation: Subarrays are [3], [1], [2], [4], [3,1], [1,2], [2,4], [3,1,2], +[1,2,4], [3,1,2,4]. +Minimums are 3, 1, 2, 4, 1, 1, 2, 1, 1, 1. Sum is 17. + + +Note: + +1 <= A.length <= 30000 +1 <= A[i] <= 30000 +""" +from typing import List + +MOD = 10 ** 9 + 7 + + +class Solution: + def sumSubarrayMins(self, A: List[int]) -> int: + """ + Let F[i][j] be the min of A[i:j] + O(N^2) + + There are a number of subarray with min as A[i] + A[m].... A[i] ... A[n] + A[m] < A[i] + A[n] < A[i] + then min(A[m+1:n]) is A[i] + + a a A[i] a + 3 choices on the left, 2 choices on the right + totally 3 * 2 = 6 subarrays + + use an increasing stk from both left and right + L[i] records the index of m, default -1 + R[i] records the index of n, default len(A) + """ + n = len(A) + L = [-1 for _ in A] + R = [n for _ in A] + + stk = [] + for i in range(n): + while stk and A[stk[-1]] >= A[i]: + stk.pop() + + if stk: + L[i] = stk[-1] + stk.append(i) + + stk = [] + for i in range(n-1, -1, -1): + # avoid double count when equal, attribtue to leftmost duplicate + while stk and A[stk[-1]] > A[i]: + stk.pop() + + if stk: + R[i] = stk[-1] + stk.append(i) + + ret = 0 + for i in range(n): + ret += ( + A[i] * (i - L[i]) * (R[i] - i) + ) + ret %= MOD + + return ret + + +class Solution: + def sumSubarrayMins(self, A: List[int]) -> int: + """ + Improve the above solution using one stack + use an increasing stk + """ + stk = [] + A = [-float('inf')] + A + [-float('inf')] + ret = 0 + for i, a in enumerate(A): + while stk and A[stk[-1]] > a: + h = stk.pop() + # record for h + ret += A[h] * (h - stk[-1]) * (i - h) + ret %= MOD + + stk.append(i) + return ret + + +if __name__ == "__main__": + assert Solution().sumSubarrayMins([71,55,82,55]) == 593 + assert Solution().sumSubarrayMins([3,1,2,4]) == 17 diff --git a/908 Smallest Range I.py b/908 Smallest Range I.py new file mode 100644 index 0000000..b5446b4 --- /dev/null +++ b/908 Smallest Range I.py @@ -0,0 +1,41 @@ +#!/usr/bin/python3 +""" +Given an array A of integers, for each integer A[i] we may choose any x with +-K <= x <= K, and add x to A[i]. + +After this process, we have some array B. + +Return the smallest possible difference between the maximum value of B and the +minimum value of B. + +Example 1: + +Input: A = [1], K = 0 +Output: 0 +Explanation: B = [1] +Example 2: + +Input: A = [0,10], K = 2 +Output: 6 +Explanation: B = [2,8] +Example 3: + +Input: A = [1,3,6], K = 3 +Output: 0 +Explanation: B = [3,3,3] or B = [4,4,4] + + +Note: +1 <= A.length <= 10000 +0 <= A[i] <= 10000 +0 <= K <= 10000 +""" +from typing import List + + +class Solution: + def smallestRangeI(self, A: List[int], K: int) -> int: + """ + only need the max and min + """ + return max(0, max(A) - K - (min(A) + K)) diff --git a/910 Smallest Range II.py b/910 Smallest Range II.py new file mode 100644 index 0000000..634993a --- /dev/null +++ b/910 Smallest Range II.py @@ -0,0 +1,73 @@ +#!/usr/bin/python3 +""" +Given an array A of integers, for each integer A[i] we need to choose either +x = -K or x = K, and add x to A[i] (only once). + +After this process, we have some array B. + +Return the smallest possible difference between the maximum value of B and the +minimum value of B. + +Example 1: + +Input: A = [1], K = 0 +Output: 0 +Explanation: B = [1] +Example 2: + +Input: A = [0,10], K = 2 +Output: 6 +Explanation: B = [2,8] +Example 3: + +Input: A = [1,3,6], K = 3 +Output: 3 +Explanation: B = [4,6,3] + +Note: +1 <= A.length <= 10000 +0 <= A[i] <= 10000 +0 <= K <= 10000 +""" +from typing import List + + +class Solution: + def smallestRangeII(self, A: List[int], K: int) -> int: + """ + Say A[i] is the largest i that goes up. A[i+1] would be the smallest + goes down + Then A[0] + K, A[i] + K, A[i+1] - K, A[A.length - 1] - K + """ + A.sort() + mn = min(A) + mx = max(A) + ret = mx - mn + for i in range(len(A) - 1): + cur_mx = max(mx - K, A[i] + K) + cur_mn = min(mn + K, A[i+1] - K) + ret = min(ret, cur_mx - cur_mn) + + return ret + + def smallestRangeII_error(self, A: List[int], K: int) -> int: + """ + find the min max is not enough, since the min max after +/- K may change + """ + mini = min(A) + maxa = max(A) + # mini + K, maxa - K + B = [] + max_upper_diff = 0 + max_lower_diff = 0 + upper = max(mini + K, maxa - K) # may cross + lower = min(mini + K, maxa - K) + for a in A: + diffs = [(a + K) - upper, lower - (a - K)] + cur_diff = min(diffs) + if cur_diff == diffs[0] and cur_diff >= max_upper_diff: + max_upper_diff = cur_diff + elif cur_diff == diffs[1] and cur_diff >= max_lower_diff: + max_lower_diff = cur_diff + + return upper + max_upper_diff - (lower + max_lower_diff) diff --git a/911 Online Election.py b/911 Online Election.py new file mode 100644 index 0000000..ba8202d --- /dev/null +++ b/911 Online Election.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +In an election, the i-th vote was cast for persons[i] at time times[i]. + +Now, we would like to implement the following query function: +TopVotedCandidate.q(int t) will return the number of the person that was leading +the election at time t. + +Votes cast at time t will count towards our query. In the case of a tie, the +most recent vote (among tied candidates) wins. + +Example 1: + +Input: ["TopVotedCandidate","q","q","q","q","q","q"], [[[0,1,1,0,0,1,0], +[0,5,10,15,20,25,30]],[3],[12],[25],[15],[24],[8]] +Output: [null,0,1,1,0,0,1] +Explanation: +At time 3, the votes are [0], and 0 is leading. +At time 12, the votes are [0,1,1], and 1 is leading. +At time 25, the votes are [0,1,1,0,0,1], and 1 is leading (as ties go to the +most recent vote.) +This continues for 3 more queries at time 15, 24, and 8. + +Note: + +1 <= persons.length = times.length <= 5000 +0 <= persons[i] <= persons.length +times is a strictly increasing array with all elements in [0, 10^9]. +TopVotedCandidate.q is called at most 10000 times per test case. +TopVotedCandidate.q(int t) is always called with t >= times[0]. +""" +from typing import List +from collections import defaultdict +import bisect + + +class TopVotedCandidate: + def __init__(self, persons: List[int], times: List[int]): + """ + Running top vote + Need to maintain list + + but time is too large to enumerate. Cannot have direct access, then + query is binary search + """ + self.maxes = [] # [(t, i)] at time t + counter = defaultdict(int) + tp = sorted(zip(times, persons)) + for t, p in tp: + counter[p] += 1 + if not self.maxes or counter[self.maxes[-1][1]] <= counter[p]: + self.maxes.append((t, p)) + + def q(self, t: int) -> int: + i = bisect.bisect(self.maxes, (t, 0)) + # equal + if i < len(self.maxes) and self.maxes[i][0] == t: + return self.maxes[i][1] + + # smaller + i -= 1 + return self.maxes[i][1] + + +# Your TopVotedCandidate object will be instantiated and called as such: +# obj = TopVotedCandidate(persons, times) +# param_1 = obj.q(t) diff --git a/914 X of a Kind in a Deck of Cards.py b/914 X of a Kind in a Deck of Cards.py new file mode 100644 index 0000000..8bc578e --- /dev/null +++ b/914 X of a Kind in a Deck of Cards.py @@ -0,0 +1,70 @@ +#!/usr/bin/python3 +""" +In a deck of cards, each card has an integer written on it. + +Return true if and only if you can choose X >= 2 such that it is possible to split the entire deck into 1 or more groups of cards, where: + +Each group has exactly X cards. +All the cards in each group have the same integer. + + +Example 1: + +Input: [1,2,3,4,4,3,2,1] +Output: true +Explanation: Possible partition [1,1],[2,2],[3,3],[4,4] +Example 2: + +Input: [1,1,1,2,2,2,3,3] +Output: false +Explanation: No possible partition. +Example 3: + +Input: [1] +Output: false +Explanation: No possible partition. +Example 4: + +Input: [1,1] +Output: true +Explanation: Possible partition [1,1] +Example 5: + +Input: [1,1,2,2,2,2] +Output: true +Explanation: Possible partition [1,1],[2,2],[2,2] + +Note: + +1 <= deck.length <= 10000 +0 <= deck[i] < 10000 +""" +from typing import List +from collections import Counter + + +class Solution: + def hasGroupsSizeX(self, deck: List[int]) -> bool: + """ + gcd of all > 2 + """ + counter = Counter(deck) + gcd = None + for v in counter.values(): + if gcd is None: + gcd = v + gcd = self.gcd(gcd, v) + if gcd == 1: + return False + + return True + + def gcd(self, a, b): + """ + a = k * b + r + gcd(a, b) = gcd(b, r) + """ + while b: + a, b = b, a % b + + return a diff --git a/915 Partition Array into Disjoint Intervals.py b/915 Partition Array into Disjoint Intervals.py new file mode 100644 index 0000000..4ffd3d8 --- /dev/null +++ b/915 Partition Array into Disjoint Intervals.py @@ -0,0 +1,71 @@ +#!/usr/bin/python3 +""" +Given an array A, partition it into two (contiguous) subarrays left and right so that: + +Every element in left is less than or equal to every element in right. +left and right are non-empty. +left has the smallest possible size. +Return the length of left after such a partitioning. It is guaranteed that such a partitioning exists. + + + +Example 1: + +Input: [5,0,3,8,6] +Output: 3 +Explanation: left = [5,0,3], right = [8,6] +Example 2: + +Input: [1,1,1,0,6,12] +Output: 4 +Explanation: left = [1,1,1,0], right = [6,12] + + +Note: + +2 <= A.length <= 30000 +0 <= A[i] <= 10^6 +It is guaranteed there is at least one way to partition A as described. +""" +from typing import List + + +class Solution: + def partitionDisjoint(self, A: List[int]) -> int: + """ + max(left) <= min(right) + + similar to 2 in terms of keyboard stroke count + """ + n = len(A) + MX = [-float('inf') for _ in range(n+1)] + MI = [float('inf') for _ in range(n+1)] + for i in range(n): + MX[i+1] = max(M[i], A[i]) + for i in range(n-1, -1, -1): + MI[i] = min(MI[i+1], A[i]) + + for l in range(1, n+1): + if MX[l] <= MI[l]: + return l + raise + + def partitionDisjoint_2(self, A: List[int]) -> int: + """ + max(left) <= min(right) + """ + MX = [0 for _ in A] + MI = [0 for _ in A] + MX[0] = A[0] + MI[-1] = A[-1] + n = len(A) + for i in range(1, n): + MX[i] = max(MX[i-1], A[i]) + for i in range(n-2, -1, -1): + MI[i] = min(MI[i+1], A[i]) + + for i in range(n-1): + if MX[i] <= MI[i+1]: + return i + + raise diff --git a/916 Word Subsets.py b/916 Word Subsets.py new file mode 100644 index 0000000..94c1b8b --- /dev/null +++ b/916 Word Subsets.py @@ -0,0 +1,75 @@ +#!/usr/bin/python3 +""" +We are given two arrays A and B of words. Each word is a string of lowercase +letters. + +Now, say that word b is a subset of word a if every letter in b occurs in a, +including multiplicity. For example, "wrr" is a subset of "warrior", but is +not a subset of "world". + +Now say a word a from A is universal if for every b in B, b is a subset of a. + +Return a list of all universal words in A. You can return the words in any order. + + + +Example 1: + +Input: A = ["amazon","apple","facebook","google","leetcode"], B = ["e","o"] +Output: ["facebook","google","leetcode"] +Example 2: + +Input: A = ["amazon","apple","facebook","google","leetcode"], B = ["l","e"] +Output: ["apple","google","leetcode"] +Example 3: + +Input: A = ["amazon","apple","facebook","google","leetcode"], B = ["e","oo"] +Output: ["facebook","google"] +Example 4: + +Input: A = ["amazon","apple","facebook","google","leetcode"], B = ["lo","eo"] +Output: ["google","leetcode"] +Example 5: + +Input: A = ["amazon","apple","facebook","google","leetcode"], B = ["ec","oc","ceo"] +Output: ["facebook","leetcode"] + + +Note: + +1 <= A.length, B.length <= 10000 +1 <= A[i].length, B[i].length <= 10 +A[i] and B[i] consist only of lowercase letters. +All words in A[i] are unique: there isn't i != j with A[i] == A[j]. +""" +from typing import List +from collections import Counter, defaultdict + + +class Solution: + def wordSubsets(self, A: List[str], B: List[str]) -> List[str]: + """ + brute foce check b subset of a: two pointers O(|a| + |b|) + O(n * m * (|a|+|b|)) + + The order of chars does not matter. + + For every letter + C_letter (a) >= max(C_letter(b) for b in B) + """ + mx = defaultdict(int) + for b in B: + c = Counter(b) + for k, v in c.items(): + mx[k] = max(mx[k], v) + + ret = [] + for a in A: + c = Counter(a) + for k, v in mx.items(): + if c[k] < v: + break + else: + ret.append(a) + + return ret diff --git a/917 Reverse Only Letters.py b/917 Reverse Only Letters.py new file mode 100644 index 0000000..210fc41 --- /dev/null +++ b/917 Reverse Only Letters.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +Given a string S, return the "reversed" string where all characters that are not +a letter stay in the same place, and all letters reverse their positions. + +Example 1: + +Input: "ab-cd" +Output: "dc-ba" + +Example 2: +Input: "a-bC-dEf-ghIj" +Output: "j-Ih-gfE-dCba" + +Example 3: +Input: "Test1ng-Leet=code-Q!" +Output: "Qedo1ct-eeLg=ntse-T!" + + +Note: +S.length <= 100 +33 <= S[i].ASCIIcode <= 122 +S doesn't contain \ or " +""" + + +class Solution: + def reverseOnlyLetters(self, S: str) -> str: + lst = list(S) + i = 0 + n = len(lst) + j = n - 1 + while True: + while i < n and not lst[i].isalpha(): + i += 1 + while j >= 0 and not lst[j].isalpha(): + j -= 1 + + if i < j and i < n and j >= 0: + lst[i], lst[j] = lst[j], lst[i] + i += 1 + j -= 1 + else: + break + + return "".join(lst) + + +if __name__ == "__main__": + assert Solution().reverseOnlyLetters("Test1ng-Leet=code-Q!") == "Qedo1ct-eeLg=ntse-T!" diff --git a/918 Maximum Sum Circular Subarray.py b/918 Maximum Sum Circular Subarray.py new file mode 100644 index 0000000..aa16e1e --- /dev/null +++ b/918 Maximum Sum Circular Subarray.py @@ -0,0 +1,97 @@ +#!/usr/bin/python3 +""" +Given a circular array C of integers represented by A, find the maximum possible +sum of a non-empty subarray of C. + +Here, a circular array means the end of the array connects to the beginning of +the array. (Formally, C[i] = A[i] when 0 <= i < A.length, and C[i+A.length] = +C[i] when i >= 0.) + +Also, a subarray may only include each element of the fixed buffer A at most +once. (Formally, for a subarray C[i], C[i+1], ..., C[j], there does not exist +i <= k1, k2 <= j with k1 % A.length = k2 % A.length.) + + + +Example 1: + +Input: [1,-2,3,-2] +Output: 3 +Explanation: Subarray [3] has maximum sum 3 +Example 2: + +Input: [5,-3,5] +Output: 10 +Explanation: Subarray [5,5] has maximum sum 5 + 5 = 10 +Example 3: + +Input: [3,-1,2,-1] +Output: 4 +Explanation: Subarray [2,-1,3] has maximum sum 2 + (-1) + 3 = 4 +Example 4: + +Input: [3,-2,2,-3] +Output: 3 +Explanation: Subarray [3] and [3,-2,2] both have maximum sum 3 +Example 5: + +Input: [-2,-3,-1] +Output: -1 +Explanation: Subarray [-1] has maximum sum -1 + + +Note: + +-30000 <= A[i] <= 30000 +1 <= A.length <= 30000 +""" +from typing import List + + +class Solution: + def maxSubarraySumCircular(self, A: List[int]) -> int: + """ + Kadane's Algorithm + Two cases: + 1. normal max subarray within A + 2. circular one, that both A[0] and A[n-1] is included + (A0 + A1 + .. + Ai) + (Aj + ... + An-1) + = sum(A) - (Ai+1 + ... + Aj-1) + """ + ret1 = self.max_subarray(A) + ret2 = sum(A) + self.max_subarray([-a for a in A[1:-1]]) # max negative (-1) + return max(ret1, ret2) + + def max_subarray(self, A) -> int: + """ + dp[i] = A[i] + max(dp[i-1],0) + """ + mx = -float('inf') + cur = 0 + for a in A: + cur = a + max(cur, 0) # RHS cur is the prev + mx = max(mx, cur) + return mx + + def maxSubarraySumCircular_error(self, A: List[int]) -> int: + """ + keep a cur_sum with index, when negative, go back to 0 + """ + cur = [0, None] + mx = -float('inf') + i = 0 + j = 0 + n = len(A) + while i < n: + cur[0] += A[i] + cur[1] = i + mx = max(mx, cur[0]) + j = i + 1 + while cur[0] >= 0 and j < i + n: + cur[0] += A[j % n] + mx = max(mx, cur[0]) + j += 1 + + i = j + + return mx diff --git a/919 Complete Binary Tree Inserter.py b/919 Complete Binary Tree Inserter.py new file mode 100644 index 0000000..2c4ec26 --- /dev/null +++ b/919 Complete Binary Tree Inserter.py @@ -0,0 +1,90 @@ +#!/usr/bin/python3 +""" +A complete binary tree is a binary tree in which every level, except possibly +the last, is completely filled, and all nodes are as far left as possible. + +Write a data structure CBTInserter that is initialized with a complete binary +tree and supports the following operations: + +CBTInserter(TreeNode root) initializes the data structure on a given tree with +head node root; +CBTInserter.insert(int v) will insert a TreeNode into the tree with value +node.val = v so that the tree remains complete, and returns the value of the +parent of the inserted TreeNode; +CBTInserter.get_root() will return the head node of the tree. + +Example 1: + +Input: inputs = ["CBTInserter","insert","get_root"], inputs = [[[1]],[2],[]] +Output: [null,1,[1,2]] +Example 2: + +Input: inputs = ["CBTInserter","insert","insert","get_root"], inputs = +[[[1,2,3,4,5,6]],[7],[8],[]] +Output: [null,3,4,[1,2,3,4,5,6,7,8]] + +Note: +The initial given tree is complete and contains between 1 and 1000 nodes. +CBTInserter.insert is called at most 10000 times per test case. +Every value of a given or inserted node is between 0 and 5000. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +from collections import deque + + +class CBTInserter: + def __init__(self, root: TreeNode): + """ + Maintain a dequeue of insertion candidates + Insertion candidates are non-full nodes (superset of leaf nodes) + BFS to get the insertion candidates + + During insertion, insert the node to the first insertion candidate's + child. Then, the inserting node is the last in the candidate queue + """ + self.candidates = deque() + self.root = root + q = [root] # can also use deque + while q: + cur_q = [] + for e in q: + if e.left: + cur_q.append(e.left) + if e.right: + cur_q.append(e.right) + if not e.left or not e.right: + # non-full node + self.candidates.append(e) + q = cur_q + + def insert(self, v: int) -> int: + pi = self.candidates[0] + node = TreeNode(v) + if not pi.left: + pi.left = node + else: + pi.right = node + + if pi.left and pi.right: + self.candidates.popleft() + + self.candidates.append(node) + return pi.val + + def get_root(self) -> TreeNode: + return self.root + + +# Your CBTInserter object will be instantiated and called as such: +# obj = CBTInserter(root) +# param_1 = obj.insert(v) +# param_2 = obj.get_root() diff --git a/921 Minimum Add to Make Parentheses Valid.py b/921 Minimum Add to Make Parentheses Valid.py new file mode 100644 index 0000000..6ac0c02 --- /dev/null +++ b/921 Minimum Add to Make Parentheses Valid.py @@ -0,0 +1,58 @@ +#!/usr/bin/python3 +""" +Given a string S of '(' and ')' parentheses, we add the minimum number of +parentheses ( '(' or ')', and in any positions ) so that the resulting +parentheses string is valid. + +Formally, a parentheses string is valid if and only if: + +It is the empty string, or +It can be written as AB (A concatenated with B), where A and B are valid +strings, or +It can be written as (A), where A is a valid string. +Given a parentheses string, return the minimum number of parentheses we must add +to make the resulting string valid. + +Example 1: + +Input: "())" +Output: 1 +Example 2: + +Input: "(((" +Output: 3 +Example 3: + +Input: "()" +Output: 0 +Example 4: + +Input: "()))((" +Output: 4 + + +Note: + +S.length <= 1000 +S only consists of '(' and ')' characters. +""" + + +class Solution: + def minAddToMakeValid(self, S: str) -> int: + """ + stk + """ + ret = 0 + stk = [] + for s in S: + if s == "(": + stk.append(s) + else: + if stk: + stk.pop() + else: + ret += 1 + + ret += len(stk) + return ret diff --git a/922 Sort Array By Parity II.py b/922 Sort Array By Parity II.py new file mode 100644 index 0000000..866993f --- /dev/null +++ b/922 Sort Array By Parity II.py @@ -0,0 +1,62 @@ +#!/usr/bin/python3 +""" +Given an array A of non-negative integers, half of the integers in A are odd, +and half of the integers are even. + +Sort the array so that whenever A[i] is odd, i is odd; and whenever A[i] is even +, i is even. + +You may return any answer array that satisfies this condition. + + + +Example 1: + +Input: [4,2,5,7] +Output: [4,5,2,7] +Explanation: [4,7,2,5], [2,5,4,7], [2,7,4,5] would also have been accepted. + + +Note: + +2 <= A.length <= 20000 +A.length % 2 == 0 +0 <= A[i] <= 1000 +""" +from typing import List + + +class Solution: + def sortArrayByParityII(self, A: List[int]) -> List[int]: + even_idx = 0 + for odd_idx in range(1, len(A), 2): + if A[odd_idx] % 2 == 0: + while A[even_idx] % 2 == 0: + even_idx += 2 + A[odd_idx], A[even_idx] = A[even_idx], A[odd_idx] + + return A + + def sortArrayByParityII_complex(self, A: List[int]) -> List[int]: + """ + in-place two passes + """ + closed = -1 + n = len(A) + for i in range(n): + if A[i] % 2 == 0: + closed += 1 + A[i], A[closed] = A[closed], A[i] + + j = closed + 1 + if j % 2 == 1: + j += 1 + for i in range(1, closed + 1, 2): + A[i], A[j] = A[j], A[i] + j += 2 + + return A + + +if __name__ == "__main__": + assert Solution().sortArrayByParityII([4,1,1,0,1,0]) == [4,1,0,1,0,1] diff --git a/923 3Sum With Multiplicity.py b/923 3Sum With Multiplicity.py new file mode 100644 index 0000000..96ae4f2 --- /dev/null +++ b/923 3Sum With Multiplicity.py @@ -0,0 +1,166 @@ +#!/usr/bin/python3 +""" +Given an integer array A, and an integer target, return the number of tuples +i, j, k such that i < j < k and A[i] + A[j] + A[k] == target. + +As the answer can be very large, return it modulo 10^9 + 7. + +Example 1: + +Input: A = [1,1,2,2,3,3,4,4,5,5], target = 8 +Output: 20 +Explanation: +Enumerating by the values (A[i], A[j], A[k]): +(1, 2, 5) occurs 8 times; +(1, 3, 4) occurs 8 times; +(2, 2, 4) occurs 2 times; +(2, 3, 3) occurs 2 times. +Example 2: + +Input: A = [1,1,2,2,2,2], target = 5 +Output: 12 +Explanation: +A[i] = 1, A[j] = A[k] = 2 occurs 12 times: +We choose one 1 from [1,1] in 2 ways, +and two 2s from [2,2,2,2] in 6 ways. + + +Note: + +3 <= A.length <= 3000 +0 <= A[i] <= 100 +0 <= target <= 300 +""" +from typing import List +from collections import defaultdict + + +MOD = 10 ** 9 + 7 + + +class Solution: + def threeSumMulti(self, A: List[int], target: int) -> int: + """ + Adapted from 3 sum + 3 pointers O(N + K^2) + j, k scan each element once + """ + counter = defaultdict(int) + for a in A: + counter[a] += 1 + + keys = list(counter.keys()) + keys.sort() + n = len(keys) + ret = 0 + for i in range(n): + j = i # not i + 1 + k = n - 1 + while j <= k: # not < + a, b, c = keys[i], keys[j], keys[k] + if b + c < target - a: + j += 1 + elif b + c > target - a: + k -= 1 + else: # equal + if a < b < c: + ret += counter[a] * counter[b] * counter[c] + elif a == b < c: + # nC2 + ret += counter[a] * (counter[a] - 1) // 2 * counter[c] + elif a < b == c: + ret += counter[a] * counter[b] * (counter[b] - 1) // 2 + elif a== b == c: + # nC3 + ret += counter[a] * (counter[a] - 1) * (counter[a] - 2) // (3 * 2) + else: + raise + + ret %= MOD + j += 1 + k -= 1 + + return ret + + def threeSumMulti_TLE(self, A: List[int], target: int) -> int: + """ + Adapted from 3 sum + 3 pointers O(N^2) + j, k scan each element once + """ + A.sort() + n = len(A) + ret = 0 + for i in range(n): + j = i + 1 + k = n - 1 + while j < k: + if A[j] + A[k] < target - A[i]: + j += 1 + elif A[j] + A[k] > target - A[i]: + k -= 1 + else: # equal + l_cnt = 1 + while j + l_cnt < n and A[j + l_cnt] == A[j]: + l_cnt += 1 + + r_cnt = 1 + while k - r_cnt >= 0 and A[k - r_cnt] == A[k]: + r_cnt += 1 + + if A[j] != A[k]: + ret += l_cnt * r_cnt + ret %= MOD + else: + ret += l_cnt * (l_cnt - 1) // 2 # nC2 + ret %= MOD + + j += l_cnt + k -= r_cnt + + return ret + + def threeSumMulti_TLE(self, A: List[int], target: int) -> int: + """ + O(n * target * 3) + Let F[i][t][k] be the number of k sums using A[:i] to target t + """ + n = len(A) + F = [[[0 for _ in range(3 + 1)] for _ in range(target + 1)] for _ in range(n+1)] + + for i in range(n+1): + F[i][0][0] = 1 + + for i in range(1, n + 1): + for t in range(target + 1): + for k in range(1, 3 + 1): + # choose A[i-1] or not + F[i][t][k] = F[i-1][t][k] % MOD + if t - A[i-1] >= 0: + F[i][t][k] += F[i-1][t-A[i-1]][k-1] % MOD + + print(F[n][target][3]) + return F[n][target][3] + + def threeSumMulti_TLE(self, A: List[int], target: int) -> int: + """ + O(n * target * 3) + Let F[i][t][k] be the number of k sums using A[:i] to target t + """ + F = defaultdict(lambda: defaultdict(lambda: defaultdict(int))) + n = len(A) + for i in range(n+1): + F[i][0][0] = 1 + + for i in range(1, n + 1): + for t in range(target + 1): + for k in range(1, 3 + 1): + # choose A[i-1] or not + F[i][t][k] = F[i-1][t][k] + F[i-1][t-A[i-1]][k-1] + F[i][t][k] %= MOD + + return F[n][target][3] + + +if __name__ == "__main__": + assert Solution().threeSumMulti([1,1,2,2,3,3,4,4,5,5], 8) == 20 diff --git a/924 Minimize Malware Spread.py b/924 Minimize Malware Spread.py new file mode 100644 index 0000000..0d04e56 --- /dev/null +++ b/924 Minimize Malware Spread.py @@ -0,0 +1,101 @@ +#!/usr/bin/python3 +""" +In a network of nodes, each node i is directly connected to another node j if +and only if graph[i][j] = 1. + +Some nodes initial are initially infected by malware. Whenever two nodes are +directly connected and at least one of those two nodes is infected by malware, +both nodes will be infected by malware. This spread of malware will continue +until no more nodes can be infected in this manner. + +Suppose M(initial) is the final number of nodes infected with malware in the +entire network, after the spread of malware stops. + +We will remove one node from the initial list. Return the node that if removed, +would minimize M(initial). If multiple nodes could be removed to minimize +M(initial), return such a node with the smallest index. + +Note that if a node was removed from the initial list of infected nodes, it may +still be infected later as a result of the malware spread. + +Example 1: +Input: graph = [[1,1,0],[1,1,0],[0,0,1]], initial = [0,1] +Output: 0 + +Example 2: +Input: graph = [[1,0,0],[0,1,0],[0,0,1]], initial = [0,2] +Output: 0 + +Example 3: +Input: graph = [[1,1,1],[1,1,1],[1,1,1]], initial = [1,2] +Output: 1 + +Note: +1 < graph.length = graph[0].length <= 300 +0 <= graph[i][j] == graph[j][i] <= 1 +graph[i][i] = 1 +1 <= initial.length < graph.length +0 <= initial[i] < graph.length +""" +from typing import List +from collections import defaultdict + + +class DisjointSet: + def __init__(self): + self.pi = {} + + def union(self, x, y): + pi_x = self.find(x) + pi_y = self.find(y) + self.pi[pi_x] = pi_y + + def find(self, x): + if x not in self.pi: + self.pi[x] = x + if self.pi[x] != x: + self.pi[x] = self.find(self.pi[x]) + return self.pi[x] + + +class Solution: + def minMalwareSpread(self, graph: List[List[int]], initial: List[int]) -> int: + """ + DisjointSet. But how to use DisjointSet? + + Ensure each component, the element points to a common ancestor. + The ancestor uniquely identify the component + + Each component has size. If there are only one malware in the component, + then the component can be sanitized. + """ + ds = DisjointSet() + n = len(graph) # nbr matrix + for i in range(n): + for j in range(n): + if graph[i][j] == 1: + ds.union(i, j) + + counts = defaultdict(int) # count of element in the component + for i in range(n): + counts[ds.find(i)] += 1 + + malware_counts = defaultdict(int) + for i in initial: + malware_counts[ds.find(i)] += 1 + + max_i = min(initial) + for i in initial: + pi = ds.find(i) + if malware_counts[pi] == 1: + max_count = counts[ds.find(max_i)] + if max_count < counts[pi]: + max_i = i + elif max_count == counts[pi] and max_i > i: + max_i = i + + return max_i + + +if __name__ == "__main__": + assert Solution().minMalwareSpread([[1,1,0],[1,1,0],[0,0,1]], [0,1]) == 0 diff --git a/925 Long Pressed Name.py b/925 Long Pressed Name.py new file mode 100644 index 0000000..a857ab7 --- /dev/null +++ b/925 Long Pressed Name.py @@ -0,0 +1,59 @@ +#!/usr/bin/python3 +""" +Your friend is typing his name into a keyboard. Sometimes, when typing a +character c, the key might get long pressed, and the character will be typed 1 +or more times. + +You examine the typed characters of the keyboard. Return True if it is possible +that it was your friends name, with some characters (possibly none) being long +pressed. + +Example 1: + +Input: name = "alex", typed = "aaleex" +Output: true +Explanation: 'a' and 'e' in 'alex' were long pressed. +Example 2: + +Input: name = "saeed", typed = "ssaaedd" +Output: false +Explanation: 'e' must have been pressed twice, but it wasn't in the typed output. +Example 3: + +Input: name = "leelee", typed = "lleeelee" +Output: true +Example 4: + +Input: name = "laiden", typed = "laiden" +Output: true +Explanation: It's not necessary to long press any character. + +Note: + +name.length <= 1000 +typed.length <= 1000 +The characters of name and typed are lowercase letters. +""" + + +class Solution: + def isLongPressedName(self, name: str, typed: str) -> bool: + """ + two pointers + """ + m, n = len(name), len(typed) + i, j = 0, 0 + while i < m and j < n: + if name[i] == typed[j]: + i += 1 + j += 1 + elif j - 1 >= 0 and typed[j-1] == typed[j]: + j += 1 + else: + return False + + # tail + while j - 1 >= 0 and j < n and typed[j-1] == typed[j]: + j += 1 + + return i == m and j == n diff --git a/926 Flip String to Monotone Increasing.py b/926 Flip String to Monotone Increasing.py new file mode 100644 index 0000000..7c16d23 --- /dev/null +++ b/926 Flip String to Monotone Increasing.py @@ -0,0 +1,62 @@ +#!/usr/bin/python3 +""" +A string of '0's and '1's is monotone increasing if it consists of some number +of '0's (possibly 0), followed by some number of '1's (also possibly 0.) + +We are given a string S of '0's and '1's, and we may flip any '0' to a '1' or a +'1' to a '0'. + +Return the minimum number of flips to make S monotone increasing. + + + +Example 1: + +Input: "00110" +Output: 1 +Explanation: We flip the last digit to get 00111. +Example 2: + +Input: "010110" +Output: 2 +Explanation: We flip to get 011111, or alternatively 000111. +Example 3: + +Input: "00011000" +Output: 2 +Explanation: We flip to get 00000000. + + +Note: + +1 <= S.length <= 20000 +S only consists of '0' and '1' characters. +""" + + +class Solution: + def minFlipsMonoIncr(self, S: str) -> int: + """ + let S[i] be the flipping point, leftside 0, rightside 1 + count number of 1 from the left, + count number of 0 from the right + O(N) + """ + n = len(S) + Z = [0 for _ in range(n+1)] # let Z[i] be #zero in A[i:] + O = [0 for _ in range(n+1)] # let O[i] be #one in A[:i] + for i in range(1, n+1): + O[i] = O[i-1] + if S[i-1] == "1": + O[i] += 1 + + for i in range(n-1, -1, -1): + Z[i] = Z[i+1] + if S[i] == "0": + Z[i] += 1 + + ret = float('inf') + for i in range(n): + ret = min(ret, O[i] + Z[i+1]) + + return ret diff --git a/928 Minimize Malware Spread II.py b/928 Minimize Malware Spread II.py new file mode 100644 index 0000000..74cfef4 --- /dev/null +++ b/928 Minimize Malware Spread II.py @@ -0,0 +1,104 @@ +#!/usr/bin/python3 +""" +(This problem is the same as Minimize Malware Spread, with the differences +bolded.) + +In a network of nodes, each node i is directly connected to another node j if +and only if graph[i][j] = 1. + +Some nodes initial are initially infected by malware. Whenever two nodes are +directly connected and at least one of those two nodes is infected by malware, +both nodes will be infected by malware. This spread of malware will continue +until no more nodes can be infected in this manner. + +Suppose M(initial) is the final number of nodes infected with malware in the +entire network, after the spread of malware stops. + +We will remove one node from the initial list, completely removing it and any +connections from this node to any other node. Return the node that if removed, +would minimize M(initial). If multiple nodes could be removed to minimize +M(initial), return such a node with the smallest index. + +Example 1: +Input: graph = [[1,1,0],[1,1,0],[0,0,1]], initial = [0,1] +Output: 0 + +Example 2: +Input: graph = [[1,1,0],[1,1,1],[0,1,1]], initial = [0,1] +Output: 1 + +Example 3: +Input: graph = [[1,1,0,0],[1,1,1,0],[0,1,1,1],[0,0,1,1]], initial = [0,1] +Output: 1 + + +Note: +1 < graph.length = graph[0].length <= 300 +0 <= graph[i][j] == graph[j][i] <= 1 +graph[i][i] = 1 +1 <= initial.length < graph.length +0 <= initial[i] < graph.length +""" +from typing import List +from collections import defaultdict + + +class DisjointSet: + def __init__(self): + self.pi = {} + + def union(self, x, y): + self.pi[self.find(x)] = self.find(y) + + def find(self, x): + if x not in self.pi: + self.pi[x] = x + if self.pi[x] != x: + self.pi[x] = self.find(self.pi[x]) + return self.pi[x] + + +class Solution: + def minMalwareSpread(self, graph: List[List[int]], initial: List[int]) -> int: + """ + DisjointSet? DisjointSet cannot remove connections + + Then don't add the connections from the malware at all + + For each component of G, either it neighbors 0, 1, or >= 2 nodes from + initial. The result only changes if there is exactly 1 neighbor from + initial, so we need a way to count this. + """ + n = len(graph) + initial_set = set(initial) + normal = [i for i in range(n) if i not in initial_set] + ds = DisjointSet() + for i in normal: + for j in normal: + if graph[i][j] == 1: + ds.union(i, j) + + sizes = defaultdict(int) + for i in normal: + sizes[ds.find(i)] += 1 + + comp2malcount = defaultdict(int) + mal2comps = defaultdict(set) + for i in normal: + for j in initial: + if graph[i][j] == 1: + comp2malcount[ds.find(i)] += 1 + mal2comps[j].add(ds.find(i)) + + idx = min(initial) + max_size = 0 + for j in initial: + for comp in mal2comps[j]: + if comp2malcount[comp] == 1: + if sizes[comp] > max_size: + max_size = sizes[comp] + idx = j + elif sizes[comp] == max_size: + idx = min(idx, j) + + return idx diff --git a/929 Unique Email Addresses.py b/929 Unique Email Addresses.py new file mode 100644 index 0000000..3353a11 --- /dev/null +++ b/929 Unique Email Addresses.py @@ -0,0 +1,59 @@ +#!/usr/bin/python3 +""" +Every email consists of a local name and a domain name, separated by the @ sign. + +For example, in alice@leetcode.com, alice is the local name, and leetcode.com is +the domain name. + +Besides lowercase letters, these emails may contain '.'s or '+'s. + +If you add periods ('.') between some characters in the local name part of an +email address, mail sent there will be forwarded to the same address without +dots in the local name. For example, "alice.z@leetcode.com" and +"alicez@leetcode.com" forward to the same email address. (Note that this rule +does not apply for domain names.) + +If you add a plus ('+') in the local name, everything after the first plus sign +will be ignored. This allows certain emails to be filtered, for example +m.y+name@email.com will be forwarded to my@email.com. (Again, this rule does +not apply for domain names.) + +It is possible to use both of these rules at the same time. + +Given a list of emails, we send one email to each address in the list. How many +different addresses actually receive mails? + +Example 1: + +Input: ["test.email+alex@leetcode.com","test.e.mail+bob.cathy@leetcode.com", +"testemail+david@lee.tcode.com"] +Output: 2 +Explanation: "testemail@leetcode.com" and "testemail@lee.tcode.com" actually +receive mails + +Note: + +1 <= emails[i].length <= 100 +1 <= emails.length <= 100 +Each emails[i] contains exactly one '@' character. +All local and domain names are non-empty. +Local names do not start with a '+' character. +""" +from typing import List + + +class Solution: + def numUniqueEmails(self, emails: List[str]) -> int: + """ + stemming + """ + s = set() + for e in emails: + local, domain = e.split("@") + local = self.stem(local) + s.add((local, domain)) + + return len(s) + + def stem(self, local): + return local.split("+")[0].replace(".", "") diff --git a/930 Binary Subarrays With Sum.py b/930 Binary Subarrays With Sum.py new file mode 100644 index 0000000..f58b19e --- /dev/null +++ b/930 Binary Subarrays With Sum.py @@ -0,0 +1,87 @@ +#!/usr/bin/python3 +""" +In an array A of 0s and 1s, how many non-empty subarrays have sum S? + +Example 1: + +Input: A = [1,0,1,0,1], S = 2 +Output: 4 +Explanation: +The 4 subarrays are bolded below: +[1,0,1,0,1] +[1,0,1,0,1] +[1,0,1,0,1] +[1,0,1,0,1] + + +Note: + +A.length <= 30000 +0 <= S <= A.length +A[i] is either 0 or 1. +""" +from typing import List + + +class Solution: + def numSubarraysWithSum(self, A: List[int], S: int) -> int: + """ + Two pointers + i_lo and i_hi + count = i_hi - i_lo + 1 + """ + ret = 0 + i_lo, i_hi, j = 0, 0, 0 + sum_lo, sum_hi = 0, 0 + for j in range(len(A)): + sum_lo += A[j] + sum_hi += A[j] + while i_lo < j and sum_lo > S: + sum_lo -= A[i_lo] + i_lo += 1 + while i_hi < j and (sum_hi > S or sum_hi == S and A[i_hi] == 0): + sum_hi -= A[i_hi] + i_hi += 1 + assert i_hi >= i_lo + if sum_lo == S: + assert sum_hi == S + ret += i_hi - i_lo + 1 + + return ret + + def numSubarraysWithSum_error(self, A: List[int], S: int) -> int: + """ + Continuous subarrays sum using prefix sum to target O(N), space O(N) + Two pointer, O(N), space O(1) + """ + ret = 0 + i = 0 + j = 0 + n = len(A) + cur_sum = 0 + while j < n: + cur_sum += A[j] + if cur_sum < S and j < n: + j += 1 + elif cur_sum == S: + ret += 1 + while i <= j and A[i] == 0: + i += 1 + ret += 1 + j += 1 + else: + while i <= j and cur_sum > S: + cur_sum -= A[i] + i += 1 + if cur_sum == S: + ret += 1 + while i <= j and A[i] == 0: + i += 1 + ret += 1 + j += 1 + + return ret + + +if __name__ == "__main__": + assert Solution().numSubarraysWithSum([1,0,1,0,1], 2) == 4 diff --git a/931 Minimum Falling Path Sum.py b/931 Minimum Falling Path Sum.py new file mode 100644 index 0000000..b8aeeef --- /dev/null +++ b/931 Minimum Falling Path Sum.py @@ -0,0 +1,77 @@ +#!/usr/bin/python3 +""" +Given a square array of integers A, we want the minimum sum of a falling path +through A. + +A falling path starts at any element in the first row, and chooses one element +from each row. The next row's choice must be in a column that is different from +the previous row's column by at most one. + + + +Example 1: + +Input: [[1,2,3],[4,5,6],[7,8,9]] +Output: 12 +Explanation: +The possible falling paths are: +[1,4,7], [1,4,8], [1,5,7], [1,5,8], [1,5,9] +[2,4,7], [2,4,8], [2,5,7], [2,5,8], [2,5,9], [2,6,8], [2,6,9] +[3,5,7], [3,5,8], [3,5,9], [3,6,8], [3,6,9] +The falling path with the smallest sum is [1,4,7], so the answer is 12. + + + +Note: + +1 <= A.length == A[0].length <= 100 +-100 <= A[i][j] <= 100 +""" +from typing import List +from collections import defaultdict + + +class Solution: + def minFallingPathSum(self, A: List[List[int]]) -> int: + """ + dp, build from bottom + let F[i][j] be the min falling path sum at A[i][j] + using default dict + """ + m, n = len(A), len(A[0]) + F = defaultdict(lambda: defaultdict(lambda: float("inf"))) + for j in range(n): + F[m-1][j] = A[m-1][j] + + for i in range(m-2, -1, -1): + for j in range(n): + F[i][j] = min(F[i+1][j-1], F[i+1][j], F[i+1][j+1]) + A[i][j] + + return min( + F[0][j] + for j in range(n) + ) + + def minFallingPathSum_std(self, A: List[List[int]]) -> int: + """ + dp, build from bottom + let F[i][j] be the min falling path sum at A[i][j] + """ + m, n = len(A), len(A[0]) + F = [[float('inf') for _ in range(n)] for _ in range(m)] + for j in range(n): + F[m-1][j] = A[m-1][j] + + for i in range(m-2, -1, -1): + for j in range(n): + F[i][j] = min(F[i][j], F[i+1][j] + A[i][j]) + if j - 1 >= 0: + F[i][j] = min(F[i][j], F[i+1][j-1] + A[i][j]) + if j + 1 < n: + F[i][j] = min(F[i][j], F[i+1][j+1] + A[i][j]) + + return min(F[0]) + + +if __name__ == "__main__": + assert Solution().minFallingPathSum([[1,2,3],[4,5,6],[7,8,9]]) == 12 diff --git a/934 Shortest Bridge.py b/934 Shortest Bridge.py new file mode 100644 index 0000000..9a16268 --- /dev/null +++ b/934 Shortest Bridge.py @@ -0,0 +1,96 @@ +#!/usr/bin/python3 +""" +In a given 2D binary array A, there are two islands. (An island is a +4-directionally connected group of 1s not connected to any other 1s.) + +Now, we may change 0s to 1s so as to connect the two islands together to form 1 +island. + +Return the smallest number of 0s that must be flipped. (It is guaranteed that +the answer is at least 1.) + +Example 1: + +Input: [[0,1],[1,0]] +Output: 1 +Example 2: + +Input: [[0,1,0],[0,0,0],[0,0,1]] +Output: 2 +Example 3: + +Input: [[1,1,1,1,1],[1,0,0,0,1],[1,0,1,0,1],[1,0,0,0,1],[1,1,1,1,1]] +Output: 1 + +Note: +1 <= A.length = A[0].length <= 100 +A[i][j] == 0 or A[i][j] == 1 +""" +from typing import List + + +dirs = ((0, -1), (0, 1), (-1, 0), (1, 0)) + + +class Solution: + def shortestBridge(self, A: List[List[int]]) -> int: + """ + market component 1 and component 2 + iterate 0 and BFS, min(dist1 + dist2 - 1)? + O(N * N) high complexity + + BFS grow from 1 component + """ + m, n = len(A), len(A[0]) + # coloring + colors = [[None for _ in range(n)] for _ in range(m)] + color = 0 + for i in range(m): + for j in range(n): + if A[i][j] == 1 and colors[i][j] is None: + self.dfs(A, i, j, colors, color) + color += 1 + assert color == 2 + + # BFS + step = 0 + q = [] + visited = [[False for _ in range(n)] for _ in range(m)] + for i in range(m): + for j in range(n): + if colors[i][j] == 0: + visited[i][j] = True + q.append((i, j)) + + while q: + cur_q = [] + for i, j in q: + for I, J in self.nbr(A, i, j): + if not visited[I][J]: + if colors[I][J] == None: + visited[I][J] = True # pre-check, dedup + cur_q.append((I, J)) + elif colors[I][J] == 1: + return step + step += 1 + q = cur_q + + raise + + def nbr(self, A, i, j): + m, n = len(A), len(A[0]) + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n: + yield I, J + + def dfs(self, A, i, j, colors, color): + colors[i][j] = color + for I, J in self.nbr(A, i, j): + if colors[I][J] is None and A[I][J] == 1: + self.dfs(A, I, J, colors, color) + + +if __name__ == "__main__": + assert Solution().shortestBridge([[1,1,1,1,1],[1,0,0,0,1],[1,0,1,0,1],[1,0,0,0,1],[1,1,1,1,1]]) == 1 diff --git a/935 Knight Dialer.py b/935 Knight Dialer.py new file mode 100644 index 0000000..0cada02 --- /dev/null +++ b/935 Knight Dialer.py @@ -0,0 +1,152 @@ +#!/usr/bin/python3 +""" +A chess knight can move as indicated in the chess diagram below: + +This time, we place our chess knight on any numbered key of a phone pad +(indicated above), and the knight makes N-1 hops. Each hop must be from one key +to another numbered key. + +Each time it lands on a key (including the initial placement of the knight), it +presses the number of that key, pressing N digits total. + +How many distinct numbers can you dial in this manner? + +Since the answer may be large, output the answer modulo 10^9 + 7. + + +Example 1: +Input: 1 +Output: 10 + +Example 2: +Input: 2 +Output: 20 + +Example 3: +Input: 3 +Output: 46 + +Note: +1 <= N <= 5000 +""" + + +MOD = 10 ** 9 + 7 + + +dirs = [ + (-2, 1), + (-1, 2), + (1, 2), + (2, 1), + (2, -1), + (1, -2), + (-1, -2), + (-2, -1), +] + +nbrs = { + 1: (6, 8), + 2: (7, 9), + 3: (4, 8), + 4: (3, 9, 0), + 5: tuple(), + 6: (1, 7, 0), + 7: (2, 6), + 8: (1, 3), + 9: (2, 4), + 0: (4, 6), +} + + +from collections import defaultdict + + +class Solution: + def knightDialer(self, N: int) -> int: + """ + DP + F[pos][step] = sum(F[nbr][step+1] for all nbr) + """ + F = defaultdict(lambda: defaultdict(int)) + for pos in range(10): + F[pos][N-1] = 1 + + for n in range(N-2, -1, -1): + for pos in range(10): + for nbr in nbrs[pos]: + F[pos][n] += F[nbr][n+1] + F[pos][n] %= MOD + + ret = 0 + for i in range(10): + ret += F[i][0] + ret %= MOD + + return ret + + +class SolutionTLE2: + def __init__(self): + self.cache = {} + + def knightDialer(self, N: int) -> int: + ret = 0 + for i in range(10): + ret += self.dfs(i, N-1) + ret %= MOD + + return ret + + def dfs(self, i, r): + if (i, r) not in self.cache: + ret = 0 + if r == 0: + ret = 1 + else: + for nbr in nbrs[i]: + ret += self.dfs(nbr, r-1) + + self.cache[i, r] = ret + + return self.cache[i, r] + + +class SolutionTLE: + def __init__(self): + # row, col size + self.m = 4 + self.n = 3 + self.cache = {} + + def knightDialer(self, N: int) -> int: + ret = 0 + for i in range(self.m): + for j in range(self.n): + if (i, j) != (3, 0) and (i, j) != (3, 2): + ret += self.dfs(i, j, N-1) + ret %= MOD + return ret + + def dfs(self, i, j, r): + if (i, j, r) not in self.cache: + ret = 0 + if r == 0: + ret = 1 + else: + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < self.m and 0 <= J < self.n and (I, J) != (3, 0) and (I, J) != (3, 2): + ret += self.dfs(I, J, r - 1) + ret %= MOD + + self.cache[i, j, r] = ret + + return self.cache[i, j, r] + + +if __name__ == "__main__": + assert Solution().knightDialer(1) == 10 + assert Solution().knightDialer(2) == 20 + assert Solution().knightDialer(3) == 46 diff --git a/938 Range Sum of BST.py b/938 Range Sum of BST.py new file mode 100644 index 0000000..2fb7a9e --- /dev/null +++ b/938 Range Sum of BST.py @@ -0,0 +1,56 @@ +#!/usr/bin/python3 +""" +Given the root node of a binary search tree, return the sum of values of all +nodes with value between L and R (inclusive). + +The binary search tree is guaranteed to have unique values. + +Example 1: + +Input: root = [10,5,15,3,7,null,18], L = 7, R = 15 +Output: 32 +Example 2: + +Input: root = [10,5,15,3,7,13,18,1,null,6], L = 6, R = 10 +Output: 23 + + +Note: + +The number of nodes in the tree is at most 10000. +The final answer is guaranteed to be less than 2^31. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.ret = 0 + + def rangeSumBST(self, root: TreeNode, L: int, R: int) -> int: + """ + traverse + """ + self.dfs(root, L, R) + return self.ret + + def dfs(self, node, L, R): + if not node: + return + + if L <= node.val <= R: + self.ret += node.val + self.dfs(node.left, L, R) + self.dfs(node.right, L, R) + + elif node.val > R: + self.dfs(node.left, L, R) + else: + self.dfs(node.right, L, R) diff --git a/941 Valid Mountain Array.py b/941 Valid Mountain Array.py new file mode 100644 index 0000000..e99e76d --- /dev/null +++ b/941 Valid Mountain Array.py @@ -0,0 +1,55 @@ +#!/usr/bin/python3 +""" +Given an array A of integers, return true if and only if it is a valid mountain array. + +Recall that A is a mountain array if and only if: + +A.length >= 3 +There exists some i with 0 < i < A.length - 1 such that: +A[0] < A[1] < ... A[i-1] < A[i] +A[i] > A[i+1] > ... > A[B.length - 1] + + +Example 1: + +Input: [2,1] +Output: false +Example 2: + +Input: [3,5,5] +Output: false +Example 3: + +Input: [0,3,2,1] +Output: true + + +Note: + +0 <= A.length <= 10000 +0 <= A[i] <= 10000 +""" +from typing import List + + +class Solution: + def validMountainArray(self, A: List[int]) -> bool: + """ + related to 845 Longest Mountain in Array + + use a flag + """ + incr = 0 # 0 undecided, 1 increasing, 2 decresing + for i in range(1, len(A)): + if A[i] == A[i-1]: + return False + elif A[i] > A[i-1]: + if incr == 2: + return False + incr = 1 + else: + if incr == 0: + return False + incr = 2 + + return incr == 2 diff --git a/942 DI String Match.py b/942 DI String Match.py new file mode 100644 index 0000000..d188437 --- /dev/null +++ b/942 DI String Match.py @@ -0,0 +1,70 @@ +#!/usr/bin/python3 +""" +Given a string S that only contains "I" (increase) or "D" (decrease), let N = +S.length. + +Return any permutation A of [0, 1, ..., N] such that for all i = 0, ..., N-1: + +If S[i] == "I", then A[i] < A[i+1] +If S[i] == "D", then A[i] > A[i+1] + + +Example 1: + +Input: "IDID" +Output: [0,4,1,3,2] +Example 2: + +Input: "III" +Output: [0,1,2,3] +Example 3: + +Input: "DDI" +Output: [3,2,0,1] + + +Note: + +1 <= S.length <= 10000 +S only contains characters "I" or "D". +""" +from typing import List + + +class Solution: + def diStringMatch(self, S: str) -> List[int]: + """ + Looking at prev rather than cur + If "I", then put smallest as prev. Increase from the min + If "D", then put the largest as prev. Decrese from the max + """ + mini, maxa = 0, len(S) + ret = [] + for c in S: + if c == "I": + ret.append(mini) + mini += 1 + else: # "D" + ret.append(maxa) + maxa -= 1 + + ret.append(mini) + return ret + + def diStringMatchErrror(self, S: str) -> List[int]: + """ + start with 0, then add the min up to 0 + + errror since cannot repeat + """ + ret = [0] + for c in S: + if c == "I": + ret.append(ret[-1] + 1) + else: + ret.append(ret[-1] -1) + mn = min(ret) + return [ + e - mn + for e in ret + ] diff --git a/945 Minimum Increment to Make Array Unique.py b/945 Minimum Increment to Make Array Unique.py new file mode 100644 index 0000000..511ceef --- /dev/null +++ b/945 Minimum Increment to Make Array Unique.py @@ -0,0 +1,94 @@ +#!/usr/bin/python3 +""" +Given an array of integers A, a move consists of choosing any A[i], and +incrementing it by 1. + +Return the least number of moves to make every value in A unique. + + +Example 1: + +Input: [1,2,2] +Output: 1 +Explanation: After 1 move, the array could be [1, 2, 3]. +Example 2: + +Input: [3,2,1,2,1,7] +Output: 6 +Explanation: After 6 moves, the array could be [3, 4, 1, 2, 5, 7]. +It can be shown with 5 or less moves that it is impossible for the array to have all unique values. + +Note: + +0 <= A.length <= 40000 +0 <= A[i] < 40000 +""" +from typing import List +from collections import Counter + + +class Solution: + def minIncrementForUnique(self, A: List[int]) -> int: + """ + sort + at least previous + 1 + """ + if not A: + return 0 + + A.sort() + ret = 0 + prev = A[0] + for i in range(1, len(A)): + target = prev + 1 + if A[i] < target: + # change A[i] to target + ret += target - A[i] + prev = target + else: + prev = A[i] + return ret + + +class Solution: + def minIncrementForUnique(self, A: List[int]) -> int: + """ + fill the slot and count + A[i] < 40000 + largest count 3999 + 40000 + """ + counter = Counter(A) + q = [] + ret = 0 + for i in range(40000 * 2): + if counter[i] > 1: + q.extend([i] * (counter[i] - 1)) + elif q and counter[i] == 0: + ret += i - q.pop() + return ret + +class Solution: + def minIncrementForUnique(self, A: List[int]) -> int: + """ + sort, a "brute force" solution of incrementing it repeatedly until it is + not unique. + The brute force can be mathematically calculated + + revert to 0, then increase to A[i-1] + k + """ + ret = 0 + A.sort() + A.append(1 << 31 - 1) # append max + demand = 0 + supply = 0 + for i in range(1, len(A)): + if A[i] == A[i-1]: + demand += 1 + # dup_sum += A[i-1] # error + ret -= A[i-1] # smart + else: + supply = min(demand, A[i] - A[i-1] - 1) + # revert to 0, then increase to A[i-1] + k + ret += (A[i-1] + 1 + A[i-1] + supply) * supply // 2 + demand -= supply + + return ret diff --git a/946 Validate Stack Sequences.py b/946 Validate Stack Sequences.py new file mode 100644 index 0000000..1b1c292 --- /dev/null +++ b/946 Validate Stack Sequences.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +Given two sequences pushed and popped with distinct values, return true if and +only if this could have been the result of a sequence of push and pop operations +on an initially empty stack. + +Example 1: + +Input: pushed = [1,2,3,4,5], popped = [4,5,3,2,1] +Output: true +Explanation: We might do the following sequence: +push(1), push(2), push(3), push(4), pop() -> 4, +push(5), pop() -> 5, pop() -> 3, pop() -> 2, pop() -> 1 +Example 2: + +Input: pushed = [1,2,3,4,5], popped = [4,3,5,1,2] +Output: false +Explanation: 1 cannot be popped before 2. + + +Note: + +0 <= pushed.length == popped.length <= 1000 +0 <= pushed[i], popped[i] < 1000 +pushed is a permutation of popped. +pushed and popped have distinct values. +""" +from typing import List + + +class Solution: + def validateStackSequences(self, pushed: List[int], popped: List[int]) -> bool: + """ + maintain a stack and iterate through pushed + """ + j = 0 + n = len(pushed) + stk = [] + for i in range(n): + stk.append(pushed[i]) + while j < n and stk and stk[-1] == popped[j]: + stk.pop() + j += 1 + + return j == n + + def validateStackSequences(self, pushed: List[int], popped: List[int]) -> bool: + """ + maintain a stack + """ + i = 0 + j = 0 + stk = [] + n = len(pushed) + while i < n and j < n: + while i < n and (not stk or stk[-1] != popped[j]): + stk.append(pushed[i]) + i += 1 + + stk.pop() + j += 1 + + while j < n and stk and stk[-1] == popped[j]: + stk.pop() + j += 1 + + return not stk diff --git a/947 Most Stones Removed with Same Row or Column.py b/947 Most Stones Removed with Same Row or Column.py new file mode 100644 index 0000000..89c555b --- /dev/null +++ b/947 Most Stones Removed with Same Row or Column.py @@ -0,0 +1,70 @@ +#!/usr/bin/python3 +""" +On a 2D plane, we place stones at some integer coordinate points. Each coordinate point may have at most one stone. + +Now, a move consists of removing a stone that shares a column or row with another stone on the grid. + +What is the largest possible number of moves we can make? + + + +Example 1: + +Input: stones = [[0,0],[0,1],[1,0],[1,2],[2,1],[2,2]] +Output: 5 +Example 2: + +Input: stones = [[0,0],[0,2],[1,1],[2,0],[2,2]] +Output: 3 +Example 3: + +Input: stones = [[0,0]] +Output: 0 + + +Note: + +1 <= stones.length <= 1000 +0 <= stones[i][j] < 10000 +""" +from typing import List +from collections import defaultdict + + +class Solution: + def removeStones(self, stones: List[List[int]]) -> int: + """ + convert to graph problem + each component in the graph can be removed to only one node + N - #component + + construct graph O(N^2) + DFS - O(N) + """ + G = defaultdict(list) + n = len(stones) + for i in range(n): + for j in range(i): + if stones[i][0] == stones[j][0] or stones[i][1] == stones[j][1]: + G[i].append(j) + G[j].append(i) + + # dfs + comp_cnt = 0 + visited = [False for _ in range(n)] + for i in range(n): + if not visited[i]: + comp_cnt += 1 + self.dfs(G, i, visited) + + return n - comp_cnt + + def dfs(self, G, i, visited): + visited[i] = True + for nbr in G[i]: + if not visited[nbr]: + self.dfs(G, nbr, visited) + + +if __name__ == "__main__": + assert Solution().removeStones([[0,0],[0,2],[1,1],[2,0],[2,2]]) == 3 diff --git a/950 Reveal Cards In Increasing Order.py b/950 Reveal Cards In Increasing Order.py new file mode 100644 index 0000000..7f12cac --- /dev/null +++ b/950 Reveal Cards In Increasing Order.py @@ -0,0 +1,68 @@ +#!/usr/bin/python3 +""" +In a deck of cards, every card has a unique integer. You can order the deck in +any order you want. + +Initially, all the cards start face down (unrevealed) in one deck. + +Now, you do the following steps repeatedly, until all cards are revealed: + +Take the top card of the deck, reveal it, and take it out of the deck. +If there are still cards in the deck, put the next top card of the deck at the +bottom of the deck. +If there are still unrevealed cards, go back to step 1. Otherwise, stop. +Return an ordering of the deck that would reveal the cards in increasing order. + +The first entry in the answer is considered to be the top of the deck. + + + +Example 1: + +Input: [17,13,11,2,3,5,7] +Output: [2,13,3,11,5,17,7] +Explanation: +We get the deck in the order [17,13,11,2,3,5,7] (this order doesn't matter), and reorder it. +After reordering, the deck starts as [2,13,3,11,5,17,7], where 2 is the top of the deck. +We reveal 2, and move 13 to the bottom. The deck is now [3,11,5,17,7,13]. +We reveal 3, and move 11 to the bottom. The deck is now [5,17,7,13,11]. +We reveal 5, and move 17 to the bottom. The deck is now [7,13,11,17]. +We reveal 7, and move 13 to the bottom. The deck is now [11,17,13]. +We reveal 11, and move 17 to the bottom. The deck is now [13,17]. +We reveal 13, and move 17 to the bottom. The deck is now [17]. +We reveal 17. +Since all the cards revealed are in increasing order, the answer is correct. + + +Note: +1 <= A.length <= 1000 +1 <= A[i] <= 10^6 +A[i] != A[j] for all i != j +""" +from typing import List +from collections import deque + + +class Solution: + def deckRevealedIncreasing(self, deck: List[int]) -> List[int]: + """ + Sorted is [2, 3, 5, 7, 11, 13, 17] + 17 is the last card, start from the right + Reverse the process + + 17 -> 13 -> 11 + 17 17 + 13 + + Reverse the proess of move top card to the bottom - move the bottom card + to the top + """ + q = deque() + deck.sort() + for i in range(len(deck) - 1, -1, -1): + if q: + tail = q.pop() + q.appendleft(tail) + q.appendleft(deck[i]) + + return list(q) diff --git a/951 Flip Equivalent Binary Trees.py b/951 Flip Equivalent Binary Trees.py new file mode 100644 index 0000000..d704f2d --- /dev/null +++ b/951 Flip Equivalent Binary Trees.py @@ -0,0 +1,50 @@ +#!/usr/bin/python3 +""" +For a binary tree T, we can define a flip operation as follows: choose any node, +and swap the left and right child subtrees. + +A binary tree X is flip equivalent to a binary tree Y if and only if we can make +X equal to Y after some number of flip operations. + +Write a function that determines whether two binary trees are flip equivalent. +The trees are given by root nodes root1 and root2. + + + +Example 1: + +Input: root1 = [1,2,3,4,5,6,null,null,null,7,8], root2 = [1,3,2,null,6,4,5,null,null,null,null,8,7] +Output: true +Explanation: We flipped at nodes with values 1, 3, and 5. +Flipped Trees Diagram + + +Note: + +Each tree will have at most 100 nodes. +Each value in each tree will be a unique integer in the range [0, 99]. +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def flipEquiv(self, root1: TreeNode, root2: TreeNode) -> bool: + """ + O(N) + """ + if not root1 and not root2: + return True + elif not root1 or not root2: + return False + + if root1.val != root2.val: + return False + + return self.flipEquiv(root1.left, root2.left) and self.flipEquiv(root1.right, root2.right) or \ + self.flipEquiv(root1.left, root2.right) and self.flipEquiv(root1.right, root2.left) diff --git a/953 Verifying an Alien Dictionary.py b/953 Verifying an Alien Dictionary.py new file mode 100644 index 0000000..109d369 --- /dev/null +++ b/953 Verifying an Alien Dictionary.py @@ -0,0 +1,70 @@ +#!/usr/bin/python3 +""" +In an alien language, surprisingly they also use english lowercase letters, but +possibly in a different order. The order of the alphabet is some permutation of +lowercase letters. + +Given a sequence of words written in the alien language, and the order of the +alphabet, return true if and only if the given words are sorted lexicographicaly +in this alien language. + + + +Example 1: + +Input: words = ["hello","leetcode"], order = "hlabcdefgijkmnopqrstuvwxyz" +Output: true +Explanation: As 'h' comes before 'l' in this language, then the sequence is +sorted. +Example 2: + +Input: words = ["word","world","row"], order = "worldabcefghijkmnpqstuvxyz" +Output: false +Explanation: As 'd' comes after 'l' in this language, then words[0] > words[1], +hence the sequence is unsorted. +Example 3: + +Input: words = ["apple","app"], order = "abcdefghijklmnopqrstuvwxyz" +Output: false +Explanation: The first three characters "app" match, and the second string is +shorter (in size.) According to lexicographical rules "apple" > "app", because 'l' > '∅', where '∅' is defined as the blank character which is less than any other character (More info). + +Note: + +1 <= words.length <= 100 +1 <= words[i].length <= 20 +order.length == 26 +All characters in words[i] and order are english lowercase letters. +""" +from typing import List + + +class Solution: + def isAlienSorted(self, words: List[str], order: str) -> bool: + h = {} + for i, c in enumerate(order): + h[c] = i + + for i in range(1, len(words)): + if self.cmp(words[i], words[i-1], h) == -1: + return False + + return True + + def cmp(self, w1, w2, h): + for c1, c2 in zip(w1, w2): + if h[c1] < h[c2]: + return -1 + elif h[c1] > h[c2]: + return 1 + + if len(w1) == len(w2): + return 0 + elif len(w1) > len(w2): + return 1 + else: + return -1 + + +if __name__ == "__main__": + assert Solution().isAlienSorted(["hello","leetcode"], "hlabcdefgijkmnopqrstuvwxyz") == True diff --git a/954 Array of Doubled Pairs.py b/954 Array of Doubled Pairs.py new file mode 100644 index 0000000..3031101 --- /dev/null +++ b/954 Array of Doubled Pairs.py @@ -0,0 +1,80 @@ +#!/usr/bin/python3 +""" +Given an array of integers A with even length, return true if and only if it is +possible to reorder it such that A[2 * i + 1] = 2 * A[2 * i] for every +0 <= i < len(A) / 2. + + + +Example 1: + +Input: [3,1,3,6] +Output: false +Example 2: + +Input: [2,1,2,6] +Output: false +Example 3: + +Input: [4,-2,2,-4] +Output: true +Explanation: We can take two groups, [-2,-4] and [2,4] to form [-2,-4,2,4] or +[2,4,-2,-4]. +Example 4: + +Input: [1,2,4,16,8,4] +Output: false + + +Note: + +0 <= A.length <= 30000 +A.length is even +-100000 <= A[i] <= 100000 +""" +from typing import List +from collections import Counter + + +class Solution: + def canReorderDoubled(self, A: List[int]) -> bool: + A.sort(key=abs) + counter = Counter(A) + for a in A: + if counter[a] == 0: + continue + if counter[2*a] == 0: + return False + + counter[a] -= 1 + counter[2*a] -= 1 + + return True + + def canReorderDoubled_positive_negative(self, A: List[int]) -> bool: + """ + sort + counter to form the doubled pairs + """ + A.sort() + counter = Counter(A) + for a in A: + if counter[a] == 0: + continue + counter[a] -= 1 + if a > 0: + target = 2 * a + elif a % 2 != 0: + return False + else: + target = a // 2 + + if counter[target] > 0: + counter[target] -= 1 + else: + return False + + return True + + +if __name__ == "__main__": + assert Solution().canReorderDoubled([4,-2,2,-4]) == True diff --git a/955 Delete Columns to Make Sorted II.py b/955 Delete Columns to Make Sorted II.py new file mode 100644 index 0000000..b68163e --- /dev/null +++ b/955 Delete Columns to Make Sorted II.py @@ -0,0 +1,77 @@ +#!/usr/bin/python3 +""" +We are given an array A of N lowercase letter strings, all of the same length. + +Now, we may choose any set of deletion indices, and for each string, we delete +all the characters in those indices. + +For example, if we have an array A = ["abcdef","uvwxyz"] and deletion indices +{0, 2, 3}, then the final array after deletions is ["bef","vyz"]. + +Suppose we chose a set of deletion indices D such that after deletions, the +final array has its elements in lexicographic order (A[0] <= A[1] <= A[2] ... +<= A[A.length - 1]). + +Return the minimum possible value of D.length. + + + +Example 1: + +Input: ["ca","bb","ac"] +Output: 1 +Explanation: +After deleting the first column, A = ["a", "b", "c"]. +Now A is in lexicographic order (ie. A[0] <= A[1] <= A[2]). +We require at least 1 deletion since initially A was not in lexicographic order, +so the answer is 1. +Example 2: + +Input: ["xc","yb","za"] +Output: 0 +Explanation: +A is already in lexicographic order, so we don't need to delete anything. +Note that the rows of A are not necessarily in lexicographic order: +ie. it is NOT necessarily true that (A[0][0] <= A[0][1] <= ...) +Example 3: + +Input: ["zyx","wvu","tsr"] +Output: 3 +Explanation: +We have to delete every column. + + +Note: + +1 <= A.length <= 100 +1 <= A[i].length <= 100 +""" +from typing import List + + +class Solution: + def minDeletionSize(self, A: List[str]) -> int: + """ + Greedily delete + Scannign from left to right + Keep a lt array to reprent already sorted pair + lt[i] is true meaning A[i] < A[i+1] + + handle equal case [aa, ab, aa] + """ + m, n = len(A), len(A[0]) + lt = [False for i in range(m)] + deleted = 0 + for j in range(n): + for i in range(m-1): + if lt[i]: + continue + if A[i][j] > A[i+1][j]: + deleted += 1 + break + else: # not deleted + # handle equal case + for i in range(m-1): + lt[i] = lt[i] or A[i][j] < A[i+1][j] + + return deleted diff --git a/958 Check Completeness of a Binary Tree.py b/958 Check Completeness of a Binary Tree.py new file mode 100644 index 0000000..a739c75 --- /dev/null +++ b/958 Check Completeness of a Binary Tree.py @@ -0,0 +1,62 @@ +#!/usr/bin/python3 +""" +Given a binary tree, determine if it is a complete binary tree. + +Definition of a complete binary tree from Wikipedia: +In a complete binary tree every level, except possibly the last, is completely +filled, and all nodes in the last level are as far left as possible. It can have +between 1 and 2h nodes inclusive at the last level h. + +Example 1: + +Input: [1,2,3,4,5,6] +Output: true +Explanation: Every level before the last is full (ie. levels with node-values +{1} and {2, 3}), and all nodes in the last level ({4, 5, 6}) are as far left as possible. +Example 2: + +Input: [1,2,3,4,5,null,7] +Output: false +Explanation: The node with value 7 isn't as far left as possible. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.max_depth = -float("inf") + self.expecting_partial = False + + def isCompleteTree(self, root: TreeNode) -> bool: + """ + Do it in one pass + Left first dfs + Record the max depth and expecting partial fill in the last level + Need a special flag to tell whether expecting partial now + """ + return self.dfs(root, 0) + + def dfs(self, node, d): + if not node: + # empty node (below leaf) is the key decision point + if self.max_depth == -float("inf"): # leftmost empty node + self.max_depth = d - 1 + return True + elif self.expecting_partial: + return d == self.max_depth + else: + if d == self.max_depth + 1: + return True + if d == self.max_depth: + self.expecting_partial = True + return True + return False + + return self.dfs(node.left, d + 1) and self.dfs(node.right, d + 1) diff --git a/959 Regions Cut By Slashes.py b/959 Regions Cut By Slashes.py new file mode 100644 index 0000000..56b6d0f --- /dev/null +++ b/959 Regions Cut By Slashes.py @@ -0,0 +1,154 @@ +#!/usr/bin/python3 +""" +In a N x N grid composed of 1 x 1 squares, each 1 x 1 square consists of a /, \, +or blank space. These characters divide the square into contiguous regions. + +(Note that backslash characters are escaped, so a \ is represented as "\\".) + +Return the number of regions. + + +Example 1: + +Input: +[ + " /", + "/ " +] +Output: 2 +Explanation: The 2x2 grid is as follows: + +Example 2: + +Input: +[ + " /", + " " +] +Output: 1 +Explanation: The 2x2 grid is as follows: + +Example 3: + +Input: +[ + "\\/", + "/\\" +] +Output: 4 +Explanation: (Recall that because \ characters are escaped, "\\/" refers to \/, +and "/\\" refers to /\.) +The 2x2 grid is as follows: + +Example 4: + +Input: +[ + "/\\", + "\\/" +] +Output: 5 +Explanation: (Recall that because \ characters are escaped, "/\\" refers to /\, +and "\\/" refers to \/.) +The 2x2 grid is as follows: + +Example 5: + +Input: +[ + "//", + "/ " +] +Output: 3 +Explanation: The 2x2 grid is as follows: + + + +Note: + +1 <= grid.length == grid[0].length <= 30 +grid[i][j] is either '/', '\', or ' '. +""" +from typing import List + + +class DisjointSet: + def __init__(self): + """ + unbalanced DisjointSet + """ + self.pi = {} + + def union(self, x, y): + pi_x = self.find(x) + pi_y = self.find(y) + self.pi[pi_y] = pi_x + + def find(self, x): + # LHS self.pi[x] + if x not in self.pi: + self.pi[x] = x + if self.pi[x] != x: + self.pi[x] = self.find(self.pi[x]) + return self.pi[x] + +class Solution: + def regionsBySlashes(self, grid: List[str]) -> int: + """ + in 1 x 1 cell + 3 possibilities + ___ + | | + |___| + ___ + | /| + |/__| + ___ + |\ | + |__\| + + 4 regions in the + ___ + |\ /| + |/_\| + """ + m, n = len(grid), len(grid[0]) + ds = DisjointSet() + T, R, B, L = range(4) # top, right, bottom, left + for i in range(m): + for j in range(n): + e = grid[i][j] + if e == "/" or e == " ": + ds.union((i, j, B), (i, j, R)) + ds.union((i, j, T), (i, j, L)) + if e == "\\" or e == " ": # not elif + ds.union((i, j, T), (i, j, R)) + ds.union((i, j, B), (i, j, L)) + # nbr + if i - 1 >= 0: + ds.union((i, j, T), (i-1, j, B)) + if j - 1 >= 0: + ds.union((i, j, L), (i, j-1, R)) + + # unnessary, half closed half open + # if i + 1 < m: + # ds.union((i, j, B), (i+1, j, T)) + # if j + 1 < n: + # ds.union((i, j, R), (i, j+1, L)) + + + return len(set( + ds.find(x) + for x in ds.pi.keys() + )) + + +if __name__ == "__main__": + assert Solution().regionsBySlashes([ + " /", + "/ " + ]) == 2 + assert Solution().regionsBySlashes([ + "//", + "/ " + ]) == 3 diff --git a/961 N-Repeated Element in Size 2N Array.py b/961 N-Repeated Element in Size 2N Array.py new file mode 100644 index 0000000..3a8981b --- /dev/null +++ b/961 N-Repeated Element in Size 2N Array.py @@ -0,0 +1,65 @@ +#!/usr/bin/python3 +""" +In a array A of size 2N, there are N+1 unique elements, and exactly one of these +elements is repeated N times. + +Return the element repeated N times. + +Example 1: + +Input: [1,2,3,3] +Output: 3 +Example 2: + +Input: [2,1,2,5,3,2] +Output: 2 +Example 3: + +Input: [5,1,5,2,5,3,5,4] +Output: 5 + + +Note: + +4 <= A.length <= 10000 +0 <= A[i] < 10000 +A.length is even +""" +from typing import List + + +class Solution: + def repeatedNTimes(self, A: List[int]) -> int: + """ + Counter. Straightforward. O(N) space + + O(1) space + 2N items, N + 1 unique, 1 repeat N times + + N = 2 + a t b t + t a b t + N = 3 + a t b t c t + + window 2, cannot find the target + window 3, can find the target? no [9,5,6,9] + window 4, can find + + + * There is a major element in a length 2 subarray, or; + * Every length 2 subarray has exactly 1 major element, which means that + a length 4 subarray that begins at a major element will have 2 major + elements. + """ + n = len(A) + for i in range(n - 1): + for j in range(3): + if A[i] == A[min(n - 1, i + 1 + j)]: + return A[i] + + raise + + +if __name__ == "__main__": + assert Solution().repeatedNTimes([1,2,3,3]) == 3 diff --git a/962 Maximum Width Ramp.py b/962 Maximum Width Ramp.py new file mode 100644 index 0000000..5ca7a57 --- /dev/null +++ b/962 Maximum Width Ramp.py @@ -0,0 +1,49 @@ +#!/usr/bin/python3 +""" +Given an array A of integers, a ramp is a tuple (i, j) for which i < j and +A[i] <= A[j]. The width of such a ramp is j - i. + +Find the maximum width of a ramp in A. If one doesn't exist, return 0. + + + +Example 1: + +Input: [6,0,8,2,1,5] +Output: 4 +Explanation: +The maximum width ramp is achieved at (i, j) = (1, 5): A[1] = 0 and A[5] = 5. +Example 2: + +Input: [9,8,1,0,1,9,4,0,4,1] +Output: 7 +Explanation: +The maximum width ramp is achieved at (i, j) = (2, 9): A[2] = 1 and A[9] = 1. + + +Note: + +2 <= A.length <= 50000 +0 <= A[i] <= 50000 +""" +from typing import List + + +class Solution: + def maxWidthRamp(self, A: List[int]) -> int: + """ + Use stack? No, since require the furthest element rather than the closest + Sort the values, keep its index + Iterate the vlaues in increasing order, calcualte j - i + Need to keep the smallest index + """ + ret = -float("inf") + V = [(a, i) for i, a in enumerate(A)] + V.sort() + min_idx = float("inf") + for _, i in V: + # V is sorted, guarantee a' > a + ret = max(ret, i - min_idx) + min_idx = min(min_idx, i) + + return max(ret, 0) diff --git a/964 Least Operators to Express Number.py b/964 Least Operators to Express Number.py new file mode 100644 index 0000000..7213b3a --- /dev/null +++ b/964 Least Operators to Express Number.py @@ -0,0 +1,96 @@ +#!/usr/bin/python3 +""" +Given a single positive integer x, we will write an expression of the form +x (op1) x (op2) x (op3) x ... where each operator op1, op2, etc. is either +addition, subtraction, multiplication, or division (+, -, *, or /). For +example, with x = 3, we might write 3 * 3 / 3 + 3 - 3 which is a value of 3. + +When writing such an expression, we adhere to the following conventions: + +The division operator (/) returns rational numbers. +There are no parentheses placed anywhere. +We use the usual order of operations: multiplication and division happens before +addition and subtraction. +It's not allowed to use the unary negation operator (-). For example, "x - x" +is a valid expression as it only uses subtraction, but "-x + x" is not because +it uses negation. +We would like to write an expression with the least number of operators such +that the expression equals the given target. Return the least number of +operators used. + + +Example 1: +Input: x = 3, target = 19 +Output: 5 +Explanation: 3 * 3 + 3 * 3 + 3 / 3. The expression contains 5 operations. + +Example 2: +Input: x = 5, target = 501 +Output: 8 +Explanation: 5 * 5 * 5 * 5 - 5 * 5 * 5 + 5 / 5. The expression contains 8 +operations. + +Example 3: +Input: x = 100, target = 100000000 +Output: 3 +Explanation: 100 * 100 * 100 * 100. The expression contains 3 operations. + + +Note: +2 <= x <= 100 +1 <= target <= 2 * 10^8 +""" +from functools import lru_cache + + +class Solution: + def leastOpsExpressTarget(self, x: int, target: int) -> int: + """ + x/x is 1 + x * x is power 2 + + target = a_n * x^n + a_{n-1} * x^{n-1} + ... + a_1 * x^1 + a_0 * x/x + + To make target divisible, it can be target - a0 or target + (x^1 - a0) + """ + return self.dfs(target, x, 0) - 1 + + @lru_cache(maxsize=None) + def dfs(self, target, x, power): + """ + power: power, pow(x, power) + """ + if target == 0: + return 0 + + if target == 1: + return self.ops(power) + + d, r = target // x, target % x + ret = r * self.ops(power) + self.dfs(d, x, power + 1) + # either -r or +(x-r) + if r != 0: + ret2 = (x - r) * self.ops(power) + self.dfs(d + 1, x, power + 1) + ret = min(ret, ret2) + + return ret + + def ops(self, power): + """ + number of ops required + + + x/x + + x + + x * x + + x * x * x + """ + if power == 0: + return 2 + else: + return power + + +if __name__ == "__main__": + assert Solution().leastOpsExpressTarget(3, 19) == 5 + assert Solution().leastOpsExpressTarget(5, 501) == 8 + assert Solution().leastOpsExpressTarget(2, 125046) == 50 diff --git a/965 Univalued Binary Tree.py b/965 Univalued Binary Tree.py new file mode 100644 index 0000000..ad0c84e --- /dev/null +++ b/965 Univalued Binary Tree.py @@ -0,0 +1,45 @@ +#!/usr/bin/python3 +""" +A binary tree is univalued if every node in the tree has the same value. + +Return true if and only if the given tree is univalued. + + + +Example 1: + + +Input: [1,1,1,1,1,null,1] +Output: true +Example 2: + + +Input: [2,2,2,5,2] +Output: false + + +Note: + +The number of nodes in the given tree will be in the range [1, 100]. +Each node's value will be an integer in the range [0, 99]. +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def isUnivalTree(self, root: TreeNode) -> bool: + return self.dfs(root, root.val if root else None) + + def dfs(self, node, val) -> bool: + if not node: + return True + if node.val != val: + return False + + return self.dfs(node.left, val) and self.dfs(node.right, val) diff --git a/967 Numbers With Same Consecutive Differences.py b/967 Numbers With Same Consecutive Differences.py new file mode 100644 index 0000000..9ce7409 --- /dev/null +++ b/967 Numbers With Same Consecutive Differences.py @@ -0,0 +1,70 @@ +#!/usr/bin/python3 +""" +Return all non-negative integers of length N such that the absolute difference +between every two consecutive digits is K. + +Note that every number in the answer must not have leading zeros except for the +number 0 itself. For example, 01 has one leading zero and is invalid, but 0 is valid. + +You may return the answer in any order. + + + +Example 1: + +Input: N = 3, K = 7 +Output: [181,292,707,818,929] +Explanation: Note that 070 is not a valid number, because it has leading zeroes. +Example 2: + +Input: N = 2, K = 1 +Output: [10,12,21,23,32,34,43,45,54,56,65,67,76,78,87,89,98] + + +Note: + +1 <= N <= 9 +0 <= K <= 9 +""" +from typing import List + + +class Solution: + def __init__(self): + self.cache = {} + + def numsSameConsecDiff(self, N: int, K: int) -> List[int]: + """ + dfs + memoization + """ + ret = [] + for i in range(1, 10): + ret.extend(self.dfs(i, N, K)) + + if N == 1: + ret.append([0]) # special case + + return list( + map(lambda x: int("".join(map(str, x))), ret) + ) + + def dfs(self, start: int, N: int, K: int) -> List[List[int]]: + if (start, N, K) not in self.cache: + ret = [] + if N == 1: + ret = [[start]] + elif N > 1: + if start + K <= 9: + for e in self.dfs(start + K, N - 1, K): + ret.append([start] + e) + if start - K >= 0 and K != 0: # special case + for e in self.dfs(start - K, N - 1, K): + ret.append([start] + e) + + self.cache[start, N, K] = ret + + return self.cache[start, N, K] + + +if __name__ == "__main__": + Solution().numsSameConsecDiff(3, 7) == [181,292,707,818,929] diff --git a/968 Binary Tree Cameras.py b/968 Binary Tree Cameras.py new file mode 100644 index 0000000..31c40d9 --- /dev/null +++ b/968 Binary Tree Cameras.py @@ -0,0 +1,107 @@ +#!/usr/bin/python3 +""" +Given a binary tree, we install cameras on the nodes of the tree. + +Each camera at a node can monitor its parent, itself, and its immediate children. + +Calculate the minimum number of cameras needed to monitor all nodes of the tree. + + + +Example 1: + + +Input: [0,0,null,0,0] +Output: 1 +Explanation: One camera is enough to monitor all nodes if placed as shown. +Example 2: + + +Input: [0,0,null,0,null,0,null,null,0] +Output: 2 +Explanation: At least two cameras are needed to monitor all nodes of the tree. +The above image shows one of the valid configurations of camera placement. + +Note: + +The number of nodes in the given tree will be in the range [1, 1000]. +Every node has value 0. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.covered = {None} + self.cnt = 0 + + def minCameraCover(self, root: TreeNode) -> int: + """ + Greedy? + Bottom up, cover leaf's parent is strictly better than cover leaf + """ + self.dfs(root, None) + if root not in self.covered: + self.covered.add(root) + self.cnt += 1 + + return self.cnt + + + def dfs(self, node, pi): + """ + post order + rely on the parents to cover it + """ + if not node: + return + + self.dfs(node.left, node) + self.dfs(node.right, node) + if node.left not in self.covered or node.right not in self.covered: + self.cnt += 1 + self.covered.add(node.left) + self.covered.add(node.right) + self.covered.add(node) + self.covered.add(pi) + + +class SolutionErrror: + def __init__(self): + self.covered = set() + + def minCameraCover(self, root: TreeNode) -> int: + """ + Greedy? + Top-down, no good. + Bottom up, cover leaf's parent is strictly better than cover leaf + """ + dummy = TreeNode(0) + dummy.left = root + self.dfs(root, dummy) + self.covered.discard(dummy) # swallow KeyError + return len(self.covered) + + def dfs(self, node, pi): + """ + post order + """ + if not node: + return + + self.dfs(node.left, node) + self.dfs(node.right, node) + # post oder + if ( + (not node.left or node.left in self.covered) and + (not node.right or node.right in self.covered) + ): + self.covered.add(pi) + return diff --git a/971 Flip Binary Tree To Match Preorder Traversal.py b/971 Flip Binary Tree To Match Preorder Traversal.py new file mode 100644 index 0000000..7d2759f --- /dev/null +++ b/971 Flip Binary Tree To Match Preorder Traversal.py @@ -0,0 +1,81 @@ +#!/usr/bin/python3 +""" +Given a binary tree with N nodes, each node has a different value from +{1, ..., N}. + +A node in this binary tree can be flipped by swapping the left child and the +right child of that node. + +Consider the sequence of N values reported by a preorder traversal starting from +the root. Call such a sequence of N values the voyage of the tree. + +(Recall that a preorder traversal of a node means we report the current node's +value, then preorder-traverse the left child, then preorder-traverse the right +child.) + +Our goal is to flip the least number of nodes in the tree so that the voyage of +the tree matches the voyage we are given. + +If we can do so, then return a list of the values of all nodes flipped. You may +return the answer in any order. + +If we cannot do so, then return the list [-1]. + +Example 1: + +Input: root = [1,2], voyage = [2,1] +Output: [-1] +Example 2: + +Input: root = [1,2,3], voyage = [1,3,2] +Output: [1] +Example 3: + +Input: root = [1,2,3], voyage = [1,2,3] +Output: [] + +Note: + +1 <= N <= 100 +""" +from typing import List + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.ret = [] + self.i = 0 # currently scanning index of voyage + + def flipMatchVoyage(self, root: TreeNode, voyage: List[int]) -> List[int]: + """ + match the voyage + Flip the least number of nodes? There is only one answer + """ + self.dfs(root, voyage) + return self.ret + + def dfs(self, node, voyage): + if not node: + return + + if node.val != voyage[self.i]: + self.ret = [-1] + return + + self.i += 1 + if node.left and node.right and node.left.val != voyage[self.i]: + # flip left and right + self.ret.append(node.val) + self.dfs(node.right, voyage) + self.dfs(node.left, voyage) + else: + self.dfs(node.left, voyage) + self.dfs(node.right, voyage) diff --git a/973 K Closest Points to Origin.py b/973 K Closest Points to Origin.py new file mode 100644 index 0000000..31edddf --- /dev/null +++ b/973 K Closest Points to Origin.py @@ -0,0 +1,39 @@ +#!/usr/bin/python3 +""" +We have a list of points on the plane. Find the K closest points to the origin +(0, 0). + +(Here, the distance between two points on a plane is the Euclidean distance.) + +You may return the answer in any order. The answer is guaranteed to be unique +(except for the order that it is in.) + +Example 1: + +Input: points = [[1,3],[-2,2]], K = 1 +Output: [[-2,2]] +Explanation: +The distance between (1, 3) and the origin is sqrt(10). +The distance between (-2, 2) and the origin is sqrt(8). +Since sqrt(8) < sqrt(10), (-2, 2) is closer to the origin. +We only want the closest K = 1 points from the origin, so the answer is just +[[-2,2]]. +Example 2: + +Input: points = [[3,3],[5,-1],[-2,4]], K = 2 +Output: [[3,3],[-2,4]] +(The answer [[-2,4],[3,3]] would also be accepted.) + +Note: + +1 <= K <= points.length <= 10000 +-10000 < points[i][0] < 10000 +-10000 < points[i][1] < 10000 +""" +from typing import List +import heapq + + +class Solution: + def kClosest(self, points: List[List[int]], K: int) -> List[List[int]]: + return heapq.nsmallest(K, points, key=lambda x: x[0]**2 + x[1]**2) diff --git a/974 Subarray Sums Divisible by K.py b/974 Subarray Sums Divisible by K.py new file mode 100644 index 0000000..23e6e90 --- /dev/null +++ b/974 Subarray Sums Divisible by K.py @@ -0,0 +1,62 @@ +#!/usr/bin/python3 +""" +Given an array A of integers, return the number of (contiguous, non-empty) +subarrays that have a sum divisible by K. + +Example 1: + +Input: A = [4,5,0,-2,-3,1], K = 5 +Output: 7 +Explanation: There are 7 subarrays with a sum divisible by K = 5: +[4, 5, 0, -2, -3, 1], [5], [5, 0], [5, 0, -2, -3], [0], [0, -2, -3], [-2, -3] + +Note: + +1 <= A.length <= 30000 +-10000 <= A[i] <= 10000 +2 <= K <= 10000 +""" +from typing import List +from collections import defaultdict + + +class Solution: + def subarraysDivByK_2(self, A: List[int], K: int) -> int: + """ + count the prefix sum mod K + nC2 + """ + prefix_sum = 0 + counter = defaultdict(int) + counter[0] = 1 # important trival case + for a in A: + prefix_sum += a + prefix_sum %= K + counter[prefix_sum] += 1 + + ret = 0 + for v in counter.values(): + ret += v * (v-1) // 2 + + return ret + + def subarraysDivByK(self, A: List[int], K: int) -> int: + """ + Prefix sum + O(N^2) + How to optimize? + Mapping to prefix sum to count + Divide: Translate divisible by K into mod. + prefix sum has to be MOD by K. + """ + prefix_sum = 0 + counter = defaultdict(int) + counter[0] = 1 # trival case. !important + ret = 0 + for a in A: + prefix_sum += a + prefix_sum %= K + ret += counter[prefix_sum] # count of previously matching prefix sum + counter[prefix_sum] += 1 + + return ret diff --git a/976 Largest Perimeter Triangle.py b/976 Largest Perimeter Triangle.py new file mode 100644 index 0000000..84c7f64 --- /dev/null +++ b/976 Largest Perimeter Triangle.py @@ -0,0 +1,44 @@ +#!/usr/bin/python3 +""" +Given an array A of positive lengths, return the largest perimeter of a triangle +with non-zero area, formed from 3 of these lengths. + +If it is impossible to form any triangle of non-zero area, return 0. + +Example 1: + +Input: [2,1,2] +Output: 5 +Example 2: + +Input: [1,2,1] +Output: 0 +Example 3: + +Input: [3,2,3,4] +Output: 10 +Example 4: + +Input: [3,6,2,3] +Output: 8 + + +Note: + +3 <= A.length <= 10000 +1 <= A[i] <= 10^6 +""" +from typing import List + + +class Solution: + def largestPerimeter(self, A: List[int]) -> int: + """ + sort and scanning from right + """ + A.sort() + for i in range(len(A) - 3, -1, -1): + if A[i] + A[i+1] > A[i+2]: + return sum(A[i:i+3]) + else: + return 0 diff --git a/977 Squares of a Sorted Array.py b/977 Squares of a Sorted Array.py new file mode 100644 index 0000000..204bd43 --- /dev/null +++ b/977 Squares of a Sorted Array.py @@ -0,0 +1,43 @@ +#!/usr/bin/python3 +""" +Given an array of integers A sorted in non-decreasing order, return an array of +the squares of each number, also in sorted non-decreasing order. + +Example 1: + +Input: [-4,-1,0,3,10] +Output: [0,1,9,16,100] +Example 2: + +Input: [-7,-3,2,3,11] +Output: [4,9,9,49,121] + + +Note: + +1 <= A.length <= 10000 +-10000 <= A[i] <= 10000 +A is sorted in non-decreasing order. +""" +from typing import List +from collections import deque + + +class Solution: + def sortedSquares(self, A: List[int]) -> List[int]: + """ + started from two ends + """ + n = len(A) + ret = deque() + lo = 0 + hi = n + while lo < hi: + if A[lo] ** 2 < A[hi - 1] ** 2: + ret.appendleft(A[hi - 1] ** 2) + hi -= 1 + else: + ret.appendleft(A[lo] ** 2) + lo += 1 + + return list(ret) diff --git a/978 Longest Turbulent Subarray.py b/978 Longest Turbulent Subarray.py new file mode 100644 index 0000000..f5b5491 --- /dev/null +++ b/978 Longest Turbulent Subarray.py @@ -0,0 +1,66 @@ +#!/usr/bin/python3 +""" +A subarray A[i], A[i+1], ..., A[j] of A is said to be turbulent if and only if: + +For i <= k < j, A[k] > A[k+1] when k is odd, and A[k] < A[k+1] when k is even; +OR, for i <= k < j, A[k] > A[k+1] when k is even, and A[k] < A[k+1] when k is +odd. +That is, the subarray is turbulent if the comparison sign flips between each +adjacent pair of elements in the subarray. + +Return the length of a maximum size turbulent subarray of A. + +Example 1: + +Input: [9,4,2,10,7,8,8,1,9] +Output: 5 +Explanation: (A[1] > A[2] < A[3] > A[4] < A[5]) +Example 2: + +Input: [4,8,12,16] +Output: 2 +Example 3: + +Input: [100] +Output: 1 + +Note: + +1 <= A.length <= 40000 +0 <= A[i] <= 10^9 +""" +from typing import List + + +class Solution: + def maxTurbulenceSize(self, A: List[int]) -> int: + """ + scan + """ + flag = None # 0: expecting <, 1: expecting > + ret = 1 + cur = 1 + for i in range(len(A)-1): + if A[i] == A[i+1]: + flag = None + cur = 1 + elif A[i] > A[i+1]: + if flag is None or flag == 1: + cur += 1 + ret = max(ret, cur) + else: + cur = 2 + flag = 0 + else: # < + if flag is None or flag == 0: + cur += 1 + ret = max(ret, cur) + else: + cur = 2 + flag = 1 + + return ret + + +if __name__ == "__main__": + assert Solution().maxTurbulenceSize([9,4,2,10,7,8,8,1,9]) == 5 diff --git a/979 Distribute Coins in Binary Tree.py b/979 Distribute Coins in Binary Tree.py new file mode 100644 index 0000000..51e17fa --- /dev/null +++ b/979 Distribute Coins in Binary Tree.py @@ -0,0 +1,66 @@ +#!/usr/bin/python3 +""" +Given the root of a binary tree with N nodes, each node in the tree has node.val coins, and there are N coins total. + +In one move, we may choose two adjacent nodes and move one coin from one node to another. (The move may be from parent to child, or from child to parent.) + +Return the number of moves required to make every node have exactly one coin. + +Example 1: + +Input: [3,0,0] +Output: 2 +Explanation: From the root of the tree, we move one coin to its left child, and + one coin to its right child. +Example 2: + +Input: [0,3,0] +Output: 3 +Explanation: From the left child of the root, we move two coins to the root +[taking two moves]. Then, we move one coin from the root of the tree to the +right child. +Example 3: + +Input: [1,0,2] +Output: 2 +Example 4: + +Input: [1,0,0,null,3] +Output: 4 + +Note: +1<= N <= 100 +0 <= node.val <= N +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.ret = 0 + + def distributeCoins(self, root: TreeNode) -> int: + """ + dfs + """ + self.demand(root) + return self.ret + + def demand(self, node) -> int: + if not node: + return 0 + + demand_l = self.demand(node.left) + demand_r = self.demand(node.right) + demand_m = 1 - node.val + # attribut the move to the node required + demand = demand_l + demand_r + demand_m + self.ret += abs(demand) + return demand diff --git a/981 Time Based Key-Value Store.py b/981 Time Based Key-Value Store.py new file mode 100644 index 0000000..28e8297 --- /dev/null +++ b/981 Time Based Key-Value Store.py @@ -0,0 +1,89 @@ +#!/usr/bin/python3 +""" +Create a timebased key-value store class TimeMap, that supports two operations. + +1. set(string key, string value, int timestamp) + +Stores the key and value, along with the given timestamp. +2. get(string key, int timestamp) + +Returns a value such that set(key, value, timestamp_prev) was called previously, +with timestamp_prev <= timestamp. +If there are multiple such values, it returns the one with the largest +timestamp_prev. +If there are no values, it returns the empty string (""). + + +Example 1: + +Input: inputs = ["TimeMap","set","get","get","set","get","get"], inputs = + [[],["foo","bar",1],["foo",1],["foo",3],["foo","bar2",4],["foo",4],["foo",5]] +Output: [null,null,"bar","bar",null,"bar2","bar2"] +Explanation: +TimeMap kv; +kv.set("foo", "bar", 1); // store the key "foo" and value "bar" along with +timestamp = 1 +kv.get("foo", 1); // output "bar" +kv.get("foo", 3); // output "bar" since there is no value corresponding to foo +at timestamp 3 and timestamp 2, then the only value is at timestamp 1 ie "bar" +kv.set("foo", "bar2", 4); +kv.get("foo", 4); // output "bar2" +kv.get("foo", 5); //output "bar2" + +Example 2: + +Input: inputs = ["TimeMap","set","set","get","get","get","get","get"], inputs = +[[],["love","high",10],["love","low",20],["love",5],["love",10],["love",15], +["love",20],["love",25]] +Output: [null,null,null,"","high","high","low","low"] + + +Note: + +All key/value strings are lowercase. +All key/value strings have length in the range [1, 100] +The timestamps for all TimeMap.set operations are strictly increasing. +1 <= timestamp <= 10^7 +TimeMap.set and TimeMap.get functions will be called a total of 120000 times +combined) per test case. +""" +import bisect +from collections import defaultdict + + +class TimeMap: + + def __init__(self): + """ + Initialize your data structure here. + Looks like Cassandra + Heap? Largest timestamp_prev <= timestamp + BST + Bineary search + """ + self.m = defaultdict(list) + + def set(self, key: str, value: str, timestamp: int) -> None: + n = (timestamp, value) + bisect.insort(self.m[key], n) + + def get(self, key: str, timestamp: int) -> str: + if key not in self.m: + return "" + + # find the largest v, s.t. v <= t + lst = self.m[key] + i = bisect.bisect(lst, (timestamp, "")) + if i < len(lst) and lst[i][0] == timestamp: + return lst[i][1] + i -= 1 + if i >= 0: + return lst[i][1] + + return "" + + +# Your TimeMap object will be instantiated and called as such: +# obj = TimeMap() +# obj.set(key,value,timestamp) +# param_2 = obj.get(key,timestamp) diff --git a/983 Minimum Cost For Tickets.py b/983 Minimum Cost For Tickets.py new file mode 100644 index 0000000..c917f0b --- /dev/null +++ b/983 Minimum Cost For Tickets.py @@ -0,0 +1,125 @@ +#!/usr/bin/python3 +""" +In a country popular for train travel, you have planned some train travelling +one year in advance. The days of the year that you will travel is given as an +array days. Each day is an integer from 1 to 365. + +Train tickets are sold in 3 different ways: + +a 1-day pass is sold for costs[0] dollars; +a 7-day pass is sold for costs[1] dollars; +a 30-day pass is sold for costs[2] dollars. +The passes allow that many days of consecutive travel. For example, if we get +a 7-day pass on day 2, then we can travel for 7 days: day 2, 3, 4, 5, 6, 7, and +8. + +Return the minimum number of dollars you need to travel every day in the given +list of days. + +Example 1: + +Input: days = [1,4,6,7,8,20], costs = [2,7,15] +Output: 11 +Explanation: +For example, here is one way to buy passes that lets you travel your travel plan: +On day 1, you bought a 1-day pass for costs[0] = $2, which covered day 1. +On day 3, you bought a 7-day pass for costs[1] = $7, which covered days 3, 4, ..., 9. +On day 20, you bought a 1-day pass for costs[0] = $2, which covered day 20. +In total you spent $11 and covered all the days of your travel. +Example 2: + +Input: days = [1,2,3,4,5,6,7,8,9,10,30,31], costs = [2,7,15] +Output: 17 +Explanation: +For example, here is one way to buy passes that lets you travel your travel plan: +On day 1, you bought a 30-day pass for costs[2] = $15 which covered days 1, 2, ..., 30. +On day 31, you bought a 1-day pass for costs[0] = $2 which covered day 31. +In total you spent $17 and covered all the days of your travel. + +Note: + +1 <= days.length <= 365 +1 <= days[i] <= 365 +days is in strictly increasing order. +costs.length == 3 +1 <= costs[i] <= 1000 +""" +from typing import List + + +class Solution: + def mincostTickets(self, days: List[int], costs: List[int]) -> int: + """ + Iterate backward. + + Why does iterate backward work? Currrent min depends on the future mins + + Let F[i] be the min cost at day i, covering all trips from i to 365 + F[i] = min(F[i + d] + c for d, c in zip([1, 7, 30], costs)) + If day i is not travel day, then wait until i + k that is a travel day + + O(365) + """ + F = [float("inf") for _ in range(366 + 30)] + for i in range(366, 366 + 30): + F[i] = 0 + + days_set = set(days) + for i in range(365, 0, -1): + if i not in days_set: + F[i] = F[i+1] + else: + F[i] = min( + c + F[i+d] + for d, c in zip([1, 7, 30], costs) + ) + + return F[1] + + def mincostTickets_error(self, days: List[int], costs: List[int]) -> int: + """ + Iterate backward on days + O(30 * |days|) + + Iterate throughout the year is more elegant + Need buffer day + """ + n = len(days) + F = [float("inf") for _ in range(n)] + F[-1] = costs[0] + for i in range(n-2, -1, -1): + for j in range(i+1, n): + delta = days[j] - days[i] + if delta <= 1: + F[i] = min(F[i], costs[0] + F[j]) + if delta <= 7: + F[i] = min(F[i], costs[1] + F[j]) + if delta <= 30: + F[i] = min(F[i], costs[2] + F[j]) + else: + break + return F[0] + + def mincostTickets_error(self, days: List[int], costs: List[int]) -> int: + """ + dp + Let F[i] be the min cost at day i, covering all trips from day 1 to i + For 30-day ticiekt, iterate forward all 30 days? + How to express idle date? Same as previous. + + Why does iterate forward fail? Because future min does not depends on the + current min. Current higher cost may contribtue to future lower cost. + """ + F = [float("inf") for _ in range(365 + 1)] + F[0] = 0 + days_set = set(days) + for i in range(1, 366): + if i not in days_set: + F[i] = F[i-1] + else: + # iterate forward does not work + F[i] = min(F[i], F[i-1] + costs[0]) + + +if __name__ == "__main__": + assert Solution().mincostTickets([1,4,6,7,8,20], [2,7,15]) == 11 diff --git a/985 Sum of Even Numbers After Queries.py b/985 Sum of Even Numbers After Queries.py new file mode 100644 index 0000000..a7d6072 --- /dev/null +++ b/985 Sum of Even Numbers After Queries.py @@ -0,0 +1,53 @@ +#!/usr/bin/python3 +""" +We have an array A of integers, and an array queries of queries. + +For the i-th query val = queries[i][0], index = queries[i][1], we add val to +A[index]. Then, the answer to the i-th query is the sum of the even values of +A. + +(Here, the given index = queries[i][1] is a 0-based index, and each query +permanently modifies the array A.) + +Return the answer to all queries. Your answer array should have answer[i] as +the answer to the i-th query. + +Example 1: + +Input: A = [1,2,3,4], queries = [[1,0],[-3,1],[-4,0],[2,3]] +Output: [8,6,2,4] +Explanation: +At the beginning, the array is [1,2,3,4]. +After adding 1 to A[0], the array is [2,2,3,4], and the sum of even values is 2 + 2 + 4 = 8. +After adding -3 to A[1], the array is [2,-1,3,4], and the sum of even values is 2 + 4 = 6. +After adding -4 to A[0], the array is [-2,-1,3,4], and the sum of even values is -2 + 4 = 2. +After adding 2 to A[3], the array is [-2,-1,3,6], and the sum of even values is -2 + 6 = 4. + +Note: + +1 <= A.length <= 10000 +-10000 <= A[i] <= 10000 +1 <= queries.length <= 10000 +-10000 <= queries[i][0] <= 10000 +0 <= queries[i][1] < A.length +""" +from typing import List + + +class Solution: + def sumEvenAfterQueries(self, A: List[int], queries: List[List[int]]) -> List[int]: + """ + maintain a sum + """ + cur_sum = sum(filter(lambda x: x % 2 == 0, A)) + ret = [] + for val, idx in queries: + prev = A[idx] + if prev % 2 == 0: + cur_sum -= prev + A[idx] += val + if A[idx] % 2 == 0: + cur_sum += A[idx] + ret.append(cur_sum) + + return ret diff --git a/986 Interval List Intersections.py b/986 Interval List Intersections.py new file mode 100644 index 0000000..e1983b8 --- /dev/null +++ b/986 Interval List Intersections.py @@ -0,0 +1,87 @@ +#!/usr/bin/python3 +""" +Given two lists of closed intervals, each list of intervals is pairwise disjoint +and in sorted order. + +Return the intersection of these two interval lists. + +(Formally, a closed interval [a, b] (with a <= b) denotes the set of real +numbers x with a <= x <= b. The intersection of two closed intervals is a set +of real numbers that is either empty, or can be represented as a closed interval. +For example, the intersection of [1, 3] and [2, 4] is [2, 3].) + +Example 1: + +Input: A = [[0,2],[5,10],[13,23],[24,25]], B = [[1,5],[8,12],[15,24],[25,26]] +Output: [[1,2],[5,5],[8,10],[15,23],[24,24],[25,25]] +Reminder: The inputs and the desired output are lists of Interval objects, and not arrays or lists. + +Note: +0 <= A.length < 1000 +0 <= B.length < 1000 +0 <= A[i].start, A[i].end, B[i].start, B[i].end < 10^9 +""" +from typing import List + + +# Definition for an interval. +class Interval: + def __init__(self, s=0, e=0): + self.start = s + self.end = e + + +class Solution: + def intervalIntersection(self, A: List[Interval], B: List[Interval]) -> List[Interval]: + """ + Among the given intervals, consider the interval A[0] with the smallest + endpoint. (Without loss of generality, this interval occurs in array A.) + Then, among the intervals in array B, A[0] can only intersect one such + interval in array B. (If two intervals in B intersect A[0], then they + both share the endpoint of A[0] -- but intervals in B are disjoint, which + is a contradiction.) + + If A[0] has the smallest endpoint, it can only intersect B[0]. After, we + can discard A[0] since it cannot intersect anything else. + + merge by checking max starts and min ends + pop by ends + """ + i, j = 0, 0 + m, n = len(A), len(B) + ret = [] + while i < m and j < n: + lo = max(A[i].start, B[j].start) + hi = min(A[i].end, B[j].end) + if lo <= hi: + ret.append(Interval(lo, hi)) + if A[i].end > B[j].end: + j += 1 + else: + i += 1 + + return ret + + def intervalIntersection_complex(self, A: List[Interval], B: List[Interval]) -> List[Interval]: + """ + like merge + """ + ret = [] + i = 0 + j = 0 + m, n = len(A), len(B) + while i < m and j < n: + a = A[i] + b = B[j] + if b.start <= a.end <= b.end: + ret.append(Interval(max(a.start, b.start), a.end)) + i += 1 + elif a.start <= b.end <= a.end: + ret.append(Interval(max(a.start, b.start), b.end)) + j += 1 + else: + if a.end < b.start: + i += 1 + else: + j += 1 + return ret diff --git a/987 Vertical Order Traversal of a Binary Tree.py b/987 Vertical Order Traversal of a Binary Tree.py new file mode 100644 index 0000000..4771b93 --- /dev/null +++ b/987 Vertical Order Traversal of a Binary Tree.py @@ -0,0 +1,76 @@ +#!/usr/bin/python3 +""" +Given a binary tree, return the vertical order traversal of its nodes values. + +For each node at position (X, Y), its left and right children respectively will +be at positions (X-1, Y-1) and (X+1, Y-1). + +Running a vertical line from X = -infinity to X = +infinity, whenever the +vertical line touches some nodes, we report the values of the nodes in order +from top to bottom (decreasing Y coordinates). + +If two nodes have the same position, then the value of the node that is +reported first is the value that is smaller. + +Return an list of non-empty reports in order of X coordinate. Every report +will have a list of values of nodes. + +Example 1: + +Input: [3,9,20,null,null,15,7] +Output: [[9],[3,15],[20],[7]] +Explanation: +Without loss of generality, we can assume the root node is at position (0, 0): +Then, the node with value 9 occurs at position (-1, -1); +The nodes with values 3 and 15 occur at positions (0, 0) and (0, -2); +The node with value 20 occurs at position (1, -1); +The node with value 7 occurs at position (2, -2). +Example 2: + +Input: [1,2,3,4,5,6,7] +Output: [[4],[2],[1,5,6],[3],[7]] +Explanation: +The node with value 5 and the node with value 6 have the same position according to the given scheme. +However, in the report "[1,5,6]", the node value of 5 comes first since 5 is smaller than 6. + + +Note: + +The tree will have between 1 and 1000 nodes. +Each node's value will be between 0 and 1000. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +from collections import defaultdict + + +class Solution: + def __init__(self): + self.mp = defaultdict(list) # element (-Y, val) # from left to right, top to bottom + + def verticalTraversal(self, root: TreeNode) -> List[List[int]]: + self.dfs(root, 0, 0) + ret = [] + mn = min(self.mp) + mx = max(self.mp) + for i in range(mn, mx+1): + ret.append([ + val + for _, val in sorted(self.mp[i]) + ]) + return ret + + def dfs(self, node, x, y): + if not node: + return + self.mp[x].append((-y, node.val)) + self.dfs(node.left, x-1, y-1) + self.dfs(node.right, x+1, y-1) diff --git a/988 Smallest String Starting From Leaf.py b/988 Smallest String Starting From Leaf.py new file mode 100644 index 0000000..9312f34 --- /dev/null +++ b/988 Smallest String Starting From Leaf.py @@ -0,0 +1,74 @@ +#!/usr/bin/python3 +""" +Given the root of a binary tree, each node has a value from 0 to 25 representing +the letters 'a' to 'z': a value of 0 represents 'a', a value of 1 represents +'b', and so on. + +Find the lexicographically smallest string that starts at a leaf of this tree +and ends at the root. + +(As a reminder, any shorter prefix of a string is lexicographically smaller: for +example, "ab" is lexicographically smaller than "aba". A leaf of a node is a +node that has no children.) + +Example 1: + +Input: [0,1,2,3,4,3,4] +Output: "dba" +Example 2: + +Input: [25,1,3,1,3,0,2] +Output: "adz" +Example 3: + +Input: [2,2,1,null,1,0,null,0] +Output: "abc" + +Note: +The number of nodes in the given tree will be between 1 and 8500. +Each node in the tree will have a value between 0 and 25. +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +from typing import Tuple +from collections import deque + + +class Solution: + def __init__(self): + self.mn: Tuple[int] = None + + def smallestFromLeaf(self, root: TreeNode) -> str: + """ + dfs + """ + self.dfs(root, deque()) + if not self.mn: + return "" + return "".join( + chr(e + ord("a")) + for e in self.mn + ) + + def dfs(self, node, cur_deque): + if not node: + return + + cur_deque.appendleft(node.val) + if not node.left and not node.right: + t = tuple(cur_deque) + if not self.mn or t < self.mn: + self.mn = t + else: + self.dfs(node.left, cur_deque) + self.dfs(node.right, cur_deque) + # need to pop at the end + cur_deque.popleft() diff --git a/989 Add to Array-Form of Integer.py b/989 Add to Array-Form of Integer.py new file mode 100644 index 0000000..2cb8fbb --- /dev/null +++ b/989 Add to Array-Form of Integer.py @@ -0,0 +1,51 @@ +#!/usr/bin/python3 +""" +For a non-negative integer X, the array-form of X is an array of its digits in +left to right order. For example, if X = 1231, then the array form is [1,2,3,1]. + +Given the array-form A of a non-negative integer X, return the array-form of the integer X+K. + + + +Example 1: + +Input: A = [1,2,0,0], K = 34 +Output: [1,2,3,4] +Explanation: 1200 + 34 = 1234 +Example 2: + +Input: A = [2,7,4], K = 181 +Output: [4,5,5] +Explanation: 274 + 181 = 455 +Example 3: + +Input: A = [2,1,5], K = 806 +Output: [1,0,2,1] +Explanation: 215 + 806 = 1021 +Example 4: + +Input: A = [9,9,9,9,9,9,9,9,9,9], K = 1 +Output: [1,0,0,0,0,0,0,0,0,0,0] +Explanation: 9999999999 + 1 = 10000000000 +""" +from typing import List +from collections import deque + + +class Solution: + def addToArrayForm(self, A: List[int], K: int) -> List[int]: + """ + carry + """ + carry = K + for i in range(len(A)-1, -1, -1): + A[i] += carry + carry = A[i] // 10 + A[i] %= 10 + + head = deque() + while carry: + head.appendleft(carry % 10) + carry //= 10 + + return list(head) + A diff --git a/990 Satisfiability of Equality Equations.py b/990 Satisfiability of Equality Equations.py new file mode 100644 index 0000000..d2242fb --- /dev/null +++ b/990 Satisfiability of Equality Equations.py @@ -0,0 +1,83 @@ +#!/usr/bin/python3 +""" +Given an array equations of strings that represent relationships between +variables, each string equations[i] has length 4 and takes one of two different +forms: "a==b" or "a!=b". Here, a and b are lowercase letters (not necessarily +different) that represent one-letter variable names. + +Return true if and only if it is possible to assign integers to variable names +so as to satisfy all the given equations. + + + +Example 1: + +Input: ["a==b","b!=a"] +Output: false +Explanation: If we assign say, a = 1 and b = 1, then the first equation is +satisfied, but not the second. There is no way to assign the variables to +satisfy both equations. +Example 2: + +Input: ["b==a","a==b"] +Output: true +Explanation: We could assign a = 1 and b = 1 to satisfy both equations. +Example 3: + +Input: ["a==b","b==c","a==c"] +Output: true +Example 4: + +Input: ["a==b","b!=c","c==a"] +Output: false +Example 5: + +Input: ["c==c","b==d","x!=z"] +Output: true + +Note: + +1 <= equations.length <= 500 +equations[i].length == 4 +equations[i][0] and equations[i][3] are lowercase letters +equations[i][1] is either '=' or '!' +equations[i][2] is '=' +""" +from typing import List + + +class DisjointSet: + def __init__(self): + self.pi = {} + + def union(self, x, y): + self.pi[self.find(x)] = self.find(y) + + def find(self, x): + if x not in self.pi: + self.pi[x] = x + elif self.pi[x] != x: + self.pi[x] = self.find(self.pi[x]) + return self.pi[x] + +class Solution: + def equationsPossible(self, equations: List[str]) -> bool: + """ + union find + """ + ds = DisjointSet() + neqs = [] # list of neq + for e in equations: + a = e[0] + b = e[-1] + sign = e[1:-1] + if sign == "==": + ds.union(a, b) + else: + neqs.append((a, b)) + + for a, b in neqs: + if ds.find(a) == ds.find(b): + return False + + return True diff --git a/991 Broken Calculator.py b/991 Broken Calculator.py new file mode 100644 index 0000000..8f1bc50 --- /dev/null +++ b/991 Broken Calculator.py @@ -0,0 +1,94 @@ +#!/usr/bin/python3 +""" +On a broken calculator that has a number showing on its display, we can perform +two operations: + +Double: Multiply the number on the display by 2, or; +Decrement: Subtract 1 from the number on the display. +Initially, the calculator is displaying the number X. + +Return the minimum number of operations needed to display the number Y. + + + +Example 1: + +Input: X = 2, Y = 3 +Output: 2 +Explanation: Use double operation and then decrement operation {2 -> 4 -> 3}. +Example 2: + +Input: X = 5, Y = 8 +Output: 2 +Explanation: Use decrement and then double {5 -> 4 -> 8}. +Example 3: + +Input: X = 3, Y = 10 +Output: 3 +Explanation: Use double, decrement and double {3 -> 6 -> 5 -> 10}. +Example 4: + +Input: X = 1024, Y = 1 +Output: 1023 +Explanation: Use decrement operations 1023 times. + + +Note: + +1 <= X <= 10^9 +1 <= Y <= 10^9 +""" + + +class Solution: + def brokenCalc(self, X: int, Y: int) -> int: + """ + greedy + work backward + + If Y is odd, we can do only Y = Y + 1 + If Y is even, if we plus 1 to Y, then Y is odd, we need to plus another 1. + And because (Y + 1 + 1) / 2 = (Y / 2) + 1, 3 operations are more than 2. + We always choose Y / 2 if Y is even. + """ + t = 0 + while Y > X: + if Y % 2 == 0: + Y //= 2 + else: + Y += 1 + t += 1 + + return t + X - Y + + def brokenCalc_TLE(self, X: int, Y: int) -> int: + """ + BFS + """ + q = [X] + t = 0 + has_larger = False + while q: + cur_q = [] + for e in q: + if e == Y: + return t + + cur = e * 2 + if cur >= 1: + if cur > Y and not has_larger: + has_larger = True + cur_q.append(cur) + elif cur <= Y: + cur_q.append(cur) + + cur = e - 1 + if cur >= 1: + cur_q.append(cur) + q = cur_q + t += 1 + + raise + + +if __name__ == "__main__": + assert Solution().brokenCalc(2, 3) == 2 diff --git a/993 Cousins in Binary Tree.py b/993 Cousins in Binary Tree.py new file mode 100644 index 0000000..437641a --- /dev/null +++ b/993 Cousins in Binary Tree.py @@ -0,0 +1,68 @@ +#!/usr/bin/python3 +""" +In a binary tree, the root node is at depth 0, and children of each depth k node +are at depth k+1. + +Two nodes of a binary tree are cousins if they have the same depth, but have +different parents. + +We are given the root of a binary tree with unique values, and the values x and +y of two different nodes in the tree. + +Return true if and only if the nodes corresponding to the values x and y are +cousins. + +Example 1: + +Input: root = [1,2,3,4], x = 4, y = 3 +Output: false +Example 2: + +Input: root = [1,2,3,null,4,null,5], x = 5, y = 4 +Output: true +Example 3: + +Input: root = [1,2,3,null,4], x = 2, y = 3 +Output: false + +Note: + +The number of nodes in the tree will be between 2 and 100. +Each node has a unique integer value from 1 to 100. +""" + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def __init__(self): + self.pi = [] + self.depths = [] + + def isCousins(self, root: TreeNode, x: int, y: int) -> bool: + """ + need to know parent and depth + """ + self.dfs(None, root, x, 0) + self.dfs(None, root, y, 0) + if len(self.pi) != 2: + return False + return self.pi[0] != self.pi[1] and self.depths[0] == self.depths[1] + + + def dfs(self, pi, node, x, depth): + if not node: + return + + if node.val == x: + self.pi.append(pi) + self.depths.append(depth) + return + + self.dfs(node, node.left, x, depth + 1) + self.dfs(node, node.right, x, depth + 1) diff --git a/994 Rotting Oranges.py b/994 Rotting Oranges.py new file mode 100644 index 0000000..222f1aa --- /dev/null +++ b/994 Rotting Oranges.py @@ -0,0 +1,73 @@ +#!/usr/bin/python3 +""" +In a given grid, each cell can have one of three values: + +the value 0 representing an empty cell; +the value 1 representing a fresh orange; +the value 2 representing a rotten orange. +Every minute, any fresh orange that is adjacent (4-directionally) to a rotten +orange becomes rotten. + +Return the minimum number of minutes that must elapse until no cell has a fresh +orange. If this is impossible, return -1 instead. + +Example 1: + +Input: [[2,1,1],[1,1,0],[0,1,1]] +Output: 4 +Example 2: + +Input: [[2,1,1],[0,1,1],[1,0,1]] +Output: -1 +Explanation: The orange in the bottom left corner (row 2, column 0) is never +rotten, because rotting only happens 4-directionally. +Example 3: + +Input: [[0,2]] +Output: 0 +Explanation: Since there are already no fresh oranges at minute 0, the answer +is just 0. + +Note: +1 <= grid.length <= 10 +1 <= grid[0].length <= 10 +grid[i][j] is only 0, 1, or 2. +""" +from typing import List + + +dirs = ((0, -1), (0, 1), (-1, 0), (1, 0)) + + +class Solution: + def orangesRotting(self, grid: List[List[int]]) -> int: + """ + maintain a q for the newly rotten + """ + m, n = len(grid), len(grid[0]) + q = [] + for i in range(m): + for j in range(n): + if grid[i][j] == 2: + q.append((i, j)) + + t = -1 + while q: + t += 1 + cur_q = [] + for i, j in q: + for di, dj in dirs: + I = i + di + J = j + dj + if 0 <= I < m and 0 <= J < n and grid[I][J] == 1: + grid[I][J] = 2 + cur_q.append((I, J)) + q = cur_q + + has_fresh = any( + grid[i][j] == 1 + for i in range(m) + for j in range(n) + ) + + return max(0, t) if not has_fresh else -1 diff --git a/997 Find the Town Judge.py b/997 Find the Town Judge.py new file mode 100644 index 0000000..0476350 --- /dev/null +++ b/997 Find the Town Judge.py @@ -0,0 +1,64 @@ +#!/usr/bin/python3 +""" +In a town, there are N people labelled from 1 to N. There is a rumor that one +of these people is secretly the town judge. + +If the town judge exists, then: + +The town judge trusts nobody. +Everybody (except for the town judge) trusts the town judge. +There is exactly one person that satisfies properties 1 and 2. +You are given trust, an array of pairs trust[i] = [a, b] representing that the +person labelled a trusts the person labelled b. + +If the town judge exists and can be identified, return the label of the town +judge. Otherwise, return -1. + +Example 1: + +Input: N = 2, trust = [[1,2]] +Output: 2 +Example 2: + +Input: N = 3, trust = [[1,3],[2,3]] +Output: 3 +Example 3: + +Input: N = 3, trust = [[1,3],[2,3],[3,1]] +Output: -1 +Example 4: + +Input: N = 3, trust = [[1,2],[2,3]] +Output: -1 +Example 5: + +Input: N = 4, trust = [[1,3],[1,4],[2,3],[2,4],[4,3]] +Output: 3 + + +Note: + +1 <= N <= 1000 +trust.length <= 10000 +trust[i] are all different +trust[i][0] != trust[i][1] +1 <= trust[i][0], trust[i][1] <= N +""" +from typing import List +from collections import defaultdict + + +class Solution: + def findJudge(self, N: int, trust: List[List[int]]) -> int: + """ + like the find the celebrity + """ + ingress = defaultdict(set) + egress =defaultdict(set) + for p, q in trust: + egress[p].add(q) + ingress[q].add(p) + for i in range(1, N+1): + if len(egress[i]) == 0 and len(ingress[i]) == N - 1: + return i + return -1 diff --git a/998 Maximum Binary Tree II.py b/998 Maximum Binary Tree II.py new file mode 100644 index 0000000..d7e03dc --- /dev/null +++ b/998 Maximum Binary Tree II.py @@ -0,0 +1,67 @@ +#!/usr/bin/python3 +""" +We are given the root node of a maximum tree: a tree where every node has a +value greater than any other value in its subtree. + +Just as in the previous problem, the given tree was constructed from an list A +(root = Construct(A)) recursively with the following Construct(A) routine: + +If A is empty, return null. +Otherwise, let A[i] be the largest element of A. Create a root node with value +A[i]. +The left child of root will be Construct([A[0], A[1], ..., A[i-1]]) +The right child of root will be Construct([A[i+1], A[i+2], ..., +A[A.length - 1]]) +Return root. +Note that we were not given A directly, only a root node root = Construct(A). + +Suppose B is a copy of A with the value val appended to it. It is guaranteed +that B has unique values. + +Return Construct(B). + +Example 1: +Input: root = [4,1,3,null,null,2], val = 5 +Output: [5,4,null,1,3,null,null,2] +Explanation: A = [1,4,2,3], B = [1,4,2,3,5] + +Example 2: +Input: root = [5,2,4,null,1], val = 3 +Output: [5,2,4,null,1,null,3] +Explanation: A = [2,1,5,4], B = [2,1,5,4,3] + +Example 3: +Input: root = [5,2,3,null,1], val = 4 +Output: [5,2,4,null,1,3] +Explanation: A = [2,1,5,3], B = [2,1,5,3,4] +""" + + +# Definition for a binary tree node. +class TreeNode: + def __init__(self, x): + self.val = x + self.left = None + self.right = None + + +class Solution: + def insertIntoMaxTree(self, root: TreeNode, val: int) -> TreeNode: + """ + Suppose B is a copy of A with the value val appended to it. + val is ALWAYS on the right + + insert the node in the root + Go through the example one by one. + Need to maintain the parent relationship -> return the sub-root + """ + if not root: + return TreeNode(val) + + if val > root.val: + node = TreeNode(val) + node.left = root + return node + + root.right = self.insertIntoMaxTree(root.right, val) + return root diff --git a/README.md b/README.md index 1d4b891..4986aff 100644 --- a/README.md +++ b/README.md @@ -1,22 +1,14 @@ -# LeetCode -LeetCode is a coding online judger. You may find the problem list [here](https://oj.leetcode.com/problems/). +# LeetCode ![Language](https://img.shields.io/badge/language-Python-blue.svg) ![License](https://img.shields.io/badge/license-MIT-red.svg) +LeetCode is a coding online judger. You may find the problem list here [LeetCode](https://leetcode.com/problemset/algorithms/). -###Battery Included -You can find comprehensive documentation in the source code itself. Documentation includes problem descriptions, algorithms, and test cases. - -``` - .-==============-. .-==============-. - | BATTERY | | INCLUDED | - (|+ -| (|+ -| - | | | | - '-===============' '-==============-' -``` ### Problem List -Indexed by chronological order: [Link](http://deepreader.io/LeetCode/problem_list.html). +Problem list indexed by chronological order: [Link](http://deepreader.io/LeetCode/problem_list.html). ### Feedback -Welcome to raise an issue [here](https://github.com/idf/LeetCode/issues) if you have any feedback. +Welcome to raise an issue [here](https://github.com/algorhythms/LeetCode/issues) if you have any feedback. ### Notes: TLE & MLE -Failed attempts are kept in the source code as documentation, which are annotated as TLE (Time Limit Exceeds) or MLE (Memory Limit Exceeds). +Failed attempts are kept in the source code as documentation, which are annotated as TLE (Time Limit Exceeded) or MLE (Memory Limit Exceeded). +### Disclaimer +The solutions in this repository are personal work, and in any form it neither represents any opinion of nor affiliates to LeetCode Corp.